CN114075281A - anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof - Google Patents
anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof Download PDFInfo
- Publication number
- CN114075281A CN114075281A CN202111356411.0A CN202111356411A CN114075281A CN 114075281 A CN114075281 A CN 114075281A CN 202111356411 A CN202111356411 A CN 202111356411A CN 114075281 A CN114075281 A CN 114075281A
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- inhibin
- cell line
- protein
- alpha protein
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/22—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against growth factors ; against growth regulators
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/577—Immunoassay; Biospecific binding assay; Materials therefor involving monoclonal antibodies binding reaction mechanisms characterised by the use of monoclonal antibodies; monoclonal antibodies per se are classified with their corresponding antigens
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Immunology (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Urology & Nephrology (AREA)
- Biomedical Technology (AREA)
- Hematology (AREA)
- Medicinal Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- General Physics & Mathematics (AREA)
- Food Science & Technology (AREA)
- Biotechnology (AREA)
- Cell Biology (AREA)
- Organic Chemistry (AREA)
- Microbiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Pathology (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Biophysics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Peptides Or Proteins (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
Abstract
The invention relates to the field of biological detection, and provides an anti-Inhibin-alpha protein monoclonal antibody, wherein the amino acid sequences of the heavy chain and light chain variable regions are respectively the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO. 3. The inventor also provides a hybridoma cell line for secreting anti-Inhibin-alpha protein, wherein the cell line is a mouse hybridoma cell line 15E11D5E11 with the preservation number of: CGMCC NO. 22320. The anti-Inhibin-alpha protein monoclonal antibody has high specificity and sensitivity, can specifically identify cells expressing Inhibin-alpha protein, and is suitable for immunological detection, especially immunohistochemical detection.
Description
Technical Field
The invention relates to the field of biological detection, in particular to an Inhibin-alpha protein resisting monoclonal antibody, a cell line, a preparation method and application thereof.
Background
Inhibin is one of the important hormones regulated by the hypothalamic pituitary gonadal axis system. Inhibin belongs to a member of TGF-beta family, and can inhibit synthesis and secretion of adenohypophysis anterior lobe basic and FSH regulated by gonadotropin-releasing hormone by reducing transcription of follicle stimulating hormone gene and down-regulating gonadotropin-releasing hormone receptor in paracrine and autocrine manner. And has local regulating effect on gonadal steroid production. Inhibin consists essentially of inhibin A and inhibin B, both of which have alpha subunits, differing in the form of beta subunits. The Inhibin-alpha subunit has only one molecular structure, a relative molecular mass of 18000, and is located on human chromosome 2q 33.
Inhibin-alpha is produced by Sertoli cells and ovarian granulosa cells of the testis and inhibits the production and secretion of pituitary gonadotropins. Inhibin-alpha is obviously increased in most ovarian epithelial cancers, is more obviously increased in granulocytoma and mucinous cystadenocarcinoma, has higher expression in the early stage of ovarian malignant tumor, and is commonly used for differential diagnosis of ovarian granulocytoma and cancer. In addition, Inhibina is expressed in normal adrenal cortex, cortical nodular hyperplasia and cortical tumor, mainly expressed in the inner layer of the reticular zone and fasciculate zone of the cortex, and is mainly expressed in the cortical tumor (particularly cortical adenoma) in a diffuse way, thereby being helpful for judging normal or hyperplastic tissue or tumor tissue.
Disclosure of Invention
The inventor provides an anti-Inhibin-alpha protein monoclonal antibody, and the amino acid sequences of heavy chain and light chain variable regions of the monoclonal antibody are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3.
Furthermore, the heavy chain and light chain variable region amino acid sequences of the monoclonal antibody are respectively encoded by the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO. 5.
Furthermore, in the preparation process of the monoclonal antibody, an antigen used by an immunized mouse is a recombinant protein which is coded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination.
Further, the monoclonal antibody specifically recognizes the human Inhibin-alpha protein.
Further, the monoclonal antibody is produced by a hybridoma cell line with the preservation number of CGMCC NO. 22320. The cell line is a mouse hybridoma cell line 15E11D5E11, and is classified and named as: a mouse hybridoma cell line which has been deposited at 29.29.04 in 2021 at the center of China Committee for culture Collection of microorganisms and is addressed to the institute of microorganisms of the national academy of sciences, China, institute of sciences, No.3, West Lu 1, Beijing, Chaoyang, and the quarter.
Further, the anti-Inhibin-alpha protein is a mouse IgG1 subtype monoclonal antibody.
The inventor also provides a preparation method of the anti-Inhibin-alpha protein monoclonal antibody, and an antigen used by an immune mouse is a recombinant protein which is coded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination.
