CN114774443B - Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof - Google Patents

Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof Download PDF

Info

Publication number
CN114774443B
CN114774443B CN202210568493.3A CN202210568493A CN114774443B CN 114774443 B CN114774443 B CN 114774443B CN 202210568493 A CN202210568493 A CN 202210568493A CN 114774443 B CN114774443 B CN 114774443B
Authority
CN
China
Prior art keywords
seq
nucleic acid
acid sequence
parthenolide
saccharomyces cerevisiae
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202210568493.3A
Other languages
Chinese (zh)
Other versions
CN114774443A (en
Inventor
元英进
史一婷
肖文海
董天宇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Tianjin University
Original Assignee
Tianjin University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Tianjin University filed Critical Tianjin University
Priority to CN202210568493.3A priority Critical patent/CN114774443B/en
Publication of CN114774443A publication Critical patent/CN114774443A/en
Application granted granted Critical
Publication of CN114774443B publication Critical patent/CN114774443B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/37—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi
    • C07K14/39—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts
    • C07K14/395—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from fungi from yeasts from Saccharomyces
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/335—Heterocyclic compounds having oxygen as the only ring hetero atom, e.g. fungichromin
    • A61K31/365—Lactones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • A61P35/02—Antineoplastic agents specific for leukemia
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0006—Oxidoreductases (1.) acting on CH-OH groups as donors (1.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/0004—Oxidoreductases (1.)
    • C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
    • C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/10—Transferases (2.)
    • C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
    • C12N9/1205—Phosphotransferases with an alcohol group as acceptor (2.7.1), e.g. protein kinases
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/16—Hydrolases (3) acting on ester bonds (3.1)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/88—Lyases (4.)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P17/00—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms
    • C12P17/18—Preparation of heterocyclic carbon compounds with only O, N, S, Se or Te as ring hetero atoms containing at least two hetero rings condensed among themselves or condensed with a common carbocyclic ring system, e.g. rifamycin
    • C12P17/181—Heterocyclic compounds containing oxygen atoms as the only ring heteroatoms in the condensed system, e.g. Salinomycin, Septamycin
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P5/00—Preparation of hydrocarbons or halogenated hydrocarbons
    • C12P5/007—Preparation of hydrocarbons or halogenated hydrocarbons containing one or more isoprene units, i.e. terpenes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/40—Preparation of oxygen-containing organic compounds containing a carboxyl group including Peroxycarboxylic acids
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
    • C12P7/00—Preparation of oxygen-containing organic compounds
    • C12P7/62—Carboxylic acid esters
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y101/00—Oxidoreductases acting on the CH-OH group of donors (1.1)
    • C12Y101/01—Oxidoreductases acting on the CH-OH group of donors (1.1) with NAD+ or NADP+ as acceptor (1.1.1)
    • C12Y101/01049—Glucose-6-phosphate dehydrogenase (1.1.1.49)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
    • C12Y114/1312—Costunolide synthase (1.14.13.120)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
    • C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
    • C12Y114/13123—Germacrene A hydroxylase (1.14.13.123)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y207/00—Transferases transferring phosphorus-containing groups (2.7)
    • C12Y207/01—Phosphotransferases with an alcohol group as acceptor (2.7.1)
    • C12Y207/01086—NADH kinase (2.7.1.86)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y301/00—Hydrolases acting on ester bonds (3.1)
    • C12Y301/03—Phosphoric monoester hydrolases (3.1.3)
    • C12Y301/03004—Phosphatidate phosphatase (3.1.3.4)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/03012—6-Pyruvoyltetrahydropterin synthase (4.2.3.12)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y402/00—Carbon-oxygen lyases (4.2)
    • C12Y402/03—Carbon-oxygen lyases (4.2) acting on phosphates (4.2.3)
    • C12Y402/03023—Germacrene-A synthase (4.2.3.23)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/10—Plasmid DNA
    • C12N2800/106—Plasmid DNA for vertebrates
    • C12N2800/107—Plasmid DNA for vertebrates for mammalian
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2800/00—Nucleic acids vectors
    • C12N2800/22—Vectors comprising a coding region that has been codon optimised for expression in a respective host

Landscapes

  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • General Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Medicinal Chemistry (AREA)
  • Biotechnology (AREA)
  • Molecular Biology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Mycology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Biophysics (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The invention relates to the field of microbial genetic engineering, in particular to a recombinant saccharomyces cerevisiae strain for producing parthenolide and a construction method thereof. The invention provides a recombinant saccharomyces cerevisiae strain for producing parthenolide and a construction method thereof, wherein a recombinant saccharomyces cerevisiae with high yield of FPP is used as a chassis strain, and four exogenous genes GAS, GAO, COS, PTS are integrated into the chassis strain one by one to obtain strains for producing Ji Maxi A, ji Masuan, costunolide and parthenolide. And screening for enzymes of different origins. The best modification was selected by increasing the supply of NADPH by overexpressing ZWF1 and POS 5.DELTA.17, respectively. After the path enzyme, especially the P450 enzyme, is positioned in the endoplasmic reticulum, the area of the endoplasmic reticulum is expanded by respectively knocking out OPI1 and PAH1 through over-expression of INO2 and HAC1, and the transformation with the best screening effect is realized, so that the yield of parthenolide is greatly increased.