The inventor also provides a hybridoma cell line for secreting anti-Inhibin-alpha protein, wherein the cell line is a mouse hybridoma cell line 15E11D5E11, the cell line is preserved in China general microbiological culture Collection center with the preservation number of: CGMCC NO. 22320.
The inventor also provides the application of the anti-Inhibin-alpha protein monoclonal antibody in human Inhibin-alpha protein immunoassay.
Further, the immunodetection includes immunohistochemistry, immunoblotting and enzyme-linked immunoassay.
The inventor further provides a human Inhibin-alpha protein immunoassay reagent, and the immunoassay reagent contains any one of the above Inhibin-alpha protein monoclonal antibodies as an effective component.
Different from the prior art, the technical scheme is that according to the structure, antigenicity, hydrophilicity and hydrophobicity of constituent amino acids and a secondary structure of the Inhibin-alpha protein, amino acid fragments from the 128 th site to the 300 th site of the Inhibin-alpha protein and corresponding nucleotide fragments are selected, recombinant expression is carried out through escherichia coli, immunization is carried out on a mouse, cell fusion, screening and cloning are carried out, a monoclonal cell line 15E11D5E11 which efficiently secretes the anti-Inhibin-alpha protein monoclonal antibody is obtained, the monoclonal cell line 15E11D5E11 is cultured in vitro, and the anti-Inhibin-alpha protein monoclonal antibody secreted by the cell line is obtained. The antibody obtained by the scheme has high specificity and sensitivity, can specifically recognize cells expressing Inhibin-alpha protein, and is suitable for immunological detection, particularly immunohistochemical detection.
The above description of the present invention is only an overview of the technical solutions of the present application, and in order to make the technical solutions of the present application more clearly understood by those skilled in the art, the present invention may be further implemented according to the content described in the text and drawings of the present application, and in order to make the above objects, other objects, features, and advantages of the present application more easily understood, the following description is made in conjunction with the detailed description of the present application and the drawings.
Drawings
FIG. 1 is a graph showing the results of electrophoresis of the purified Inhibin-alpha monoclonal antibody of example 3; m: and (4) marking molecular weight.
FIG. 2 immunoblot of detection of human Inhibin-alpha protein by Inhibin-alpha mab.
FIG. 3 is a graph showing immunohistochemical staining results for ovarian solitary stromal tumors.
Detailed Description
In order to explain in detail possible application scenarios, technical principles, practical embodiments, and the like of the present application, the following detailed description is given with reference to the accompanying drawings in conjunction with the listed embodiments. The embodiments described herein are merely for more clearly illustrating the technical solutions of the present application, and therefore, the embodiments are only used as examples, and the scope of the present application is not limited thereby.
Reference herein to "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment can be included in at least one embodiment of the application. The appearances of the phrase "an embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or related to other embodiments specifically defined. In principle, in the present application, the technical features mentioned in the embodiments can be combined in any manner to form a corresponding implementable technical solution as long as there is no technical contradiction or conflict.
Unless defined otherwise, technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs; the use of relational terms herein is intended only to describe particular embodiments and is not intended to limit the present application.
In the description of the present application, the term "and/or" is a expression for describing a logical relationship between objects, meaning that three relationships may exist, for example a and/or B, meaning: there are three cases of A, B, and both A and B. In addition, the character "/" herein generally indicates that the former and latter associated objects are in a logical relationship of "or".
In this application, terms such as "first" and "second" are used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions.
Without further limitation, in this application, the use of "including," "comprising," "having," or other similar expressions in phrases and expressions of "including," "comprising," or "having," is intended to cover a non-exclusive inclusion, and such expressions do not exclude the presence of additional elements in a process, method, or article that includes the recited elements, such that a process, method, or article that includes a list of elements may include not only those elements but also other elements not expressly listed or inherent to such process, method, or article.
As is understood in the examination of the guidelines, the terms "greater than", "less than", "more than" and the like in this application are to be understood as excluding the number; the expressions "above", "below", "within" and the like are understood to include the present numbers. In addition, in the description of the embodiments of the present application, "a plurality" means two or more (including two), and expressions related to "a plurality" similar thereto are also understood, for example, "a plurality of groups", "a plurality of times", and the like, unless specifically defined otherwise.
EXAMPLE 1 preparation of recombinant Inhibin-alpha protein fragments
First, antigen fragment selection
The Inhibin-alpha protein sequence with the number P05111 was selected as the standard sequence from the Uniprot database (http:// www.uniprot.org). The invention selects the 128 th to 300 th amino acid segments of human Inhibin-alpha protein as antigen, and designs the specificity upstream Primer 5 'GGATCCTCTGCCCAGCTGTGGTTTCATAC' (SEQ ID NO.6 restriction enzyme site, BamH I) and downstream Primer of the Inhibin-alpha protein by using software Primer 5.0 according to the corresponding base sequence (SEQ ID NO. 1): 5 'TATCTCGAGCGGGATGTGCAGACCAC 3' (SEQ ID NO.7, restriction site, Xho I), reverse transcription amplifying the gene fragment SEQ ID NO.1 encoding amino acids 128 to 300.
And separating the PCR product by agarose gel electrophoresis, recovering, carrying out BamH I and Xho I double enzyme digestion on the recovered target gene and a plasmid vector pET28a for expression, carrying out electrophoresis recovery again, and connecting by using T4 DNA ligase. And transforming the connecting product into an escherichia coli competent cell Rosetta, selecting clone on a plate, inoculating, expanding and culturing, extracting plasmid DNA, and performing PCR identification. The clone with positive target gene shown by PCR is sequenced and analyzed, and the clone with completely correct sequence is used for the next step.
Second, expression and purification of recombinant Inhibin-alpha protein fragment
Take out 100ul of competent cells (Rosetta) preserved at-80 deg.C, thaw, add 5ul of Inhibin-alpha plasmid DNA, and stand on ice for 30 min. After heat shock at 42 ℃ for 90 seconds and ice bath for 5min, 800. mu.L of non-resistant LB medium was added. Recovering and culturing at 37 deg.C for 60min, plating, and culturing overnight. The transformed plate was picked up and single colonies were cultured in 4ml of LB liquid medium overnight at 37 ℃ and 200rpm, and then the cells were maintained.
4ul of the bacterial liquid is taken to be put into 4ml of LB liquid culture medium and cultured overnight for recovery. The cultured bacterial suspension was transferred to 200ml of LB liquid medium, mixed, cultured at 37 ℃ and 200rpm until OD becomes 0.6-0.8, and then IPTG (0.5mM) was added thereto for overnight induction at low temperature. The cells were collected by centrifugation in a 400ml large centrifuge bowl at 4000rpm for 10min and the supernatant was discarded. The pellet was blown off with 20-30ml of 10mM Tris-HCl (pH 7.0) and NaCl at a final concentration of 0.5M, and the cells were disrupted by sonication. After centrifugation at 12000rpm for 20 minutes, the centrifuged supernatant was applied to a Ni-NTA nickel column (QIAGEN) for purification, and then eluted with 10mM Tris-HCl (pH 7.0) (containing 0.5M sodium chloride) containing 50mM imidazole, 250mM imidazole and 500mM imidazole, respectively, to collect protein peaks, followed by electrophoresis for further use.
Example 215 establishment of E11D5E11 hybridoma cell line
Immunization
The Inhibin-alpha protein fusion protein obtained in example 1 was mixed and emulsified with an equal volume of complete Freund's adjuvant (CFA, Sigma) and 18-20g of Balb/c mice (purchased from Wu's laboratory animal, Fuzhou) were immunized by abdominal injection at a dose of 50. mu.g/mouse. Thereafter, the booster was administered every 14 days, and the antigen was emulsified with Freund's incomplete adjuvant (IFA, Sigma Co.) at a dose of 25. mu.g/mouse. The polyclonal titer of the anti-immunogen in the serum of the mice is detected by indirect ELISA (wavelength 450nm) 14 days after the 2 nd boosting immunization, the mice with the highest titer are injected by tail vein for impact immunization, and the antigen is uniformly mixed by PBS solution with the dosage of 50 mu g/mouse.
Secondly, cell fusion:
aseptically preparing mouse spleen cell suspension with qualified immunity, mixing with mouse myeloma cell sp2/0(ATCC) at a ratio of 5:1, centrifuging at 1000rpm for 10min, discarding supernatant, adding 1mL of PEG (Sigma) solution preheated to 37 ℃ from slow to fast within 1 min, and slightly rotating the centrifuge tube during the addition process to make the cells fully contact with PEG. Standing at room temperature for 90s, adding 4mL serum-free DMEM (Hyclone company) medium preheated to 37 deg.C from slow to fast within 2min, adding 10mL preheated serum-free DMEM medium within 2min, adding the rest preheated serum-free DMEM medium within 2min,the volume is fixed to 50mL, the centrifuge tube needs to be slowly shaken in the whole adding process, the uniform mixing is ensured, and the damage to cells is reduced. Standing at room temperature for 10min, centrifuging (1000rpm, 5min), discarding supernatant, resuspending cells in 10-20mLHAT (Sigma) medium, and diluting with HAT medium to final concentration of 0.5X 106cells/mL, all solutions were transferred to 96-well plates at 200. mu.L/well and labeled. The 96-well plates were carefully transferred to 37 ℃ with 5% CO2Culturing in an incubator. The growth state and potential pollution of cells are regularly checked, and the incubator is opened and closed as little as possible to ensure the stability of the culture environment. On day 5 post-fusion, plates were supplemented with HAT medium at 50. mu.L/well.