Description

Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof
Technical Field
The invention relates to the field of microbial genetic engineering, in particular to a recombinant saccharomyces cerevisiae strain for producing parthenolide and a construction method thereof.
Background
Parthenolide (Parthenolide) is a sesquiterpene lactone derived from the plant Parthenolide (Tanacetum parthenium). The nucleophilic nature of its methylene gamma-lactone ring and epoxy group makes it potent in inhibiting the activity of nuclear factor κb (Nuclear factor kB, NF- κb), histone deacetylase and interleukin-12, inhibiting many types of cancers such as myeloma, rectal cancer, breast cancer, cervical cancer and prostate cancer, and parthenolide is the first small molecule compound found to selectively destroy acute myelogenous leukemia stem cells. However, due to the low water solubility and poor stability of parthenolide, it cannot achieve the effect equivalent to the dosage to which it is administered. ACT001 is a derivative of parthenolide, which can be rapidly distributed to various tissues after oral administration and can diffuse through the blood brain barrier, and is an effective inhibitor of acute myelogenous leukemia cells and brain glioma cells, and a second-stage clinical test is currently being performed. The main sources of the parthenolide are extracted from plants, but the content of the parthenolide in the plants is not high, the content of the parthenolide in dried parthenols is 0.14-0.74%, and the content of the parthenolide in magnolia bark is 3.1-8.0%. And the plant cultivation needs a large floor space and has a long period. The chemical total synthesis mainly starts from a C10 compound, and has the problems of more reaction steps, low yield, and further consideration of the stereoisomerism and the like. Thus, the current availability of parthenolide is not sustainable and cannot meet increasing market demand. With the development of synthetic biology and the discovery of more genes, microbial cell factories are a very promising direction for the production of parthenolide.
The endogenous pathway of parthenolide biosynthesis is the MVA pathway, and the exogenous pathway starts from farnesyl diphosphate (FPP), and in the first step, FPP is cyclized to Ji Maxi A by Ji Maxi A synthetase (GAS) to form a 10-membered carbocyclic skeleton. In recent years, different GAS has been found from plants such as chicory, lettuce, sunflower and the like. In the second step, C12 methyl Ji Maxi a was oxidized by cytochrome P450 enzyme (P450 enzyme), first Ji Maxi a oxidase (GAO), to Ji Ma acid in three steps, and GAO was isolated from several asteraceae plants. The next catalytic enzyme is costunolide synthase (COS), which hydroxylates the C6 of Ji Ma acid, and then the C6 hydroxyl and C12 carboxyl spontaneously form a lactone ring, yielding costunolide. The final step is the synthesis of parthenolide by the epoxidation of the C4-C5 double bond of costunolide catalyzed by parthenolide synthetase (PTS) derived from parthenolide.
The difficulty in the biosynthesis of parthenolide is mainly in the continuous catalysis of these three P450 enzymes GAO, COS, PTS. Since engineering P450 enzymes is considered a major challenge, manipulation of up to three P450 enzymes in tandem in heterologous microorganisms would clearly be a major obstacle to parthenolide biosynthesis. The de novo biosynthesis of parthenolide in microorganisms has not been fully studied so far. Because there is a need for related studies to construct strains that are able to biosynthesize de novo and that can be enzymatically continuous and produce parthenolide in high yield.
Disclosure of Invention
In view of the above, the technical problem to be solved by the invention is to provide a recombinant saccharomyces cerevisiae strain for producing parthenolide and a construction method thereof.
The present invention provides a gene combination comprising at least two of GAS, GAO, COS and PTS.
The gene combination also comprises at least one of ZWF1, POS5 delta 17, INO2 or HAC1 truncations.
The GAS is a gene encoding Ji Maxi a synthetase, and in the present invention, the sources of the GAS gene include: helianthus annuus, cichorium intybus and/or Lactuca sativa. In some embodiments, the GAS is HaGAS1, haGAS2, ciGAS, or TpGAS. Wherein, the genbank accession number of HaGAS1 is EU439590, after codon optimization is carried out on the gene, the nucleic acid sequence of the HaGAS1 is SEQ ID NO.1; the genbank accession number of HaGAS2 is EU443249, and after codon optimization is carried out on the gene, the nucleic acid sequence of the HaGAS2 is SEQ ID NO.2; the genbank accession number of the CiGAS is AF497999, and after codon optimization is carried out on the CiGAS, the nucleic acid sequence of the CiGAS is SEQ ID NO.3; the genbank accession number of TpGAS is JF819848, and after codon optimization is carried out on the TpGAS, the nucleic acid sequence of the TpGAS is SEQ ID NO.4.
The GAO is a gene encoding Ji Maxi A oxidase, and the sources of the GAO in the invention include: cichorium intybus, lactuca sativa and/or Tanacetum parthenium. In some embodiments, the GAO is CYP71AV8, ciGAO, lsGAO, or TpGAO. Wherein, the genbank accession number of CYP71AV8 is HQ166835, after the invention optimizes the codon, the nucleic acid sequence of CYP71AV8 is SEQ ID NO.5; the genbank accession number of the CiGAO is GU256644, and after the CiGAO is subjected to codon optimization, the nucleic acid sequence of the CiGAO is SEQ ID NO.7; the genbank accession number of LsGAO is GU198171, and after codon optimization is carried out on the gene, the nucleic acid sequence of LsGAO is SEQ ID NO.6; the genbank accession number of TpGAO is KC964544, and after codon optimization is carried out on TpGAO, the nucleic acid sequence of TpGAO is SEQ ID NO.8.
The COS is a gene for encoding costunolide synthase, the COS is a gene for encoding Ji Maxi A oxidase, and the COS sources comprise: cichorium intybus, lactuca sativa and/or Tanacetum parthenium. In some embodiments, the COS is cisco, lsCOS, or TpCOS. Wherein, the genbank accession number of the CiCOS is AEG79727, and after the invention optimizes the codon, the nucleic acid sequence of the CiCOS is SEQ ID NO.9; the genbank accession number of the LsCOS is AEI59780, and after codon optimization is carried out on the LsCOS, the nucleic acid sequence of the LsCOS is SEQ ID NO.10; the genbank accession number of TpCOS is KC964545, and after codon optimization is carried out on the TpCOS, the nucleic acid sequence of the TpCOS is SEQ ID NO.11.
The PTS is a gene encoding parthenolide synthetase, and the source of PTS in the invention comprises Tanacetum parthenium. In some embodiments, the PTS is TpPTS. Wherein, the genbank accession number of TpPTS is KC954155, and after codon optimization is carried out on the gene, the nucleic acid sequence of TpPTS is SEQ ID NO.12.
The present invention finds the best source combination of GAS, GAO, COS, PTS for the synthesis of parthenolide and increases parthenolide yield by modulating 3P 450 enzymes (GAO, COS, PTS) in the pathway.
Further, the present invention increases the supply of NADPH through ZWF1 and POS 5.DELTA.17, thereby increasing the production of parthenolide.
Wherein ZWF1 is a gene encoding glucose-6-phosphate dehydrogenase, which is derived from Saccharomyces cerevisiae (CEN.PK2-1C), accession number is CP020136, and the optimized nucleic acid sequence is shown in SEQ ID NO. 13.
The POS5 delta 17 is a gene encoding NADH kinase, is derived from Saccharomyces cerevisiae (CEN.PK2-1C), has an accession number of CP020138, and an optimized nucleic acid sequence is shown as SEQ ID NO. 14.
Furthermore, the area of the endoplasmic reticulum is expanded by over-expressing INO2, HAC1 and knocking out OPI1 and PAH1, thereby increasing the yield of parthenolide.
Wherein, the INO2 is a gene for encoding a transcription factor related to lipid biosynthesis, and is derived from Saccharomyces cerevisiae (CEN.PK2-1C), the accession number is CP046084, and the optimized nucleic acid sequence is shown in SEQ ID NO. 15.
The HAC1 is a gene for encoding Basic leucine zipper (bZIP) transcription factor, which is derived from Saccharomyces cerevisiae (CEN.PK2-1C) and has the accession number NM_001179935, and is truncated by the invention, and specifically, the nucleic acid sequence after the optimization is truncated, as shown in SEQ ID NO. 16.
OPI1 is a gene for encoding a transcription factor related to lipid biosynthesis, and is derived from Saccharomyces cerevisiae (CEN.PK2-1C), accession number is CP020130, and the optimized nucleic acid sequence is shown as SEQ ID NO. 17.
The PAH1 is a gene for encoding phosphatidic acid phosphatase, is derived from Saccharomyces cerevisiae (CEN.PK2-1C), has the accession number of CP020135, and the optimized nucleic acid sequence is shown as SEQ ID NO. 18.
The invention also provides a gene expression module comprising at least one of the following I) to II):
i) At least one of a GAS, GAO, COS, PTS, ZWF, POS5 delta 17, INO2 or HAC1 truncate, wherein the 5 'end of each gene is connected with a promoter, and the 3' end is connected with a terminator;
II), GAS, GAO, COS, PTS, ZWF, POS 5.DELTA.17, INO2 or HAC1 truncations, each fusion fragment having a promoter attached to the 5 'end and a terminator attached to the 3' end.
The promoter or terminator in the gene expression module is derived from saccharomycetes, wherein: the promoter is GAL promoter, TEF promoter or TDH promoter, selected from GAL1, GAL7, GAL10, GAL1/GAL10, TEF1 or TDH3, and the terminator is selected from GPD, PGK1, TDH1 and TDH2. In some embodiments, the GAS gene promoter comprises GAL1 or GAL10 and the GAS gene terminator comprises GPD;
the GAO gene promoter comprises GAL1 or GAL10, and the GAO gene terminator comprises PGK1;
the COS gene promoter comprises GAL7, and the COS gene terminator comprises TDH1;
the PTS gene promoter comprises GAL7 and TEF1, and the PTS gene terminator comprises TDH2;
the ZWF1 gene promoter comprises TDH3, and the ZWF1 gene terminator comprises TDH1;
the POS5 delta 17 gene promoter comprises TDH3, and the POS5 delta 17 gene terminator comprises TDH1;
the INO2 gene promoter includes TDH3, and the INO2 gene terminator includes TDH1;
the HAC1 truncated gene promoter comprises TDH3, and the HAC1 truncated gene terminator comprises TDH1.
In some embodiments, the gene expression module of the present invention comprises: t (T) GPD -GAS-P GAL10 -P GAL1 、P GAL1 -GAO-T PGK1 、T TDH1 -COS-P GAL7 、P GAL7 -PTS-T TDH2 、P TEF1 -TpPTS-T ADH2 、P TDH3 -ZWF1-T TDH1 、P TDH3 -POS5-T TDH1 、P TDH3 -INO2-T TDH1 Or P TDH3 -HAC1-T TDH1 。
The invention provides an expression vector which comprises a framework vector and the expression module.
The expression vector comprises one or more expression modules. In the embodiment of the invention, the expression modules of GAS, GAO, COS, PTS are positioned on the same expression vector, the expression modules of ZWF1 and POS5 are positioned on the same expression vector, and INO2 or HAC1 are respectively positioned on different expression vectors.
In some embodiments, the expression vector of the invention, wherein the backbone vector comprises a pE 2. Mu. Plasmid, a ygg plasmid 416, a pRS425K plasmid and/or a P450s-RFP plasmid.
The invention also provides a host for transforming or transfecting the expression vector.
Hosts described herein include fungi, bacteria, and algae. In the present invention, the fungus includes yeasts such as, for example, saccharomyces lipolytica, saccharomyces kluyveromyces or Saccharomyces cerevisiae. In some embodiments, transformation of genetically engineered strains is performed using Saccharomyces cerevisiae as an example. In particular, the method comprises the steps of,
the Saccharomyces cerevisiae is selected from CEN.PK series and BY series; in a specific embodiment, the host Chaetomium is a synthetic precursor containing sesquiterpenes and expresses CPR1, CYB5, ADH1 and ALDH1 s. In some embodiments, the host chassis fungus is Saccharomyces cerevisiae CEN.PK2-1C.
Alternatively, the host according to the invention is a mould, for example Streptomyces. Or the host is a bacterium such as E.coli, B.subtilis, etc. In some embodiments, the host described herein overexpresses GAS, GAO, COS, PTS, ZWF1, POS 5.DELTA.17, INO2, and HAC1. Furthermore, OPI1 and PAH1 genes are knocked out in the host according to the invention.
The invention also provides a construction method of the host, which comprises one or more of the following modifications:
1) Transferring one or more than one of GAS, GAO, COS, PTS genes;
2) Overexpression of ZWF1 and/or POS5 from yeast chassis strains;
3) Overexpression of INO2 and/or sheared HAC1;
4) The OPI1 and/or PAH1 is knocked out.
In the present invention, the method of transferring or over-expressing the gene includes plasmid transformation, virus transfection or gene editing by CRISPR/Cas9 system. The method for knocking out the gene comprises gene editing through a CRISPR/Cas9 system.
The invention also provides a process for the preparation of Ji Maxi a, ji Masuan, costunolide and/or parthenolide comprising culturing said host to obtain a culture comprising said Ji Maxi a, ji Masuan, costunolide and/or parthenolide;
or fermenting and culturing the yeast genetic engineering strain obtained by the construction method to obtain a culture containing Ji Maxi A, ji Masuan, costunolide and/or parthenolide.
In the method, in the fermentation medium, the fermentation medium is YPD medium; the fermentation condition in the invention is 250mL shaking flask fermentation, the temperature is 30 ℃, the rotating speed is 220rpm, and the time is 96 hours.
The fermentation further comprises the step of extracting parthenolide from thalli.
The gene combination, the gene expression module, the expression vector, the host prepared by the construction method, the parthenolide prepared by the preparation method and/or the application of the parthenolide-containing culture prepared by the preparation method in preparing medicaments for preventing and treating cancers.
The invention also provides a medicine for preventing and treating cancers, which comprises the parthenolide prepared by the preparation method and/or a culture containing the parthenolide prepared by the preparation method.
The medicament of the invention, wherein the cancer comprises myeloma, rectal cancer, breast cancer, cervical cancer, prostate cancer and/or leukemia.