Thirdly, cloning and ELISA screening positive hybridoma cells:
when the fused cell diameter is about 1-2mm, 50-200. mu.L of culture supernatant is aspirated for the first cell selection (ELISA, IHC-P and other methods of detection), and HAT medium is added to the culture wells to 200. mu.L. And (3) detecting the culture solution supernatant by ELISA, transferring all cell culture solution in the culture hole with the positive result obtained by detection to a 24-hole culture plate, supplementing HT medium, culturing for 3 days at a concentration of 2 mL/hole.
And repeatedly screening each cell line in the 24-pore plate, and removing the culture well cells which are not positive results to obtain the culture well cells with better positive results. Performing subclone screening on the positive well cells obtained from the 24-well culture plate by limiting dilution method, namely adding cell sap obtained by limiting dilution method into 96-well culture plate, and transferring to CO2Culturing in an incubator for 11 days, and repeating cell screening when the diameter of the cloned cell is 1-2 mm. According to the detection result, 4 well-grown monoclonal positive culture wells are selected from each subcloned cell line, and transferred to a 24-well plate for continuous culture. After a period of time, a positive clone cell line obtained by cloning in a 24-well plate is screened again, namely a hybridoma cell line 15E11D5E11 secreting a specific monoclonal antibody. The cell line is transferred into a T-75 culture flask to be amplified to a logarithmic growth phase for seed preservation or subsequent experiments are carried out.
EXAMPLE 3 preparation of monoclonal antibodies by in vitro culture
First, in vitro culture
After obtaining the stable hybridoma cell line, obtaining the monoclonal antibody by adopting an in vitro culture method.
The hybridoma cells were cultured in DMEM complete medium containing 10% fetal bovine serum, and then centrifuged at low speed to collect culture supernatant, which was stored at 4 ℃ for further use.
Secondly, purification of monoclonal antibody
Antibody purification using rProtein A sepharose Fast Flow (GE) affinity column: filling a proper amount of purchased ProteinA filler into a gravity chromatographic column, and washing the gravity chromatographic column with an equilibrium buffer solution (a 0.1M Tris solution containing 1.5MNacl, pH7.0) until the equilibrium is reached; secondly, loading, namely adding cell supernatant filtered by a 0.22-micron filter membrane into a packed chromatographic column, and controlling the flow rate to be 1 drop/second; thirdly, balancing, and washing the sample solution to be balanced by using a balancing buffer solution after the sample solution is loaded; eluting, adding an elution buffer solution (0.1M citric acid solution, pH4.5) to wash the column and collecting the eluent; fifthly, regenerating, adding an equilibrium buffer solution to wash the column to be balanced after the elution is finished, washing the column with 2 times of column volume of 20 percent ethanol, and storing the column at 4 ℃. And finally, identifying the purity of the antibody by adopting an SDS-PAGE method. The result is shown in figure 1, the polyacrylamide gel electrophoresis picture of the purified Inhibin-alpha monoclonal antibody has the purity of more than 95 percent, and the concentration of the antibody is measured by an ultraviolet micro-spectrophotometer method and reaches more than 3.0 mg/mL.
EXAMPLE 4 characterization of monoclonal antibodies
Identification of one, two subtypes
The antigen protein was diluted to 1. mu.g/mL coated ELISA plates, 100. mu.L per well, coated overnight at 4 ℃, the liquid was decanted, the plates were washed 3 times with PBS (PBS-T) containing 0.05% Tween, 200. mu.L of blocking solution (PBS-T solution containing 2% BSA) was added per well, and incubated for 1h at 37 ℃. The liquid was decanted and washed 3 times with PBS-T. 0.1mL of culture supernatant of hybridoma cell line diluted 5-fold was added to each well and incubated at 37 ℃ for 1 hour. The liquid was decanted and washed 3 times with PBS-T. Using a confining liquid 1: HRP-labeled goat anti-mouse (kappa, lambda, IgM, IgG1, IgG2a, IgG2b, IgG) diluted 4003IgA) antibody (Southern Biotech) was added in an amount of 0.1mL per well and incubated at 37 ℃ for 1 hour. The liquid was decanted and washed 3 times with PBS-T. 100 μ L of substrate (A, B volume of mixed solution) per well (Hill Bio-technology Ltd.) was used for visualizationAnd (3) carrying out color reaction for 15min at room temperature, adding 50 mu L of 1N HCl solution into each hole to stop color reaction, and then measuring the OD value at the wavelength of 450nm by using a microplate reader. The results show that the monoclonal antibody of the present invention is a murine monoclonal antibody of the IgG1 type.
Second, determination of affinity constant
Inhibin-alpha protein was coated at 100. mu.g/ml, 100. mu.l/well, coated overnight at 4 ℃ and washed 3 times with PBS-T. Add 200. mu.l of blocking solution to each well and block for 1h at 37 ℃ and wash 3 times with PBS-T. The monoclonal antibody purified in example 4 was diluted to the following concentrations (unit: ng/mL): 2000. 500, 125, 62.5, 31.25, 15.625, 3.125, 0.625, incubation at 37 ℃ for 1h, PBS-T wash 3 times. HRP-labeled goat anti-mouse secondary antibody 1: diluted at 5000, 100. mu.l/well, incubated at 37 ℃ for 1h, and washed 3 times with PBS-T. Mu.l of TMB (Hiroshi, England Biotech Co., Ltd., Huzhou) color developing solution was added to each well, and the reaction was stopped by adding 100. mu.l of 1.0N hydrochloric acid solution for color development for 13 min. And measuring the light absorption value with the wavelength of 450nm by using a microplate reader. The OD values were plotted against the antibody dilution factor to find 1/2 the antibody concentration a corresponding to the "plateau OD value". The affinity constant was calculated to be 6.93X 10 using the following formula9。
III, monoclonal antibody reaction specificity and application effect
Selecting immunogen solution, detecting the recognition specificity of the monoclonal antibody of the invention by an immunoblotting method, and carrying out 15% polyacrylamide gel electrophoresis on Inhibin-alpha protein. The gel proteins were transferred to PVDF membrane by conventional wet transfer method. The membrane was placed in a 5% BSA-TBST solution (protein side down) and shaker blocked at 37 ℃ for 1h to eliminate non-specific background. After the blocking is finished, washing off 5% BSA-TBST by using TBST, adding the monoclonal antibody of Inhibin-alpha prepared by the invention, and shaking and incubating for 1h in a decoloring shaking table. After washing the membrane with TBST, the secondary antibody was added and incubated for 1h in a decolorizing shaker to allow the secondary antibody to bind fully to the primary antibody. The membrane was washed again with TBST and ECL color development kit was added. The experimental results are shown in FIG. 2, the immunoblotting of the Inhibin-alpha monoclonal antibody to detect human Inhibin-alpha protein: the band is single and darker, which indicates that the specific reaction between the antibody and the antigen is obvious.
Example 5 tissue chip staining and characterization
First, preparation of tissue wax block
HE section staining was performed on the sample tissue to determine the tumor lesion site. And (5) circling the lesion site and preparing to punch. When the receptor wax block is manufactured, a plastic frame is placed on a mold, melted paraffin (the melting point is 56-58 ℃) is poured into the mold, the tissue block is placed into wax liquid in the mold, then a proper amount of wax liquid is added to enable the tissue block to be completely embedded in the wax liquid, the mold is placed into a refrigerator with the temperature of-20 ℃ for 6min after being cooled to the room temperature, the wax block is taken out of the mold, and the section is sliced or placed into the refrigerator with the temperature of 4 ℃ for storage. After trimming, continuous slicing is carried out, the thickness is determined to be 4 mu m, the continuous slicing is rinsed in 40% alcohol, the slices are naturally unfolded, then the separated slices are transferred to warm water at 45 ℃ for 30 seconds, a glass slide treated by 2% APES acetone solution is used for mounting the slices, the prepared tissue chip is placed into an oven at 60 ℃ for baking for 2 hours, the slices are taken out for cooling at room temperature, and the tissue chip is placed into a refrigerator at-4 ℃ for storage.
Second, IHC staining and analysis
Conventional xylene dewaxing was performed 3 times for 6 minutes each time with 100%, 95%, 85% gradient ethanol hydration for 3 minutes each time and finally tap water rinse. Antigen retrieval was performed and the sections were then placed in a wet box and washed 3 x 3min with PBS. Dropwise adding 3% H2O2Incubate for 10min and wash with PBS for 3 × 3 min. The PBS was spun off and the peroxidase blocker was added dropwise and incubated for 10 minutes at room temperature. Spin-drying the slices, dripping primary antibody diluted in a proper proportion (the dilution proportion of the antibody is designed according to the concentration of the antibody in the primary dilution) and incubating for 1 hour at room temperature (25 ℃), washing for 3X 3 minutes by PBS, dripping secondary antibody and incubating for 30 minutes at room temperature, washing for 3X 3 minutes by PBS, throwing off the PBS, and developing for 3-10 minutes by using a freshly prepared DAB developing solution. Hematoxylin counterstain for 20 seconds, PBS turns blue. Dehydration was carried out in a gradient of 85% (3 min), 95% (3 min), 100% (3 min) and 100% (3 min) in order, and finally two times xylene was cleared for 10min, followed by sealing with neutral gum.