The leukemias of the present invention include acute leukemia and chronic leukemia, and the acute leukemia includes acute myelogenous leukemia.
The invention provides a recombinant saccharomyces cerevisiae chassis strain with high FPP yield, which comprises the following genes: use of inducible strong promoter P GAL1 ，P GAL10 Over-expression of 8 genes between acetyl-CoA and FPP on the MVA pathway provides sufficient precursors for sesquiterpene synthesis.
The invention also provides the best source combination of genes, haGAS1, ciGAO, lsCOS and TpPTS.
The invention also provides the highest-yield strain SyBE_Sc08140070, and the produced parthenolide has the highest content.
The present invention provides for increased supply of NADPH, overexpression of ZWF1 and POS5, and modulation of the endoplasmic reticulum (resulting in the highest yielding strain).
The parthenolide is a small molecular compound which is discovered to selectively destroy acute myeloid leukemia stem cells.
The invention provides a recombinant saccharomyces cerevisiae strain for producing parthenolide and a construction method thereof, which comprises (1) taking a recombinant saccharomyces cerevisiae with high yield of FPP as a chassis strain, and integrating four exogenous genes GAS, GAO, COS, PTS involved in the exogenous route for synthesizing parthenolide into the chassis strain one by one to obtain the strains for producing Ji Maxi A, ji Masuan, costunolide and parthenolide. And screening for enzymes of different origins, wherein GAS and GAO comprise four origins, respectively, COS comprises three origins, PTS has only one origin, and the recombinant saccharomyces cerevisiae strain with the highest production of parthenolide is screened. (2) By increasing the supply of NADPH by over-expressing ZWF1 and POS5 delta 17, respectively, the best modification was selected, thus increasing the yield of parthenolide. (3) After the positioning of the pathway enzyme, in particular the positioning of the P450 enzyme on the endoplasmic reticulum, the area of the endoplasmic reticulum is expanded by respectively overexpressing INO2 and HAC1 and respectively knocking out OPI1 and PAH1, and the reconstruction with the best screening effect is carried out, so that the yield of the parthenolide is greatly increased.
Drawings
For a clearer description of embodiments of the invention or of the solutions of the prior art, the drawings that are needed in the description of the embodiments or of the prior art will be briefly described, it being obvious that the drawings in the description below are some embodiments of the invention, and that, without the inventive effort, other drawings can be obtained from them to those skilled in the art:
FIG. 1 shows an exogenous route map for the synthesis of parthenolide;
FIG. 2 shows a schematic representation of the insertion of a foreign gene into the pE 2. Mu. Plasmid (exemplified by GAS);
FIG. 3 shows a plot of the results for each product liquid phase;
FIG. 4 shows the results of the production of various intermediates under the catalysis of enzymes of different origins;
FIG. 5 shows an HPLC-MS qualitative plot of parthenolide;
FIG. 6 shows the yield results of the strain increasing NADPH supply;
FIG. 7 shows a fluorescence plot of a pathway enzyme localization assay;
FIG. 8 shows the results of strain control endoplasmic reticulum size yield;
FIG. 9 shows a SyBE_Ec01130235 map;
FIG. 10 shows the results of a 2L fermenter fermentation of SyBE_Sc08140070 strain.
Detailed Description
The invention provides a recombinant saccharomyces cerevisiae strain for producing parthenolide and a construction method thereof, and the technical parameters can be properly improved by a person skilled in the art by referring to the content of the invention. It is expressly noted that all such similar substitutions and modifications will be apparent to those skilled in the art, and are deemed to be included in the present invention. While the methods and applications of this invention have been described in terms of preferred embodiments, it will be apparent to those skilled in the relevant art that the invention can be practiced and practiced with modification and alteration and combination of the methods and applications herein without departing from the spirit and scope of the invention.
Embodiments of the present invention will be described in detail below with reference to examples, but it will be understood by those skilled in the art that the following examples are only for illustrating the present invention and should not be construed as limiting the scope of the present invention. The specific conditions are not noted in the examples and are carried out according to conventional conditions or conditions recommended by the manufacturer. The reagents or apparatus used were conventional products commercially available without the manufacturer's attention.
Example 1 construction of exogenous pathways for the Synthesis of parthenolide in Saccharomyces cerevisiae, which produces FPP, heterologous Synthesis of parthenolide is achieved
The preliminary construction method of the recombinant saccharomyces cerevisiae strain for producing parthenolide is as follows:
1. obtaining recombinant Saccharomyces cerevisiae chassis for high yield of FPP
The strain is SyBE_Sc01130578, provided by Yuan Ying Jib group. The gene included in the recombinant saccharomyces cerevisiae is modified into: use of inducible strong promoter P GAL1 ，P GAL10 Over-expression of 8 genes between acetyl-CoA and FPP on the MVA pathway provides sufficient precursors for sesquiterpene synthesis. In the SyBE_Sc01130578 strain, the editable yeast endogenous plasmid pE2 mu is higher in copy number and stability compared with the traditional 2 mu plasmid, and the exogenous gene can be enabled to have a very high copy number by inserting the exogenous gene into the yeast endogenous plasmid pE2 mu. In addition, CPR1 and CYB5, which also present an artemisia source in the SyBE_Sc01130578 strain, can transfer electrons for the P450 enzyme. They are respectively at P GAL3 And P GAL7 Under the control of the promoter, the gal1/7/10 site and the leu2 site are integrated on the chromosome of the SyBE_Sc01130578 strain. And alcohol dehydrogenase (AaADH 1) and aldehyde dehydrogenase (AaALDH 1) of sweet wormwood origin are also present in the strain, which can aid the oxidation process of Ji Maxi to Ji Ma acids. They are respectively at P GAL3 And P GAL7 Under the control of the promoter, integration is at the gal 80 and his3 sites of the chromosome.
2. Acquisition of exogenous functional Gene elements
Exogenous genes were GAS source Helianthus annuus (HaGAS 1, haGAS 2), cichorium Intybus (CiGAS), tanacetum parthenium (TpGAS), GAO source Cichorium intybus (CYP 71AV8, ciGAO), lactuca sativa (LsGAO), tanacetum parthenium (TpGAO), COS source Cichorium Intybus (CiCOS), lactuca sativa (LsCOS), tanacetum parthenium (TpCOS), PTS source Tanacetum parthenium (TpPTS). After Saccharomyces cerevisiae codon optimization and proper avoidance of common restriction enzyme cutting sites, 5 'ends GCGGCCGCGGTCTCCA and 3' ends TAAAGGAGACCGCGGCCGC are additionally added at two ends of the gene, and the gene is obtained through artificial synthesis.
The nucleic acid sequence of the HaGAS1 is SEQ ID NO.1; the nucleic acid sequence of the HaGAS2 is SEQ ID NO.2; the nucleic acid sequence of the CiGAS is SEQ ID NO.3; the nucleic acid sequence of the TpGAS is SEQ ID NO.4; the nucleic acid sequence of CYP71AV8 is SEQ ID NO.5; the nucleic acid sequence of the LsGAO is SEQ ID NO.6; the nucleic acid sequence of the CiGAO is SEQ ID NO.7; the nucleic acid sequence of TpGAO is SEQ ID NO.8; the nucleic acid sequence of the CiCOS is SEQ ID NO.9; the nucleic acid sequence of the LsCOS is SEQ ID NO.10; the nucleic acid sequence of the TpCOS is SEQ ID NO.11; the nucleic acid sequence of the TpPTS is SEQ ID NO.12; the nucleic acid sequence of ZWF1 is shown in SEQ ID NO. 13; the nucleic acid sequence of the POS5 delta 17 is shown as SEQ ID NO. 14; the nucleic acid sequence of INO2 is shown as SEQ ID NO. 15; the nucleic acid sequence of the sheared HAC1 is shown in SEQ ID NO. 16; the nucleic acid sequence of OPI1 is shown as SEQ ID NO. 17; the nucleic acid sequence of the PAH1 is shown as SEQ ID NO. 18.
3. Construction of recombinant Saccharomyces cerevisiae Strain producing parthenolide
The GAL series inducible strong promoters were designed to express foreign genes, which were inserted onto the pE2 μ plasmid in the chassis strain sybe_sc01130578 using the CRISPR/Cas9 system, respectively.
P GAL1 /P GAL10 As a bi-directional promoter, the expression of two genes can be initiated. As shown in FIG. 2, for convenience, the expression cassette up1-T was constructed by the method of enzyme digestion ligation GPD -T PGK1 Down1, promoter P by cleavage ligation GAL1 /P GAL10 And 4 GSA genes were ligated to the expression cassette to give 4 up1-T GPD -GAS-P GAL10 -P GAL1 -T PGK1 -a down1 fragment. The CRISPR plasmid used for this editing was the laboratory-saved sybe_ec01130235, as shown in fig. 9 (sgRNA sequence TTTACGTAATGACCCGGTAG), and this plasmid and the GAS fragment constructed in step 2 were introduced into the chassis sybe_sc01130578, inserting the GAS gene into the pE2 μ plasmid. The strains SyBE_Sc08140001, syBE_Sc08140002, syBE_Sc08140003 and SyBE_Sc08140004 are obtained. The bacteria with the highest fermentation yield are transformed in the next step.
Design of GAO Gene from P GAL1 Promoter control, haGAS1Gene and GAO Gene were ligated to expression cassettes up1-T GPD -T PGK1 Down1, promoter P by cleavage ligation GAL1 /P GAL10 And 4 GSA genes were ligated to the expression cassette to give 4 up1-T GPD -HaGAS1-P GAL10 -P GAL1 -GAO-T PGK1 -a down1 fragment. The fragment and plasmid SyBE_ec01130235 were co-transformed into SyBE_Sc01130578, yielding SyBE_Sc08140005, syBE_Sc08140006, syBE_Sc08140007 and SyBE_Sc08140008 strains. The bacteria with the highest fermentation yield are transformed in the next step.
Design of COS Gene from P GAL7 The promoter controls insertion into the pE 2. Mu. Plasmid. For convenience, an expression cassette up2-T was constructed TDH1 Down2, COS Gene and promoter P by cleavage ligation GAL7 Ligation to the expression cassette yielded 3 up2-P GAL7 -COS-T TDH1 -a down2 fragment. Construction of the CRISPR plasmid strain was designated as sybe_ec08140067 (host e.coli, sgRNA sequence ttggaacacgcgacctgtcc). The construction method comprises the following steps: the 20bp sgRNA was designed using the tool CRISPOR (website is http:// CRISPOR. Tefor. Net/CRISPOR. Py). Regarding the construction of the plasmid, it was constructed based on the laboratory-preserved strain SyBE_Ec 01130235. The plasmid was cut with PaeI and NotI restriction enzymes, the original sgRNA portion was removed, the new sgRNA was designed on the primer, the plasmid-cut portion was amplified by PCR, and then ligated to the vector by T4 ligase, thus obtaining a new plasmid with a new 20bp sgRNA. The fragment and plasmid SyBE_ec08140067 were co-transformed into SyBE_Sc08140007, yielding SyBE_Sc08140011, syBE_Sc081400012 and SyBE_Sc08140013 strains. The bacteria with the highest fermentation yield are transformed in the next step.
Design of PTS Gene from P GAL7 Promoter and constitutive strong promoter P TEF1 Insertion into the pE2 μ plasmid was controlled. PTS Gene and promoter P by OE-PCR and restriction ligation GAL7 Terminator T TDH2 And the homology arm are connected to obtain up3-P GAL7 -PTS-T TDH2 -a down3 fragment. Construction of the CRISPR plasmid was designated as sybe_ec08140068 (sgRNA sequence CGAGCACTACTGGCTGTAAA). Co-transforming the fragment and plasmid SyBE_Ec08140067 to SyBE_Sc08140012 to obtain SyBE_Sc08140016 and SyBE_Sc08140017 strain.
4. Screening of the strains of the combination of different sources of GAS, GAO, COS, PTS for the highest production of parthenolide
Test materials: strain SyBE_Sc08140001-SyBE_Sc08140017
The test method comprises the following steps:
primary seed culture: inoculating the glycerinum preserved at-80 ℃ into 5mL YPD seed culture medium, and culturing for 16-20 h at 30 ℃ and 220 rpm;
secondary seed culture: at an initial OD 600 =0.1 first seed was transferred to fresh 5mL YPD seed medium, cells were cultured at 30 ℃, 220rpm for 16-20 h;
fermentation: the secondary seeds are pressed to the initial OD 600 =0.1 inoculated in 250mL shake flasks containing 50mLYPD fermentation medium, incubated at 30 ℃, 220rpm for 96h. 10g/L absolute ethanol was added at 24h, 10g/L absolute ethanol was added at 48h, and 10% of the organic phase was used for two-phase culture. For selection of the organic phase, n-dodecane was added to the strains producing Ji Maxi and Ji Ma acids by fermentation, and isopropyl myristate was added to the strains producing costunolide and parthenolide.
The product extraction method comprises the following steps: after fermentation, 1mL of the upper organic phase was removed by pipetting in a 1.5mLEP tube, centrifuged at 12,000rmp for 1min, and filtered through a 0.22 μm organic filter using a 1mL syringe into a clean EP tube. Dilution with methanol 10-20 times was detected by HPLC-PDA. If the sample cannot be detected immediately, the treated sample can be stored in a refrigerator at-20 ℃. The gas quality detection needs to add a proper amount of anhydrous sodium sulfate for water removal, and a part of anhydrous sodium sulfate in the EP pipe after water removal is finished is in a powdery state. After centrifugation at 12,000rmp for 1min, the upper organic phase was removed with a 1ml syringe and filtered through a 0.22 μm organic filter into a clean EP tube. Dilution with n-hexane 20-40 times was detected by GC-MS. If the gas detection cannot be immediately carried out, the treated sample can be stored in a refrigerator at the temperature of minus 20 ℃.
GC-MS detection: the separation was performed using a DB-5MS (30 m. Times.0.25 μm) capillary column. The gas phase conditions were set as follows: the temperature of the column box is 45 ℃, the temperature of the sample inlet is 250 ℃, the sample split ratio is 10, and the flow rate of the column is 1.58ml/min. Heating program: 45 ℃ for 1min;10 ℃/min to 300 ℃ and holding for 5min. The mass spectrometry conditions were set as follows: the ion source temperature is 230 ℃, the interface temperature is 250 ℃, the solvent delay time is 2min, and the scanning m/z is 50-750.