The immunohistochemical staining results were divided into: positive and negative. Positive expression must be at a specific antigenic site in cells and tissues to be considered positive. Under the condition that the tissue staining distribution is clear and the cell positioning is accurate, the staining result is further divided according to the difference of staining intensity, which is as follows:
1. the sample is weakly positive; marked "+";
2. the sample is moderately positive; marked "+";
3. the sample is highly positive; marked as "+ + +".
4. The sample was negative and marked "-".
Thirdly, sample detection results:
the results of the detection of the anti-Inhibin-alpha protein monoclonal antibody (15E11D5E11) prepared by the invention in 21 cases of mesothelioma, 25 cases of ovarian interstitial tumor and 1 case of adrenocortical adenoma are shown in the following table:
the results show that the staining of the anti-Inhibin-alpha protein monoclonal antibody (15E11D5E11) is accurate in localization, clear in staining, free of non-specific staining and clean in background, which indicates that the anti-Inhibin-alpha protein monoclonal antibody (15E11D5E11) is strong in specificity. FIG. 3 is a graph showing immunohistochemical staining results for ovarian solitary stromal tumors.
Finally, it should be noted that, although the above embodiments have been described in the text and drawings of the present application, the scope of the patent protection of the present application is not limited thereby. All technical solutions which are generated by replacing or modifying the equivalent structure or the equivalent flow according to the contents described in the text and the drawings of the present application, and which are directly or indirectly implemented in other related technical fields, are included in the scope of protection of the present application.
SEQUENCE LISTING
<110> Fuzhou mai New Biotechnology development Co., Ltd
<120> anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof
<130> 2021
<160> 7
<170> PatentIn version 3.5
<210> 1
<211> 519
<212> DNA
<213> Artificial sequence (Artificial)
<400> 1
tctgcccagc tgtggtttca tactggtctg gatcgtcaag gcactgccgc atctaacagc 60
tctgaaccgc tgctgggtct gctggctctg tctccaggcg gtccagtagc tgttccaatg 120
tctctgggtc atgcaccacc acattgggct gtactgcacc tggcgacgtc tgcactgagc 180
ctgctgactc acccagttct ggttctgctg ctgcgttgtc ctctgtgtac ctgttctgct 240
cgtcctgaag caaccccttt tctggttgcg catactcgta ctcgtccgcc gtctggtggt 300
gaacgtgctc gtcgttccac cccgctgatg tcttggccgt ggtctccgtc tgctctgcgt 360
ctgctgcagc gtcctccgga agaaccggct gcacacgcta actgccatcg tgtggctctg 420
aacatctcct tccaggaact gggttgggaa cgttggattg tttacccgcc gtccttcatt 480
ttccattatt gtcacggcgg ttgtggtctg cacatcccg 519
<210> 2
<211> 136
<212> PRT
<213> Artificial sequence (Artificial)
<400> 2
Met Gly Trp Ser Trp Ile Phe Leu Phe Leu Leu Ser Gly Thr Ala Gly
1 5 10 15
Val Leu Ser Glu Val Gln Leu Gln Gln Ser Gly Pro Glu Leu Val Lys
20 25 30
Pro Gly Thr Ser Val Lys Ile Ser Cys Lys Thr Ala Gly Tyr Thr Phe
35 40 45
Thr Ala Tyr Asn Ile His Trp Val Lys Gln Ser His Gly Lys Ser Leu
50 55 60
Glu Trp Ile Gly Ser Ile Asn Pro Asn Phe Gly Asp Thr Arg Tyr Asn
65 70 75 80
Gln Met Phe Glu Gly Lys Ala Thr Leu Thr Val Asp Lys Ser Ser Ser
85 90 95
Thr Ala Tyr Met Glu Leu Arg Ser Leu Thr Ser Glu Asp Ala Val Val
100 105 110
Tyr Tyr Cys Ala Arg Ser Ser Gly Ala Trp Phe Pro Tyr Trp Gly Gln
115 120 125
Gly Thr Leu Val Thr Val Ser Ala
130 135
<210> 3
<211> 131
<212> PRT
<213> Artificial sequence (Artificial)
<400> 3
Met Lys Leu Pro Val Arg Leu Leu Val Leu Met Phe Trp Ile Pro Ala
1 5 10 15
Ser Ser Ser Asp Val Leu Met Thr Gln Ile Pro Leu Ser Leu Pro Val
20 25 30
Ser Leu Gly Asp Gln Ala Ser Ile Ser Cys Arg Ala Ser Gln Ser Ile
35 40 45
Val His Ser Ser Gly Asn Thr Tyr Leu Glu Trp Tyr Leu Gln Lys Pro
50 55 60
Gly Gln Ser Pro Lys Leu Leu Ile Tyr Lys Val Ser Asn Arg Phe Ser
65 70 75 80
Gly Val Pro Asp Arg Phe Ser Gly Ser Gly Ser Gly Thr Asp Phe Thr
85 90 95
Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys
100 105 110
Phe Gln Gly Ser His Val Pro Pro Thr Phe Gly Gly Gly Thr Asn Leu
115 120 125
Glu Ile Lys
130
<210> 4
<211> 408
<212> DNA
<213> Artificial sequence (Artificial)
<400> 4
atgggatgga gctggatctt tctctttctc ctgtcaggaa ctgcaggtgt cctctctgag 60
gtccagctgc aacagtctgg acctgagctg gtgaagcctg ggacttcagt gaagatatcc 120
tgcaagactg ctggatacac attcactgca tacaacatac actgggtaaa acagagccat 180
ggaaagagcc ttgagtggat tggaagtatt aatcctaact ttggtgatac tagatacaac 240
cagatgttcg agggcaaggc cacattgact gtagacaagt cctccagcac agcctacatg 300
gaactccgca gcctgacatc tgaggatgct gtagtctatt actgtgcaag atcctctggg 360
gcctggtttc cttactgggg ccaagggact ctggtcactg tctctgca 408
<210> 5
<211> 393
<212> DNA
<213> Artificial sequence (Artificial)
<400> 5
atgaagttgc ctgttaggct gttggtgctg atgttctgga ttcctgcttc cagcagtgat 60
gttttgatga cccaaattcc actctccctg cctgtcagtc ttggagatca agcctccatc 120
tcttgcagag ctagtcagag cattgtacat agtagtggaa acacctattt agaatggtac 180
ctgcagaaac caggccagtc tccaaagctc ctgatctaca aagtttccaa ccgattttct 240
ggggtcccag acaggttcag tggcagtgga tcagggacag atttcacact caagatcagc 300
agagtggagg ctgaggatct gggagtttat tactgctttc aaggttcaca tgttcctccg 360
acgttcggtg gaggcaccaa cctggaaatc aaa 393
<210> 6
<211> 29
<212> DNA
<213> Artificial sequence (Artificial)
<400> 6
ggatcctctg cccagctgtg gtttcatac 29
<210> 7
<211> 26
<212> DNA
<213> Artificial sequence (Artificial)
<400> 7
tatctcgagc gggatgtgca gaccac 26
Claims (10)
1. The monoclonal antibody for resisting Inhibin-alpha protein is characterized in that the amino acid sequences of heavy chain and light chain variable regions of the monoclonal antibody are respectively the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO. 3.
2. The monoclonal antibody of claim 1, wherein the heavy and light chain variable region amino acid sequences of the monoclonal antibody are encoded by the nucleotide sequences set forth in SEQ ID No.4 and SEQ ID No.5, respectively.
3. The monoclonal antibody of claim 1, wherein the antigen used for immunizing a mouse in the preparation process of the monoclonal antibody is a recombinant protein encoded by the nucleotide sequence shown in SEQ ID No.1 and recombinantly expressed by Escherichia coli.
4. The monoclonal antibody of claim 1, which specifically recognizes human Inhibin- α protein.
5. The monoclonal antibody of claim 1, which is produced by a hybridoma cell line having a collection number of CGMCC No. 22320.
6. The monoclonal antibody of claim 1, wherein said anti-Inhibin- α protein is a mouse IgG1 subtype monoclonal antibody.
7. The method for preparing the monoclonal antibody against Inhibin-alpha protein as claimed in any of claims 1 to 6, wherein the antigen used for immunizing the mouse is a recombinant protein encoded by the nucleotide sequence shown in SEQ ID NO.1 and recombinantly expressed in Escherichia coli.
8. A hybridoma cell line for secreting an anti-Inhibin-alpha protein monoclonal antibody, wherein the cell line is a mouse hybridoma cell line 15E11D5E11, and the cell line is preserved in the China general microbiological culture Collection center with the preservation number: CGMCC NO. 22320.