Quantitative detection by HPLC-PDA: the liquid phase instrument used Waters e2695 HPLC. The mobile phase A is acetonitrile, the mobile phase B is 0.1% (v/v%) formic acid water solution, and the total flow rate is 1mL/min; the column temperature was 25deg.C for C18 (Hypersil Gold C18,4.6 mm. Times.150 mm. Times.5 μm) and 194nm for PDA detector setup wavelength; the chromatographic procedure was as follows: initially 65% phase a and 35% phase b, for 5min; gradient adjusting to 100% of phase A and 0% of phase B for 5-12 min, and maintaining for 3min; the gradient was adjusted back to 65% phase A and 35% phase B for 15 min-17 min and maintained for 3min.
HPLC-MS detection: for product characterization, HPLC-MS detection was used, and the mass spectrometer was a Q exact mass spectrometer (Thermo Scientific). The column and mobile and liquid phase conditions were the same as HPLC-PDA but the flow rate was 3 times slower.
Test results: as shown in FIG. 3, each intermediate was detected by HPLC-PDA, and each peak represents Ji Maxi A (peak 1), ji Ma acid (peak 2), costunolide (peak 3) and parthenolide (peak 4), respectively. As shown in fig. 4, the parthenolide standard and sybe_sc08140016 had an ion peak [ m+h ] += 249.15 at the same retention time by HPLC-MS scanning. As shown in FIG. 5, the best source combinations during the stepwise synthesis of parthenolide are HaGAS1, ciGAO, lsCOS and TpPTS. The final yield of parthenolide is up to 2.19mg/L.
Example 2 increasing the supply of NADPH in a Brevibacterium strain producing parthenolide to increase the yield of parthenolide
1. Construction of NADPH-regenerating Strain
For overexpression of ZWF1 and POS5, a constitutive strong promoter P was designed to be used TDH3 To control, and respectively express one more gene at gal1/7/10 locus of SyBE_Sc08140017 genome. For convenience, the expression cassette T is constructed first HXT7 -P TDH3 -T TDH1 ZWF1 (SEQ ID NO: 13) and POS 5.DELTA.17 (SEQ ID NO: 14) were then ligated into the middle of the cassette by seamless cloning to give fragment T HXT7 -P TDH3 -ZWF1-T TDH1 And T HXT7 -P TDH3 -POS5△17-T TDH1 . Construction of the CRISPR plasmid was designated as sybe_ec08140069 (sgRNA sequence GGCGACCTCGATGTCCTCGA). The fragments and plasmids were transferred into yeast SyBE_Sc08140017 to obtain SyBE_Sc08140055 and SyBE_Sc08140056 strains.
2. Screening of NADPH-regenerated Strain for the highest production of parthenolide
Test materials: strain SyBE_Sc08140017, syBE_Sc08140055 and SyBE_Sc08140056
The test method comprises the following steps: the fermentation method and the detection method are the same as in example 1.
Test results:
as shown in FIG. 6, after shake flask fermentation of the newly constructed two strains SyBE_Sc08140055 and SyBE_Sc08140056 and the control strain SyBE_Sc08140017 for 96 hours, the OD of the strains 600 There was no significant difference in the values, indicating that overexpression of ZWF1 and POS5 Δ17 did not reduce cell growth density. Regarding the yields of the products, both the yields of the strains SyBE_Sc08140055 and SyBE_Sc08140056 were increased, and the yields of parthenolide were increased by 75.28% (up to 6.39 mg/L) and 38.11% (up to 5.03 mg/L), respectively. Therefore, the effect of over-expressing ZWF1 is better, and the method is more suitable for producing parthenolide by SyBE_Sc08140017 strain.
Example 3 modulation of endoplasmic reticulum in SyBE_Sc08140055 Strain to further increase production of parthenolide
1. Construction of double fluorescence localization system
And observing the light-emitting conditions of the two proteins in cells through a fluorescence microscope, and if the light-emitting positions coincide well, indicating that the target protein is consistent with the reference protein in positioning. RFP (accession number EU 262302) was ligated to the C-terminus of HaGAS1 and 3P 450 enzymes by BM seamless cloning kit and ligated to ygg 416.416 backbone to give ygg 416.416-P GAL1 -HaGAS1-RFP-T TDH2 、ygg416-T ADH1 -P GAL1 -CiGAO-RFP-T TDH2 、ygg416-T ADH1 -P GAL1 -LsCOS-RFP-T TDH2 、ygg416-P GAL7 -TpPTS-RFP-T TDH2 The plasmid has a Ura auxotroph tag. And seamless through BMThe cloning kit links GFP (accession number CAK 02784) expressed in cytoplasm and endoplasmic reticulum marker protein Sec61-GFP to pRS425K skeleton to obtain pRS425K-T CYC1 -P TDH3 -GFP-T ADH1 、pRS425K-T TDH2 -P GAL1 -Sec61-GFP-T FBA1 The plasmid has a Leu auxotroph tag. Ygg416-P GAL1 -HaGAS1-RFP-T TDH2 With pRS425K-T CYC1 -P TDH3 -GFP-T ADH1 Co-transformation into CEN.PK2-1C, 3P 450s-RFP plasmids were individually transformed with pRS425K-T TDH2 -P GAL1 -Sec61-GFP-T FBA1 Co-transformation into CEN.PK2-1C was performed using Sc-U-L plates.
2. Path enzyme localization analysis
Test materials: strain SyBE_Sc08140057-SyBE_Sc08140060
The test method comprises the following steps: the plasmids with the marked protein and the target protein are respectively provided with Ura and Leu auxotroph labels, single transformant colonies are picked out from the SC-U-L agar plates and inoculated into a culture medium containing 5mL of SC-U-L, and the culture is carried out for 20 to 24 hours at a temperature of 30 ℃ in an incubator at 220rpm to reach a growth index period. Then, the bacterial solution was transferred to a fresh medium containing 5mL of the same, and 10g/L galactose was added for induction, initial OD 600 0.1, and cultured under the same conditions for 48 hours. Then, the red and green fluorescence were observed with a fluorescence microscope (Leica Microsystems CMS GmbH) and treated with LAS X software.
Test results:
as shown in FIG. 7, it was found that HaGAS1-RFP was better aligned with GFP emission sites, and three P450 enzymes were better aligned with Sec61-GFP emission sites, when observed under a fluorescence microscope. The results indicate that in yeast cells, haGAS1 is expressed in the cytoplasm and that three P450 enzymes are localized to the endoplasmic reticulum.
3. Construction of endoplasmic reticulum size-controlling Strain
The study expanded the endoplasmic reticulum by overexpressing INO2 (SEQ ID NO: 15), sheared HAC1 (SEQ ID NO: 16), and knocking out OPI1 (accession number CP 020130) and PAH1 (accession number CP 020135), respectively, in strain SyBE_Sc 08140055. With regard to overexpression of INO2 or sheared HAC1, we designed in constitutive formStrong promoter P TDH3 Is over-expressed with the ygg416 plasmid under control of (a). For convenience, a plasmid SyBE_Ec08140047 was first constructed (ygg 416-T HXT7 -P TDH3 -T TDH1 ) As an expression cassette, the gene was then ligated into the expression cassette by BM seamless cloning kit to give plasmid SyBE_ec08140052 (ygg-T HXT7 -P TDH3 -INO2-T TDH1 ) And SyBE_ec08140053 (ygg 416-T) HXT7 -P TDH3 -HAC1-T TDH1 ) They were transformed into SyBE_Sc08140055 strain, respectively, and screened on SC-U plates to obtain SyBE_Sc08140069 and SyBE_Sc08140070. Ygg416 null plasmid was transformed into SyBE_Sc08140055 as a control. The coding regions of PAH1 and OPI1 were knocked out by CRISPR/Cas9 system. About 500bp fragments are respectively taken before and after the coding region and are connected as left and right homology arms. The CRISPR plasmid was constructed in the same manner as in examples 1 to 3.PAH1 on the thirteen chromosome of yeast, a plasmid SyBE_Ec08140075 (sgRNA sequence TTGCGATCAATTGAACAGAA) was constructed. OPI1 on chromosome eight of yeast, plasmid SyBE_Ec08140074 (sgRNA sequence CGCCAGCGAGCAGTCTATTG) was constructed. The corresponding plasmid and homologous arm fragments are respectively transformed into SyBE_Sc08140055, and SyBE_Sc08140071 and SyBE_Sc08140072 are obtained through screening.
4. Screening of endoplasmic reticulum modified strain with highest production of parthenolide
Test materials: strain SyBE_Sc08140055, syBE_Sc08140068-SyBE_Sc08140072
The test method comprises the following steps: the fermentation and yield test method was the same as in example 1.
Test results:
as shown in FIG. 8, due to the OD of the modified cells 600 Reduced so we use per OD 600 The product yield of the cells is indicative of the effect after engineering. Over-expression of INO2 (SyBE_Sc 08140069) or HAC1 (SyBE_Sc 08140070) significantly increased the production of parthenolide compared to the control strain (SyBE_Sc 08140055 with empty plasmid), wherein SyBE_Sc08140070 gave the highest yield of parthenolide of 0.69mg/L/OD 600 Parthenolide (yield 8.75 mg/L) was further improved by 120.26% compared to the NADPH-supplied strain SyBE_Sc 08140055.
Table 1 data referred to in the drawings of the specification
Table 2: the strains used in this study
*DescriptionofpE2μ:
[raf1(RC)_rep1_FRT(RC)_flp(RC)_rep2_2μori_sopC_sopB(RC)_sopA(RC)
_incC_repE(RC)_ori2_oriV_Cm R _P TDH3 -RFP-T ADH1 _P FBA1 -FBA1-T FBA1 _KanMX6(RC)_T PGI1 (RC)]
EXAMPLE 4 SyBE_Sc08140070 Strain 2L fermenter fermentation to produce product
We carried out fermentation culture in 2L fermenters on the strain SyBE_Sc08140070 with highest yield of parthenolide, and the preparation of seed culture medium was the same as that of shake flask fermentation. Seed medium (100 mL) was inoculated into a 2L fermenter (T & J-Minibox2 L.times.32 parallel bioreactor system) containing 1LFM medium with an initial glucose concentration of 20g/L.
Fermentation conditions and strategies were as follows: by adding 10M NaOH and NH 4 OH mixture, pH was controlled at 5.8. The gas flow was maintained at 1vvm and Dissolved Oxygen (DO) was maintained at 30% by means of a cascade of stirring at 200rpm to 800 rpm. The temperature was maintained at 30 ℃. After 14h of incubation, 10% (v/v) IPM organic phase was aseptically added, and after 70h of incubation, 10% (v/v) IPM organic phase was added. Cell growth and glucose concentration were continuously monitored during fermentation. Adding 600g/L glucose mother liquor into fermentation tank at a rate of 4mL/h, and keeping glucose concentration below 1.0g/L when the initial 20g/L glucose is exhausted. After 70h of cultivation, ethanol was started to be added to the fermenter instead of glucose as a carbon source for the production of the product. In addition, after 14 hours from the start of the culture, 6.0g/L of yeast extract was added to the culture every 12 hours to supplement the nitrogen source, and the fermentation results are shown in FIG. 10.
Results: by the above fermentation conditions, the strain SyBE_Sc08140070 yielded 31.01mg/L parthenolide and 648.45mg/L costunolide. The yields of parthenolide and costunolide were increased by 2.54-fold and 44.38-fold, respectively, compared to the shake flask level results.
Finally, it should be noted that: the above embodiments are only for illustrating the technical solution of the present invention, and not for limiting the same; although the invention has been described in detail with reference to the foregoing embodiments, it will be understood by those of ordinary skill in the art that: the technical scheme described in the foregoing embodiments can be modified or some or all of the technical features thereof can be replaced by equivalents; such modifications and substitutions do not depart from the spirit of the invention.
Sequence listing
<110> university of Tianjin
<120> recombinant Saccharomyces cerevisiae strain for producing parthenolide and construction method thereof
<130> MP22007935
<160> 18
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1680
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 1
atggcagccg tcggtgcatc agctacccct ttaactaata ccaaatccac agcagaacct 60
gtaagaccag tcgctaactt tcctccatca gtttggggtg atttgttttt atccttcagt 120
ttggacaagt ccataatgga agaatacgct gaagcaatgg aagaaccaaa ggaacaagtc 180
agaagattga tcttagatcc tactatggac tctaacaaga agttgtcatt gatctacaca 240
gttcatagat tgggtttaac ctacatgttc ttgaaggaaa tcgaagcaca attggataga 300
ttgttcaagg aattcaactt ggaagattac gttgaattgg acttgtacac tatctctatc 360
aacttccaag ctttcagaca cttgggttac aagttgccat gtgatgtttt caacaaattc 420
aagaacgatg actctactac attcaaggaa tcaataacag gtgatgtcag aggcatgttg 480
ggtttatacg aaagtgctca attgagattg aagggtgaaa acatcttaga tgaagcctct 540
gctttcgcag aaactaagtt gaagtctttg gttaacacat tggaaggttc attagcacaa 600
caagtcaaac aatccttgag aagaccattt catcagggta tgcctatggt tgaagctaga 660
ttgtacttct caaactacca agaagaatgc tccgcccatg atagtatctt gaagttggct 720
aagttgcact tcaactactt gcaattgcaa caaaaggaag aattaagaat agtatctcaa 780
tggtggaagg atatgagatt ccaagaaacc actccatata tcagagacag agttcctgaa 840
atatacttgt ggatcttggg tttatacttc gaaccaagat actctttggc aagaattata 900
gccacaaaaa tcaccttgtt cttagttgtc ttggatgaca cctatgatgc ctacgctact 960
atcgaagaaa tcagattgtt gacagatgca atcaacagat gggacatctc agccatgaac 1020
caaatcccag aatacataag acctttctac aagatattgt tagatgaata cgcagaattg 1080
gaaaaacaat tagccaagga aggtagagct aactctgtta tcgcttcaaa ggaagcattc 1140
caagatatcg ctagaggtta cttggaagaa gcagaatgga caaactccgg ttatgtcgct 1200
agtttcccag aatacatgaa aaatggtttg attacctctg cttacaacgt aatctctaag 1260
tcagcattgg ttggtatggg tgaaattgtc agtgaagatg cattggtatg gtacgaatct 1320
caccctcaaa tcttacaagc ctccgaattg attagtagat tgcaagatga cgtaatgacc 1380
tatcaatttg aaagagaaag aggtcaatcc gctaccggtg ttgatagtta catcaagact 1440
tacggtgtct cagaaaaggt agccatcgac gaattgaaaa agatgatcga aaacgcttgg 1500
aaggaaataa acgaaggttg tttgaagcca agagaagttt ccatggattt gttggcacct 1560
atcttgaact tggccagaat gatcgacgta gtttatagat acgatgacgg ttttactttc 1620
ccaggcaaga cattgaagga atacataaca ttgttatttg ttggttcttc acctatgtaa 1680
<210> 2
<211> 1680
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 2
atggctgctg tcggtgcctc tgctaccttg ttgaccaata ccaaaagtgc cgaagaacct 60
gtaagacctg ttgccaattt ccctccttca gtttggggtg atttgttttt atccttcagt 120
ttggacaact ccatgatgga agaatatgct gaagcaatgg aagaaccaaa gggtcaagtt 180
agaaagttga tcttggatcc tactatggac tccaacaaga agttgagttt gatctacacc 240
gtccatagat tgggtttaac ttacatgttt ttcaaggaaa tcgaaggtca attggataga 300
ttgttcaagg aattcaactt ggaagattac gtcgaagtag acttgtacac aatctcaacc 360
aacttccaag ctttcagaca cttgggttac aagttgagtt gtgatgtatt caacaaattc 420
aagaactacg actctaatac atttaaggaa tccataacca gtgatgttag aggcatgttg 480
ggtttatacg aatcagcaca attgagattg aagggtgaaa agatcttgga tgaagcctcc 540
gctttcaccg aaactaagtt gaagtccttg gtcaagacat tggaaggtag tttagcccaa 600
caagtaaagc aatctttgaa aagaccattt catcagggta tgcctatggt tgaagcaaga 660
ttgtacttct caaactacca agaagaatgc tctagacatg attcattgtt gaagttggct 720
aagttacact tcaactactt gcaattgcaa caaaaggaag aattgagaat agtctctcaa 780
tggtggaagg atatgagatt ccaagaaact acaccatata taagagacag agtacctgaa 840
atctacttgt ggatcttggg tttatacttc gaaccaagat actctttggc cagaataatc 900
gctactaaga tcacattgtt cttagttgtc ttggatgaca cttatgatgc atacgccaca 960
atagaagaag ttagattgtt gactgatgcc atcaacagat gggacatagg tgctatgtca 1020
caaatcccag aatacatcag acctttctac aagatattgt tagatgaata cgctgaattg 1080
gaaaaacaat tagctaagga aggtagagca aactccgtta tcgcaagtaa agaagccttt 1140
caagatattg ctagaggtta tttggaagaa gcagaatgga ctaattctgg ttatgttgca 1200
tcattcccag aatacatgaa aaacggtttg atcacatctg catataatgt catttctaag 1260
tcagccttag ttggtatggg tgaaattgtc tcagaagatg ctttggcatg gtacgaatcc 1320
caccctcaaa tcttgcaagc ttctgaattg atctcaagat tacaagatga cgttatgacc 1380
tatcaatttg aaagagaaag aggtcaaagt gccacaggtg tagatgctta cataaagacc 1440
tacggtgttt ctgaaaagga agctatagac gaattgaaaa agatgatcga aaacgcatgg 1500
aaggaaatca acgaaggttg tttgaagcca agagaagttt ctatggattt gttggcacct 1560
atattgaact tagccagaat gatagacgta gtttatagat acgatgacgg ttttaccttc 1620
ccaggcaaga ctttgaagga atacatcaca ttgttatttg ttggttcttc acctatgtaa 1680
<210> 3
<211> 1752
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 3
atggctttag ttagaaataa ttcatccaac ggtagagaac cagttttgtc cccaagatca 60
ttgacttccc caagaggttt gacttcacct agaccattgt cagtccaacc tactccagaa 120
cctgtaagac cattagcaaa ttttccacct tccatctggg ccgatagatt catctctttc 180
tcattggaca acagtcaatt agaagcttat gcaaacgcct tggaagaacc taaagaagcc 240
gttaagtctt tgataaccga tactacaatc gacgctaaca ctaagttgaa gttgatctac 300
tctgttcata gattgggttt atcatacttg tacccagatg aaatcgacgc agaattgaac 360
aagttgttcg aaaagatcga tttgcaatac tacgaacaag ttgacttgta cacaatcgct 420
gtccaatttc aagtattcag acatcacggt tacaagatat cttcagatgt tttcaagaag 480
ttcaaggact ctaccactgg tactttcaca gatgacgtta ctaaagatgt caagggcatg 540
ttgtctttgt acgaatcagc tcatttgaga ttgcacggtg aagatatatt ggacgaagct 600
ttggcattca cagaagcaca tttaaaaaag atcttgacaa ccttggaggg tgatttggcc 660
agacaagtaa accaagtttt gaaaagacca ttccacactg gtatgcctat ggttgaagca 720
agattgtact tcatcaccca tgaagaagat ttctccagtc acgaatctgt tgtcaaatta 780
gctaaggtcc atttcaacta cttgcaattg caacaaaagg aagaattgag attagtatcc 840
caatggtgga aggatatgca attccaacaa agtgttccat acataagaga tagagtccct 900
gaaatctact tgtggatctt gggtttatac tttgaaccat attactcaag agccagaata 960
atcgctacca agatcacttt gttcttagta gttttggatg acacttacga tgcctacgct 1020
acaatcgacg aaataagatc tatcactgat gctatcaaca gatgggaaat ctcagcaatt 1080
gaccaattgc cagaatacat caagcctttc tacagaatct tgttgaacga atacgatgac 1140
ttggaaaagg aatactccaa ggatggtaga gcattttccg ttcatgcaag taaacaagcc 1200
ttccaagaaa ttgccagagg ttatttggaa gaagctgaat ggttacacaa tggttatgtt 1260
gctactttcc cagaatacat gaagaacggt ttgataacat ctgcctataa cgtaatatcc 1320
aagagtgctt tagttggtat gggtgcaatt gccgatgaag aagctttggc atggtacgaa 1380
actcatccta agatcttgaa ggcttctgaa ttgatctcaa gattgcaaga tgacgttatg 1440
acctttcaat tcgaaagaaa aagaggtcaa tctgctactg gtgtcgatgc atacatcaag 1500
gaatacaacg tatcagaaga agttgctatc aaggaattga tgaagatgat cgaaaatgca 1560
tggaaggata taaacgaagg ttgtttgaag ccaacagaag tttctgtcgc attgttaacc 1620
cctatattga atttagccag aatgatcgat gtcgtataca agttcgatga cggtttcaca 1680
ttcccaggca agaccttgaa ggattacatc acattgttgt tcgtttcccc acctccaagt 1740
ttagaaaact aa 1752
<210> 4
<211> 1680
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 4
atggctgcag ttcaagctac tacaggtatt caagcaaata ctaaaacatc tgctgaacca 60
gttagaccat tagctaattt tccaccatca gtttggggtg acagattttt gtctttttca 120
ttggataagt ctgaattcga aagatacgct atcgcaatgg aaaagccaaa ggaagatgtt 180
agaaagttga ttgttgattc tactatggat tcaaacgaaa agttgggttt aatctattca 240
gttcatagag ttggtttaac atacatgttc ttgcaagaaa tcgaatctca attggataag 300
ttgtttaatg aattttcatt acaagattat gaagaagttg atttgtacac tatctctatt 360
aatttccaag tttttagaca tttgggttac aaattgccat gtgatgtttt taaaaagttt 420
aaagatgcta tctctggtac ttttaaagaa tctatcacat cagatgttag aggcatgttg 480
ggtttatacg aatcagcaca attgagaatc agaggtgaaa agattttgga tgaagcttct 540
gtttttattg agggtaaatt gaagtcagtt gttaacactt tggagggtaa tttggcacaa 600
caagttaagc aatctttgag aagaccattt catcagggta tgccaatggt tgaagctaga 660
ttgtacttct ctaactacga agaagaatgt tcttcacatg attcattgtt taaattggct 720
aagttgcatt tcaagtattt ggaattacaa caaaaagaag aattaagaat tgttacaaag 780
tggtacaagg atatgagatt ccaagaaact acaccataca tcagagatag agttccagaa 840
atatatttgt ggatcttggg tttatacttc gaaccaagat actctttggc tagaatcatc 900
gcaactaaga tcacattgtt tttagttgtt ttggatgata cttatgatgc ttacgcaaca 960
atcgaagaaa tcagattatt gactgatgca atgaataagt gggatatttc agctatggaa 1020
caaattccag aatacatcag accattctac aaggttttgt tggatgaata cgctgaaatc 1080
ggtaaaagaa tggctaaaga aggtagagca gatacagtta ttgcttctaa ggaagcattc 1140
caagatattg caagaggtta tttggaagaa gctgaatgga ctaattctgg ttatgttgct 1200
tcatttccag aatacatgaa gaacggttta atcacatcag catacaacgt tatttctaaa 1260
tcagctttgg ttggtatggg tgaaattgtt tctgaagatg ctttagcatg gtacgaatca 1320
catccaaaac cattgcaagc ttctgaattg atctcaagat tgcaagatga tgttatgaca 1380
taccaattcg aaagagaaag aggtcaatct gctactggtg ttgatgcata catcaagaca 1440
tacggtgttt cagaaaagaa agcaatcgat gaattgaaga tcatgatcga aaacgcttgg 1500
aaggatatca acgaaggttg tttgaagcca agacaagttt ctatggattt gttggcacca 1560
atcttgaatt tggctagaat gatcgatgtt gtttacagat acgatgatgg ttttactttt 1620
ccaggttcta cattaaaaga atatattaat ttgttatttg ttgattcatt gccagtttaa 1680
<210> 5
<211> 1491
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 5
atggaaattt ctattccaac tactttgggt ttggctgtta ttatttttat tatttttaaa 60
ttgttgacta gaactacttc taaaaaaaat ttgttgccag aaccatggag attgccaatt 120
attggtcata tgcatcattt gattggtact atgccacata gaggtgttat ggaattggct 180
agaaaacatg gttctttgat gcatttgcaa ttgggtgaag tttctactat tgttgtttct 240
tctccaagat gggctaaaga agttttgact acttatgata ttacttttgc taatagacca 300
gaaactttga ctggtgaaat tgttgcttat cataatactg atattgtttt ggctccatat 360
ggtgaatatt ggagacaatt gagaaaattg tgtactttgg aattgttgtc taataaaaaa 420
gttaaatctt ttcaatcttt gagagaagaa gaatgttgga atttggttaa agatattaga 480
tctactggtc aaggttctcc aattaatttg tctgaaaata tttttaaaat gattgctact 540
attttgtcta gagctgcttt tggtaaaggt attaaagatc aaatgaaatt tactgaattg 600
gttaaagaaa ttttgagatt gactggtggt tttgatgttg ctgatatttt tccatctaaa 660
aaattgttgc atcatttgtc tggtaaaaga gctaaattga ctaatattca taataaattg 720
gataatttga ttaataatat tattgctgaa catccaggta atagaacttc ttcttctcaa 780
gaaactttgt tggatgtttt gttgagattg aaagaatctg ctgaatttcc attgactgct 840
gataatgtta aagctgttat tttggatatg tttggtgctg gtactgatac ttcttctgct 900
actattgaat gggctatttc tgaattgatt agatgtccaa gagctatgga aaaagttcaa 960
actgaattga gacaagcttt gaatggtaaa gaaagaattc aagaagaaga tttgcaagaa 1020
ttgaattatt tgaaattggt tattaaagaa actttgagat tgcatccacc attgccattg 1080
gttatgccaa gagaatgtag agaaccatgt gttttgggtg gttatgatat tccatctaaa 1140
actaaattga ttgttaatgt ttttgctatt aatagagatc cagaatattg gaaagatgct 1200
gaaactttta tgccagaaag atttgaaaat tctccaatta ctgttatggg ttctgaatat 1260
gaatatttgc catttggtgc tggtagaaga atgtgtccag gtgctgcttt gggtttggct 1320
aatgttgaat tgccattggc tcatattttg tattatttta attggaaatt gccaaatggt 1380
aaaacttttg aagatttgga tatgactgaa tcttttggtg ctactgttca aagaaaaact 1440
gaattgttgt tggttccaac tgattttcaa actttgactg cttctactta a 1491
<210> 6
<211> 1467
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 6
atggaattat ctattacaac atctatcgca ttggctacta tcgtcttttt cttatacaag 60
ttagcaacca gacctaaatc aaccaagaag caattgccag aagcttcaag attacctatt 120
ataggtcata tgcatcactt aatcggtact atgccacaca gaggtgttat ggatttggca 180
agaaagcatg gttcattaat gcacttgcaa ttgggtgaag tttccacaat agttgtctct 240
tcaccaaaat gggcaaagga aatcttgact acatacgata tcaccttcgc caatagacct 300
gaaaccttaa ctggtgaaat cattgcatac cataacactg acattgtttt ggccccatat 360
ggtgaatact ggagacaatt gagaaagttg tgtactttgg aattgttgtc agtcaaaaag 420
gttaagtcct tccaaagtat cagagaagaa gaatgctgga atttggttaa agaagtcaag 480
gaatccggta gtggcaagcc tatcaacttg tctgaatcaa tcttcactat gatagctaca 540
atcttatcca gagctgcatt tggtaaaggt ataaaggatc aaagagaatt cactgaaatc 600
gtaaaggaaa tcttgagaca aacaggtggt ttcgatgttg ccgacatttt tccatctaaa 660
aagttcttgc atcacttatc aggtaaaaga gctagattga catccatcca taagaagttg 720
gataacttga tcaacaacat agtagccgaa catcacgtta gtacatccag taaagctaat 780
gaaaccttgt tagatgtctt gttaagattg aaggactctg cagaattccc attgacagct 840
gataacgtaa aggcaatcat cttggatatg ttcggtgccg gtacagacac ctcttcagcc 900
accgttgaat gggctatttc tgaattgata agatgtccta gagctatgga aaaagtccaa 960
gcagaattga gacaagcctt gaacggcaag gaaaagatcc aagaagaaga tatccaagac 1020
ttggcatact tgaacttggt tataagagaa accttaagat tgcatccacc tttaccattg 1080
gtcatgccta gagaatgcag agaaccagta aatttggctg gttacgaaat agcaaacaag 1140
acaaagttga tcgtaaatgt ttttgctatt aacagagatc ctgaatactg gaaagacgca 1200
gaagccttta taccagaaag attcgaaaac aaccctaaca acatcatggg tgctgattat 1260
gaatacttac catttggtgc aggtagaaga atgtgtcctg gtgccgcttt aggtttggcc 1320
aatgttcaat taccattggc taacatattg taccatttca actggaagtt acctaacggt 1380
gctagtcacg atcaattgga catgactgaa tcttttggtg caaccgttca aagaaagact 1440
gaattgttgt tggtcccatc tttctaa 1467
<210> 7
<211> 1467
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 7
atggaattga gtttgacaac atctattgcc ttagccacca tcgttttgat attatacaag 60
ttagccacaa gaccaaagag taacaagaaa agattaccag aagcttctag attgcctatt 120
ataggtcata tgcatcactt gatcggtact atgccacaca gaggtgttat ggaattagca 180
agaaaacatg gttccttgat gcacttgcaa ttaggtgaag ttagtacaat tgttgtctct 240
tcaccaaagt gggcaaagga aatcttgact acatacgata tcacctttgc caatagacct 300
gaaaccttga ctggtgaaat cattgcatac cataacactg acattgtttt agccccatat 360
ggtgaatact ggagacaatt gagaaagttg tgtactttgg aattgttgtc cgtcaaaaag 420
gttaagagtt tccaatctat cagagaagaa gaatgctgga atttagttaa agaagtcaag 480
gaatccggta gtggcaagcc tatctctttg tcagaatcca tcttcaagat gatcgctaca 540
atcttgtcta gagctgcatt tggtaaaggt ataaaggatc aaagagaatt cactgaaatc 600
gtaaaggaaa tcttgagaca aacaggtggt ttcgatgttg ccgacatatt cccatcaaaa 660
aagttcttgc atcacttgtc cggtaaaaga gcaagattga caagtatcca taagaagttg 720
gataccttga tcaataacat tgtagccgaa catcacgttt ctacctccag taaggctaac 780
gaaactttgt tggatgtctt gttgagattg aaggactcag ctgaatttcc tttgacagct 840
gataacgtaa aggcaatcat cttggatatg ttcggtgcag gtacagacac ctcttcagcc 900
accgttgaat gggctatatc tgaattgatc agatgtccaa gagctatgga aaaagtccaa 960
gcagaattaa gacaagcctt gaatggcaag gaacaaatcc atgaagaaga tattcaagac 1020
ttgccttact tgaacttggt tatcagagaa accttgagat tgcatccacc tttgccatta 1080
gtcatgccta gagaatgcag agaaccagta aacttggctg gttacgaaat cgcaaacaag 1140
acaaagttga tcgtaaacgt tttcgctatc aacagagatc ctgaatactg gaaagacgca 1200
gaagccttta taccagaaag attcgaaaac aaccctaaca acatcatggg tgctgattat 1260
gaatacttgc catttggtgc aggtagaaga atgtgtcctg gtgccgcttt gggtttagcc 1320
aacgttcaat tgccattggc taacatcttg taccatttca actggaagtt gcctaacggt 1380
gcttctcacg atcaattaga catgactgaa tcatttggtg caactgttca aagaaagaca 1440
gaattgatct tggtcccatc attctaa 1467
<210> 8
<211> 1467
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 8
atggctttat ctttgactac atcaatcgct ttggcaacta tcttgttttt cgtttacaag 60
ttcgcaacta gatctaagtc aactaaaaat tcattgccag aaccatggag attgccaatc 120
atcggtcata tgcatcattt gattggtact attccacata gaggtgttat ggatttggct 180
agaaagtacg gttcattaat gcatttgcaa ttgggtgaag tttctacaat cgttgtttct 240
tcaccaaagt gggctaagga aatcttgact acatacgata tcactttcgc aaacagacca 300
gaaactttaa caggtgaaat cgttgcttac cataacacag atattgtttt ggcaccatat 360
ggtgaatact ggagacaatt gagaaagttg tgtactttgg aattgttatc tgttaagaaa 420
gttaaatctt ttcaatcatt gagagaagaa gaatgttgga atttggttca agaaattaaa 480
gcttctggtt caggtagacc agttaatttg tcagaaaaca tttttaagtt gattgcaaca 540
attttatcta gagctgcatt tggtaaaggt attaaagatc aaaaggaatt cactgaaatt 600
gttaaagaaa ttttgagaca aacaggtggt ttcgatgttg ctgatatctt cccatctaag 660
aaattcttgc atcatttgtc aggtaaaaga gcaagattaa cttctattca tcaaaagttg 720
gataatttga ttaataattt ggttgctgaa catactgtta agacatcttc aaagactaac 780
gaaacattgt tagatgtttt gttgagattg aaggattcag ctgaattccc attgactgct 840
gataacgtta aggcaatcat cttggatatg tttggtgcag gtactgatac atcttcagct 900
acaatcgaat gggcaatctc tgaattgatt aaatgtccaa gagctatgga aaaggttcaa 960
gttgaattga gaaaggcatt aaatggtaaa gaaagaattc atgaagaaga tatccaagaa 1020
ttgtcttatt tgaatttggt tattaaagaa acattgagat tgcatccacc attaccattg 1080
gttatgccaa gagaatgtag acaaccagtt aatttggctg gttacgatat cccaaataag 1140
actaagttga tcgttaacgt tttcgctatt aatagagatc cagaatactg gaaagatgca 1200
gaaactttta ttccagaaag attcgaaaac tcttcaacta cagttatggg tgctgaatat 1260
gaatacttgc catttggtgc aggtagaaga atgtgtccag gtgctgcatt aggtttggct 1320
aatgttcaat taccattggc aaacatcttg taccatttca actggaagtt gccaaacggt 1380
gcttcatacg atcaaatcga tatgactgaa tcttttggtg caactgttca aagaaagaca 1440
gaattgttgt tggttccatc tttttaa 1467
<210> 9
<211> 1485
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 9
atggaacctt tgactattgt atccttggtc gttgcttcat tatttttatt tgctttttgg 60
gcattatcac ctaagacatc taagaattta ccacctggtc cacctaagtt gccaataatc 120
ggtaacatac atcaattgaa gtctccaaca cctcacagag tattgagaaa cttggctaga 180
aagtacggtc caatcatgca tttgcaatta ggtcaagtta gtactgttgt cgtatctaca 240
cctagattgg ccagagaaat catgaagact aacgacataa gttttgctga tagaccaact 300
acaaccactt ctcaaatttt cttttataag gctcaagata taggttgggc accttatggt 360
gaatactgga gacaaatgaa aaagatttgt acattggaat tgttgtcagc taaaaaggtt 420
cgttcctttt cttcaatcag agaagaagaa ttgtccagaa tcagtaaggt cttggaatct 480
caagcaggta ctccaatcaa tttcaccgaa atgactgttg aaatggtcaa caacgtaatt 540
tgtaaggcta ctttgggtga ctcttgcaag gatcaagcaa cattgatcga agttttgtac 600
gatgtcttga agactttgag tgccttcaac ttggcttctt actaccctgg tttgcaattc 660
ttgaacgtca tcttgggtaa aaaggctaag tggttgaaga tgcaaaagca attggatgac 720
atcttggaag atgttttgaa ggaacacaga tctaagggtt caaataaatc cgatcaagaa 780
gacttagtcg atgtattgtt aagagttaag gacacaggtg gtttggattt tacagtaacc 840
gacgaacatg ttaaagccgt tgtcttggat atgttaaccg ctggtactga cacatccagt 900
gcaaccttag aatgggccat gactgaattg atgagaaatc cacacatgat gaagagagca 960
caagatgaag ttagatcagt agttaagggt aacaccataa ctgaaacaga tttgcaatcc 1020
ttgcattact tgaagttgat cgttaaggaa acattgagat tacacgcacc aacccctttg 1080
ttagtcccaa gagaatgtag acaagattgc aatgtagacg gttacgatat acctgccaaa 1140
accaagatct tagttaacgc ttgggcatgt ggtactgatc cagactcatg gaaagatcca 1200
gaatccttca tacctgaaag attcgaaaac tgccctataa actacatggg tgcagatttt 1260
gaattcatac catttggtgc cggtagaaga atctgtcctg gtttaacatt cggtttgtca 1320
atggttgaat atccattagc caatttcttg taccatttcg attggaagtt accaaacggt 1380
ttgaaacctc acgaattgga catcacagaa ataaccggta tctctacttc attgaagcat 1440
caattgaaga tcgttccaat gattcctaag tctatagcaa aataa 1485
<210> 10
<211> 1473
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 10
atggaaccat tgactattgt ctcattggct gtcgcttcat tcttgttatt cgccttctgg 60
gcattatccc ctaaaacttc taaaaattta ccacctggtc cacctaagtt gccaataatc 120
ggtaacatac atcaattgaa gtctccaaca cctcacagag tattgagaaa cttggctaaa 180
aagtacggtc caataatgca tttgcaatta ggtcaagttt ccactgttgt cgtaagtaca 240
cctagattgg caagagaaat aatgaagact aatgacatct cctttgccga tagaccaact 300
acaaccacta gtcaaatctt tttctacaag gctcaagata ttggttgggc accttatggt 360
gaatactgga gacaaatgaa aaagatttgt acattggaat tgttgtccgc taaaaaggtt 420
cgtagtttct cttcaatcag agaagaagaa ttaagaagaa tctctaaggt cttggaatca 480
aaagcaggta ctccagtaaa tttcaccgaa atgactgttg aaatggtcaa caacgtaatt 540
tgtaaggcta ctttgggtga ctcatgcaag gatcaagcaa cattgatcga agttttgtac 600