9. Use of the anti-Inhibin- α protein monoclonal antibody of any of claims 1-6 in human Inhibin- α protein immunoassay.
10. An immunoassay reagent for human Inhibin-alpha protein, characterized in that the immunoassay reagent contains the anti-Inhibin-alpha protein monoclonal antibody of any one of claims 1 to 6 as an active ingredient.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111356411.0A CN114075281B (en) | 2021-11-16 | 2021-11-16 | anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CN202111356411.0A CN114075281B (en) | 2021-11-16 | 2021-11-16 | anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof |
Publications (2)
Publication Number | Publication Date |
---|---|
CN114075281A true CN114075281A (en) | 2022-02-22 |
CN114075281B CN114075281B (en) | 2023-04-18 |
Family
ID=80284106
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CN202111356411.0A Active CN114075281B (en) | 2021-11-16 | 2021-11-16 | anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN114075281B (en) |
Cited By (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN116948028A (en) * | 2023-09-20 | 2023-10-27 | 北京合源汇丰医药科技有限公司 | Anti-inhibin antibody and application thereof |
Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005100593A1 (en) * | 2004-04-16 | 2005-10-27 | Monash University | A method for monitoring the progress of cancer |
CN101299962A (en) * | 2004-12-15 | 2008-11-05 | 貝丝以色列女执事医疗中心 | Nucleic acids and polypeptides useful for diagnosing and treating complications of pregnancy |
-
2021
- 2021-11-16 CN CN202111356411.0A patent/CN114075281B/en active Active
Patent Citations (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
WO2005100593A1 (en) * | 2004-04-16 | 2005-10-27 | Monash University | A method for monitoring the progress of cancer |
CN101299962A (en) * | 2004-12-15 | 2008-11-05 | 貝丝以色列女执事医疗中心 | Nucleic acids and polypeptides useful for diagnosing and treating complications of pregnancy |
Non-Patent Citations (2)
Title |
---|
W G MCCLUGGAGE等: "Immunohistochemical staining of normal, hyperplastic, and neoplastic adrenal cortex with a monoclonal antibody against alpha inhibin", 《J CLIN PATHOL》 * |
孙颖等: "人抑制素βA亚基片段的合成及抑制素α亚基、βA亚基单克隆抗体的制备", 《药学学报》 * |
Cited By (2)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
CN116948028A (en) * | 2023-09-20 | 2023-10-27 | 北京合源汇丰医药科技有限公司 | Anti-inhibin antibody and application thereof |
CN116948028B (en) * | 2023-09-20 | 2023-11-28 | 北京合源汇丰医药科技有限公司 | Anti-inhibin antibody and application thereof |
Also Published As
Publication number | Publication date |
---|---|
CN114075281B (en) | 2023-04-18 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN112480260B (en) | anti-PSMA protein monoclonal antibody, cell line, preparation method and application thereof | |
CN112457400B (en) | Anti-beta-catenin protein monoclonal antibody, cell line, preparation method and application thereof | |
CN112442124B (en) | anti-CD 23 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN112194724B (en) | anti-MPO protein monoclonal antibody, cell line, preparation method and application thereof | |
CN109734805B (en) | anti-CK 20 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN110218251B (en) | anti-MSH 2 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN110903389B (en) | Monoclonal antibody and cell line for resisting GFAP protein, and preparation method and application thereof | |
CN113234155B (en) | anti-Calponin protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN113278070A (en) | anti-CK 17 protein monoclonal antibody, cell strain thereof, preparation method and application | |
CN109485724B (en) | anti-Desmin protein monoclonal antibody, cell line, preparation method and application thereof | |
CN113061186A (en) | Monoclonal antibody of anti CA125 protein, cell strain, preparation method and application thereof | |
CN113583120B (en) | Monoclonal antibody against CK20 protein, cell strain, preparation method and application thereof | |
CN112409481B (en) | Anti-p 40 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN114075281B (en) | anti-Inhibin-alpha protein monoclonal antibody, cell line, preparation method and application thereof | |
CN111454365B (en) | anti-MSH 6 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN109293775B (en) | anti-PD-1 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN113956356B (en) | anti-PRL protein monoclonal antibody, cell line and application thereof | |
CN113735971B (en) | anti-CK 18 protein monoclonal antibody and cell strain, preparation method and application thereof | |
CN113831410B (en) | anti-CD 56 protein monoclonal antibody and cell strain, preparation method and application thereof | |
CN113929783B (en) | anti-CD 99 protein monoclonal antibody, cell line, preparation method and application thereof | |
CN113845593B (en) | anti-alpha-SMA protein monoclonal antibody, cell line and application thereof | |
CN114014933B (en) | anti-PLAP protein monoclonal antibody, cell line, preparation method and application thereof | |
CN114149503B (en) | anti-TSH protein monoclonal antibody, cell line, preparation method and application thereof | |
CN110922485B (en) | anti-Ep-cam protein monoclonal antibody, cell line, preparation method and application thereof | |
CN113817055B (en) | anti-Actin protein monoclonal