gatgtcttga agactttgtc tgccttcaac ttggcttcat actaccctgg tttgcaattc 660
ttgaacgtca tcttgggtaa aaaggctaag tggttgaaga tgcaaaagca attggatgac 720
atcttggaag atgtattgaa ggaacacaga tccaagggta gaaacaagag tgatcaagaa 780
gacttggtcg atgtattgtt aagagttaag gacacaggtg gtttggattt tacagtaacc 840
gacgaacatg ttaaagccgt tgtcttggat atgttaaccg ctggtactga cacatccagt 900
gcaaccttag aatgggccat gactgaattg atgagaaacc cacacatgat gaagagagcc 960
caagaagaag ttagatctgt agttaaaggt gataccataa ctgaaacaga cttgcaatca 1020
ttgcattact tgaagttgat cgtcaaggaa acattgagat tgcacgcacc aacccctttg 1080
ttagttccaa gagaatgtag acaagcctgc aatgtcgacg gttacgatat tcctgctaaa 1140
accaagatat tggttaacgc ttgggcatgt ggtactgatc cagactcttg gaaagatgct 1200
gaatcattca tcccagaaag attcgaaaac tgccctatta actacatggg tgcagatttt 1260
gaattcattc catttggtgc cggtagaaga atatgtcctg gtttaacatt cggtttgtcc 1320
atggttgaat acccattggc aaatttcttg taccatttcg attggaagtt accaaacggt 1380
ttgaaacctc acgaattgga tatcacagaa atcaccggta tctctacttc attgaagcat 1440
caattgaaga tcgttcctat tttgaaatct taa 1473
<210> 11
<211> 1491
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 11
atggaacctt ttactatttt ctctttggtt gttgcttcat tagttttctt tgcttgttgg 60
gcattggttg ctccaaacac atctaaaaat ttgccaccag gtccaccaaa attaccaatc 120
atcggtaaca tccatcaatt gaagtcacca actccacata gagttttgaa ggatttggct 180
aagaaatacg gtccaatcat gcatttgcaa ttgggtcaag tttctactgt tgttgtttca 240
acaccaagat tggcacaaga aatcatgaag acaaacgata tctcttttgc tgatagacca 300
actacaacta catcacaaat tttcttttat aaagcacaag atattggttg ggctccatat 360
ggtgaatact ggagacaaat gaagaaaatt tgtactttgg aattgttgtc tgctaagaaa 420
gttagatcat tttcttcaat cagagaagaa gaattgacta gaatcagaaa gatcttggaa 480
ttcaaagctg gtacaccaat taattacact gaaatgacaa tcgaaatggt taataatgtt 540
atttgtaaag caactttggg tgactgttgt aaagatcaag ctttgttgat cgaattgttg 600
tacgatgttt tgaagacatt gtctgctttt aatttggctt catactaccc aagattgcaa 660
ttcttgaacg ttatctctgg taaaaaggct aagtggttga agatgcaaaa gagattggat 720
gatatcatgg aagatatctt gaaggaacat agagcaaagg gtagagctaa aaattctgat 780
caagaagatt tggttgatgt tttgttgaga attaaagata ctggtggttt agatatcaac 840
gttacagatg aacatgttaa ggcagttgtt ttggatatgt tgactgctgg tactgataca 900
tcttcaacta cattggaatg ggcaatgaca gaattgatga gaaacccaga tatgatgaag 960
agagctcaag aagaagttag atctgttgtt aaaggtgaac atgttactga aacagatttg 1020
caatcattgc attatttgaa gttgatcgtt aaagaaacta tgagattgca tgcaccaaca 1080
ccattgttag ttccaagaga atgtagacaa gattgtaatg ttgatggtta cgatatccca 1140
gctaagacta aggttttggt taacgcttgg gcatgtggtg ttgatccagg ttcttgggaa 1200
aacccagatt cttttattcc agaaagattc gaaaactctt caattaattt catgggtgca 1260
gatttccaat atattccatt tggtgctggt agaagaattt gtccaggttt gacattcggt 1320
ttatctatgg ttgaataccc attggcacat ttcttgtacc atttcgattg gaagttgcca 1380
tacggtatga aaccacatga attggatatc actgaaatca ctacaatctc tacatcattg 1440
aaacatcatt tgaagatcgt tccattccca aagtcttcat tagctaaata a 1491
<210> 12
<211> 1521
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 12
atggatactt caacatcttt cccatcatta tttttgccaa ctttatgtac aatcttgatc 60
tcttacatca ttattaagta cgttttaatt tggaatagat cttcaatggc tgcttttaat 120
ttgccaccat caccaccaaa attgccaatt attggtaata ttcatcatgt tttctctaaa 180
aatgttaacc aaacattgtg gaaattgtct aagaaatacg gtccagttat gttgatcgat 240
actggtgcta agtcattttt ggttgtttct tcatctcaaa tggcaatgga agttttgaag 300
actcatcaag aaatcttgtc aacaagacca tctaacgaag gtactaagag attgtcatac 360
aacttctctg atattacatt ttctccacat ggtgaccatt ggagagatat gagaaaggtt 420
ttcgttaacg aattcttagg tccaaaaaga gctggttggt ttaatcaagt tttgagaatg 480
gaaattaaag atgttattaa taatttgtca tctaatccat tgaatacttc tattaatttg 540
aatgaaatgt tgttgtcttt ggtttacaga gttgtttgta agttcgcatt cggtaaatca 600
tacagagaag aaccttttaa tggtgttaca ttgaaggaaa tgttggatga atctatggtt 660
gttttagctg gttcatctgc agatatgttc ccaactttcg gttggatctt ggataagttg 720
tacggttgga acgatagatt ggaaaagtgt ttcggtaatt tggatggttt ctttgaaatg 780
attattaacg aacatttgca atcagcttct gaaacatctg aagatgaaaa ggatttcgtt 840
cattcattgg ttgaattgtc tttgaaggat ccacaattca ctaaggatta catcaaggct 900
ttgttgttga acgttttgtt gggtgcaatc gatactactt ttactacaat cgtttgggct 960
atgtcagaaa tcgttaaaaa tacacaagtt atgcaaaagt tgcaaactga aatcagatct 1020
tgtatcggta gaaaggaaga agttgatgct actgatttga caaatatggc atatttgaag 1080
atggttatta aagaaacatt gagattgcat ccaccagctc cattattgtt tccaagagaa 1140
tgtccatcac attgtaagat cggtggttac gatgtttttc caggtacttg tgttgttatg 1200
aatggttggg gtattgcaag agatccaaac gtttggaagg aaatcccaaa cgaattctac 1260
ccagaaagat tcgaaaactt caacatcgat ttcttgggta atcattgtga aatgattcca 1320
tttggtgctg gtagaagatc ttgtcctggt atgaagtcag caacttctac aatcgaattc 1380
actttggtta atttgttgta ctggtttgat tgggaagttc catctggtat gaacaaccaa 1440
gatttggata tggaagaaga tggtttcttg gttattcaaa agaaatctcc attgtttttg 1500
attccaatta aacatattta a 1521
<210> 13
<211> 1518
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 13
atgagtgaag gccccgtcaa attcgaaaaa aataccgtca tatctgtctt tggtgcgtca 60
ggtgatctgg caaagaagaa gacttttccc gccttatttg ggcttttcag agaaggttac 120
cttgatccat ctaccaagat cttcggttat gcccggtcca aattgtccat ggaggaggac 180
ctgaagtccc gtgtcctacc ccacttgaaa aaacctcacg gtgaagccga tgactctaag 240
gtcgaacagt tcttcaagat ggtcagctac atttcgggaa attacgacac agatgaaggc 300
ttcgacgaat taagaacgca gatcgagaaa ttcgagaaaa gtgccaacgt cgatgtccca 360
caccgtctct tctatctggc cttgccgcca agcgtttttt tgacggtggc caagcagatc 420
aagagtcgtg tgtacgcaga gaatggcatc acccgtgtaa tcgtagagaa acctttcggc 480
cacgacctgg cctctgccag ggagctgcaa aaaaacctgg ggcccctctt taaagaagaa 540
gagttgtaca gaattgacca ttacttgggt aaagagttgg tcaagaatct tttagtcttg 600
aggttcggta accagttttt gaatgcctcg tggaatagag acaacattca aagcgttcag 660
atttcgttta aagagaggtt cggcaccgaa ggccgtggcg gctatttcga ctctataggc 720
ataatcagag acgtgatgca gaaccatctg ttacaaatca tgactctctt gactatggaa 780
agaccggtgt cttttgaccc ggaatctatt cgtgacgaaa aggttaaggt tctaaaggcc 840
gtggccccca tcgacacgga cgacgtcctc ttgggccagt acggtaaatc tgaggacggg 900
tctaagcccg cctacgtgga tgatgacact gtagacaagg actctaaatg tgtcactttt 960
gcagcaatga ctttcaacat cgaaaacgag cgttgggagg gcgtccccat catgatgcgt 1020
gccggtaagg ctttgaatga gtccaaggtg gagatcagac tgcagtacaa agcggtcgca 1080
tcgggtgtct tcaaagacat tccaaataac gaactggtca tcagagtgca gcccgatgcc 1140
gctgtgtacc taaagtttaa tgctaagacc cctggtctgt caaatgctac ccaagtcaca 1200
gatctgaatc taacttacgc aagcaggtac caagactttt ggattccaga ggcttacgag 1260
gtgttgataa gagacgccct actgggtgac cattccaact ttgtcagaga tgacgaattg 1320
gatatcagtt ggggcatatt caccccatta ctgaagcaca tagagcgtcc ggacggtcca 1380
acaccggaaa tttaccccta cggatcaaga ggtccaaagg gattgaagga atatatgcaa 1440
aaacacaagt atgttatgcc cgaaaagcac ccttacgctt ggcccgtgac taagccagaa 1500
gatacgaagg ataattag 1518
<210> 14
<211> 1197
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 14
atgagtacgt tggattcaca ttccctaaag ttacagagcg gctcgaagtt tgtaaaaata 60
aagccagtaa ataacttgag gagtagttca tcagcagatt tcgtgtcccc accaaattcc 120
aaattacaat ctttaatctg gcagaaccct ttacaaaatg tttatataac taaaaaacca 180
tggactccat ccacaagaga agcgatggtt gaattcataa ctcatttaca tgagtcatac 240
cccgaggtga acgtcattgt tcaacccgat gtggcagaag aaatttccca ggatttcaaa 300
tctcctttgg agaatgatcc caaccgacct catatacttt atactggtcc tgaacaagat 360
atcgtaaaca gaacagactt attggtgaca ttgggaggtg atgggactat tttacacggc 420
gtatcaatgt tcggaaatac gcaagttcct ccggttttag catttgctct gggcactctg 480
ggctttctat taccgtttga ttttaaggag cataaaaagg tctttcagga agtaatcagc 540
tctagagcca aatgtttgca tagaacacgg ctagaatgtc atttgaaaaa aaaggatagc 600
aactcatcta ttgtgaccca tgctatgaat gacatattct tacatagggg taattcccct 660
catctcacta acctggacat tttcattgat ggggaatttt tgacaagaac gacagcagat 720
ggtgttgcat tggccactcc aacgggttcc acagcatatt cattatcagc aggtggatct 780
attgtttccc cattagtccc tgctatttta atgacaccaa tttgtcctcg ctctttgtca 840
ttccgaccac tgattttgcc tcattcatcc cacattagga taaagatagg ttccaaattg 900
aaccaaaaac cagtcaacag tgtggtaaaa ctttctgttg atggtattcc tcaacaggat 960
ttagatgttg gtgatgaaat ttatgttata aatgaggtcg gcactatata catagatggt 1020
actcagcttc cgacgacaag aaaaactgaa aatgacttta ataattcaaa aaagcctaaa 1080
aggtcaggga tttattgtgt cgccaagacc gagaatgact ggattagagg aatcaatgaa 1140
cttttaggat tcaattctag ctttaggctg accaagagac agactgataa tgattaa 1197
<210> 15
<211> 915
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 15
atgcaacaag caactgggaa cgaattactg ggtatcctag atctggataa cgatatagac 60
tttgaaactg cttaccaaat gctcagcagt aacttcgacg accaaatgtc tgcgcacata 120
catgaaaaca cgtttagtgc aacttcccct cctctgttaa cacacgagct cggcataatt 180
cctaacgtgg caaccgtgca accctctcac gtagaaacta tacctgccga taaccaaact 240
catcatgctc ctttgcatac tcatgctcac tatctaaatc acaaccctca tcaaccaagc 300
atgggttttg atcaaacgct tggtctcaag ttgtctcctt ccagttcggg gttgttgagc 360
acgaatgaat cgaatgccat tgaacagttt ttagacaatc taatatcaca ggatatgatg 420
tcttccaacg cttccatgaa ctccgattca catctacata taagatcacc aaaaaagcag 480
cataggtata ccgaattaaa tcaaagatat cctgaaacac atccacacag taacacaggg 540
gagttaccca caaacacagc agatgtgcca actgagttca ccacgaggga aggacctcat 600
cagcctatcg gcaatgacca ctacaacccg ccaccgtttt cagtacctga gatacgaatc 660
ccagactctg atattccagc caatatcgag gacgaccctg tgaaggtacg gaaatggaaa 720
cacgttcaaa tggagaagat acgaagaata aacaccaaag aagcctttga aaggctcatt 780
aaatcagtaa ggaccccacc aaaggaaaac gggaaaagaa ttcccaagca tattctttta 840
acttgtgtaa tgaacgatat caagtccatt agaagcgcaa atgaagcact acagcacata 900
ctggatgatt cctga 915
<210> 16
<211> 915
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 16
atgcaacaag caactgggaa cgaattactg ggtatcctag atctggataa cgatatagac 60
tttgaaactg cttaccaaat gctcagcagt aacttcgacg accaaatgtc tgcgcacata 120
catgaaaaca cgtttagtgc aacttcccct cctctgttaa cacacgagct cggcataatt 180
cctaacgtgg caaccgtgca accctctcac gtagaaacta tacctgccga taaccaaact 240
catcatgctc ctttgcatac tcatgctcac tatctaaatc acaaccctca tcaaccaagc 300
atgggttttg atcaaacgct tggtctcaag ttgtctcctt ccagttcggg gttgttgagc 360
acgaatgaat cgaatgccat tgaacagttt ttagacaatc taatatcaca ggatatgatg 420
tcttccaacg cttccatgaa ctccgattca catctacata taagatcacc aaaaaagcag 480
cataggtata ccgaattaaa tcaaagatat cctgaaacac atccacacag taacacaggg 540
gagttaccca caaacacagc agatgtgcca actgagttca ccacgaggga aggacctcat 600
cagcctatcg gcaatgacca ctacaacccg ccaccgtttt cagtacctga gatacgaatc 660
ccagactctg atattccagc caatatcgag gacgaccctg tgaaggtacg gaaatggaaa 720
cacgttcaaa tggagaagat acgaagaata aacaccaaag aagcctttga aaggctcatt 780
aaatcagtaa ggaccccacc aaaggaaaac gggaaaagaa ttcccaagca tattctttta 840
acttgtgtaa tgaacgatat caagtccatt agaagcgcaa atgaagcact acagcacata 900
ctggatgatt cctga 915
<210> 17
<211> 915
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 17
atgcaacaag caactgggaa cgaattactg ggtatcctag atctggataa cgatatagac 60
tttgaaactg cttaccaaat gctcagcagt aacttcgacg accaaatgtc tgcgcacata 120
catgaaaaca cgtttagtgc aacttcccct cctctgttaa cacacgagct cggcataatt 180
cctaacgtgg caaccgtgca accctctcac gtagaaacta tacctgccga taaccaaact 240
catcatgctc ctttgcatac tcatgctcac tatctaaatc acaaccctca tcaaccaagc 300
atgggttttg atcaaacgct tggtctcaag ttgtctcctt ccagttcggg gttgttgagc 360
acgaatgaat cgaatgccat tgaacagttt ttagacaatc taatatcaca ggatatgatg 420
tcttccaacg cttccatgaa ctccgattca catctacata taagatcacc aaaaaagcag 480
cataggtata ccgaattaaa tcaaagatat cctgaaacac atccacacag taacacaggg 540
gagttaccca caaacacagc agatgtgcca actgagttca ccacgaggga aggacctcat 600
cagcctatcg gcaatgacca ctacaacccg ccaccgtttt cagtacctga gatacgaatc 660
ccagactctg atattccagc caatatcgag gacgaccctg tgaaggtacg gaaatggaaa 720
cacgttcaaa tggagaagat acgaagaata aacaccaaag aagcctttga aaggctcatt 780
aaatcagtaa ggaccccacc aaaggaaaac gggaaaagaa ttcccaagca tattctttta 840
acttgtgtaa tgaacgatat caagtccatt agaagcgcaa atgaagcact acagcacata 900
ctggatgatt cctga 915
<210> 18
<211> 2589
<212> DNA
<213> Artificial sequence (Artificial Sequence)
<400> 18
atgcagtacg taggcagagc tcttgggtct gtgtctaaaa catggtcttc tatcaatccg 60
gctacgctat caggtgctat agatgtcatt gtagtggagc atccagacgg aaggctatca 120
tgttctccct ttcatgtgag gttcggcaaa tttcaaattc taaagccatc tcaaaagaaa 180
gtccaagtgt ttataaatga gaaactgagt aatatgccaa tgaaactgag tgattctgga 240
gaagcctatt tcgttttcga gatgggtgac caggtcactg atgtccctga cgaattgctt 300
gtgtcgcccg tgatgagcgc cacatcaagc ccccctcaat cacctgaaac atccatctta 360
gaaggaggaa ccgagggtga aggtgaaggt gaaaatgaaa ataagaagaa ggaaaagaaa 420
gtgctagagg aaccagattt tttagatatc aatgacactg gagattcagg cagtaaaaat 480
agtgaaacta cagggtcgct ttctcctact gaatcctcta caacgacacc accagattca 540
gttgaagaga ggaagcttgt tgagcagcgt acaaagaact ttcagcaaaa actaaacaaa 600
aaactcactg aaatccatat acccagtaaa cttgataaca atggcgactt actactagac 660
actgaaggtt acaagccaaa caagaatatg atgcatgaca cagacataca actgaagcag 720
ttgttaaagg acgaattcgg taatgattca gatatttcca gttttatcaa ggaggacaaa 780
aatggcaaca tcaagatcgt aaatccttac gagcacctta ctgatttatc tcctccaggt 840
acgcctccaa caatggccac aagcggatca gttttaggct tagatgcaat ggaatcagga 900
agtactttga attcgttatc ttcttcacct tctggttccg atactgagga cgaaacatca 960
tttagcaaag aacaaagcag taaaagtgaa aaaactagca agaaaggaac agcagggagc 1020
ggtgagaccg agaaaagata catacgaacg ataagattga ctaatgacca gttaaagtgc 1080
ctaaatttaa cttatggtga aaatgatctg aaattttccg tagatcacgg aaaagctatt 1140
gttacgtcaa aattattcgt ttggaggtgg gatgttccaa ttgttatcag tgatattgat 1200
ggcaccatca caaaatcgga cgctttaggc catgttctgg caatgatagg aaaagactgg 1260
acgcacttgg gtgtagccaa gttatttagc gagatctcca ggaatggcta taatatactc 1320
tatctaactg caagaagtgc tggacaagct gattccacga ggagttattt gcgatcaatt 1380
gaacagaatg gcagcaaact accaaatggg cctgtgattt tatcacccga tagaacgatg 1440
gctgcgttaa ggcgggaagt aatactaaaa aaacctgaag tctttaaaat cgcgtgtcta 1500
aacgacataa gatccttgta ttttgaagac agtgataacg aagtggatac agaggaaaaa 1560
tcaacaccat tttttgccgg ctttggtaat aggattactg atgctttatc ttacagaact 1620
gtggggatac ctagttcaag aattttcaca ataaatacag agggtgaggt tcatatggaa 1680
ttattggagt tagcaggtta cagaagctcc tatattcata tcaatgagct tgtcgatcat 1740
ttctttccac cagtcagcct tgatagtgtc gatctaagaa ctaatacttc catggttcct 1800
ggctcccccc ctaatagaac gttggataac tttgactcag aaattacttc aggtcgcaaa 1860
acgctattta gaggcaatca ggaagagaaa ttcacagacg taaatttttg gagagacccg 1920
ttagtcgaca tcgacaactt atcggatatt agcaatgatg attctgataa catcgatgaa 1980
gatactgacg tatcacaaca aagcaacatt agtagaaata gggcaaattc agtcaaaacc 2040
gccaaggtca ctaaagcccc gcaaagaaat gtgagcggca gcacaaataa caacgaagtt 2100
ttagccgctt cgtctgatgt agaaaatgcg tctgacctgg tgagttccca tagtagctca 2160
ggatccacgc ccaataaatc tacaatgtcc aaaggggaca ttggaaaaca aatatatttg 2220
gagctaggtt ctccacttgc atcgccaaaa ctaagatatt tagacgatat ggatgatgaa 2280
gactccaatt acaatagaac taaatcaagg agagcatctt ctgcagccgc gactagtatc 2340
gataaagagt tcaaaaagct ctctgtgtca aaggccggcg ctccaacaag aattgtttca 2400
aagatcaacg tttcaaatga cgtacattca cttgggaatt cagataccga atcacgaagg 2460
gagcaaagtg ttaatgaaac agggcgcaat cagctacccc acaactcaat ggacgataaa 2520
gatttggatt caagagtaag cgatgaattc gatgacgatg aattcgacga agatgaattc 2580
gaagattaa 2589

Claims (7)

1. Saccharomyces cerevisiae transformed or transfected with an expression vector comprising a backbone vector and a combination of genes consisting of HaGAS1, ciGAO, lsCOS and TpPTS;
the nucleic acid sequence of the HaGAS1 is shown as SEQ ID NO.1;
the nucleic acid sequence of the CiGAO is shown in SEQ ID NO.7;
the nucleic acid sequence of the LsCOS is shown as SEQ ID NO.10;
the nucleic acid sequence of the TpPTS is shown in SEQ ID NO.12.
2. Saccharomyces cerevisiae transformed or transfected with an expression vector comprising a backbone vector and a combination of genes consisting of HaGAS1, ciGAO, lsCOS, tpPTS, ZWF1 and INO2,
the nucleic acid sequence of the HaGAS1 is shown as SEQ ID NO.1;
the nucleic acid sequence of the CiGAO is shown in SEQ ID NO.7;
the nucleic acid sequence of the LsCOS is shown as SEQ ID NO.10;
the nucleic acid sequence of the TpPTS is shown in SEQ ID NO.12;
the nucleic acid sequence of ZWF1 is shown in SEQ ID NO. 13;
the nucleic acid sequence of INO2 is shown as SEQ ID NO. 15.
3. Saccharomyces cerevisiae transformed or transfected with an expression vector comprising a backbone vector and a combination of genes consisting of HaGAS1, ciGAO, lsCOS, tpPTS, HAC1 truncations and ZWF1;
the nucleic acid sequence of the HaGAS1 is shown as SEQ ID NO.1;
the nucleic acid sequence of the CiGAO is shown in SEQ ID NO.7;
the nucleic acid sequence of the LsCOS is shown as SEQ ID NO.10;
the nucleic acid sequence of the TpPTS is shown in SEQ ID NO.12;
the nucleic acid sequence of ZWF1 is shown in SEQ ID NO. 13;
the nucleic acid sequence of the HAC1 truncated body is shown in SEQ ID NO. 16.
4. A saccharomyces cerevisiae according to any one of claims 1 to 3, which is a synthetic precursor containing sesquiterpenes and expresses CPR1, CYB5, ADH1 and ALDH 1.
5. The construction method of the saccharomyces cerevisiae according to any one of claims 1-4, wherein the construction method comprises one or more of the following modifications:
1) Transferring into HaGAS1, ciGAO, lsCOS and TpPTS genes;
2) Overexpression of ZWF1 and POS5 from yeast chassis strains;
3) Overexpression of INO2 and sheared HAC1.
6. The method of claim 5, wherein the method of transferring or over-expressing a gene comprises plasmid transformation, viral transfection or gene editing via CRISPR/Cas9 system.
7. A method for preparing parthenolide, comprising culturing the saccharomyces cerevisiae according to any one of claims 1-4 to obtain a culture containing parthenolide;
or comprises fermenting and culturing the yeast genetic engineering strain obtained by the construction method of claim 5 or 6 to obtain a culture containing the parthenolide.
CN202210568493.3A 2022-05-24 2022-05-24 Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof Active CN114774443B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202210568493.3A CN114774443B (en) 2022-05-24 2022-05-24 Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202210568493.3A CN114774443B (en) 2022-05-24 2022-05-24 Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof

Publications (2)

Publication Number Publication Date
CN114774443A CN114774443A (en) 2022-07-22
CN114774443B true CN114774443B (en) 2024-02-27

Family

ID=82408045

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202210568493.3A Active CN114774443B (en) 2022-05-24 2022-05-24 Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof

Country Status (1)

Country Link
CN (1) CN114774443B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112553097A (en) * 2020-11-26 2021-03-26 天津大学 Yeast gene engineering strain for high yield of citronellol and construction method and fermentation method thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN112553097A (en) * 2020-11-26 2021-03-26 天津大学 Yeast gene engineering strain for high yield of citronellol and construction method and fermentation method thereof

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Elucidation and in planta reconstitution of the parthenolide biosynthetic pathway;Qing Liu et al.;Metabolic Engineering;第146页左栏第2段, 146页2.4 *

Also Published As

Publication number Publication date
CN114774443A (en) 2022-07-22

Similar Documents

Publication Publication Date Title
CN111778167B (en) Saccharomyces cerevisiae engineering bacterium for high yield of betulinic acid and construction method and application thereof
CN113403334B (en) Plasmid kit for Saccharomyces cerevisiae multi-copy integration
CN110218244B (en) Compound ilamycin F and application thereof
CN107164254B (en) Microorganisms and uses thereof
CN112852650B (en) Saccharomyces cerevisiae engineering bacterium for high yield of santalene and santalol and construction method and application thereof
CN112280698B (en) Saccharomyces cerevisiae engineering bacteria for high-yield yacholanol type sesquiterpene and construction method and application thereof
CN111205993A (en) Recombinant yeast for producing ursolic acid and oleanolic acid as well as construction method and application thereof
CN115197172B (en) Sesterterpene compound, synthetic gene cluster and synthetic method thereof
CN114657078B (en) Construction method and application of saccharomyces cerevisiae strain for high yield of cannabidiol
CN116987603A (en) Recombinant saccharomyces cerevisiae strain for high yield of cannabigerolic acid as well as construction method and application thereof
CN115851810A (en) Engineering strain for de novo synthesis of naringenin by saccharomyces cerevisiae and construction method and application thereof
CN114940980A (en) Sesquiterpene polyketone synthesis gene and application thereof
CN109136119B (en) Microorganisms and uses thereof
CN112391300B (en) Application of flavone 3 beta-hydroxylase derived from silybum marianum and coenzyme thereof
CN114774443B (en) Recombinant saccharomyces cerevisiae strain for producing parthenolide and construction method thereof
CN114517161B (en) High yield gibberellin GA3Genetically engineered bacterium of (2), construction method and application
CN109136120B (en) Microorganisms and uses thereof
CN113444737B (en) Cytochrome P450 enzyme and application thereof in synthesis of ganoderma lucidum triterpenoid
CN115873836A (en) Nerolidol synthetase and application thereof
KR20020029767A (en) Cyclic depsipeptide synthases, genes thereof and mass production system of cyclic depsipeptide
CN115976118A (en) Method and carrier for biologically synthesizing nootkatone
CN111944840A (en) Application of trichoderma Azaphilones secondary metabolite
CN107903227B (en) Succinic anhydride compound, gene and protein related to succinic anhydride compound and preparation method of succinic anhydride compound
CN107746849B (en) Efficient screening method of steroid hydroxylase genes
CN114317470B (en) Compound oxalicine B biosynthesis gene cluster and C-15 hydroxylase OxaL and application

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant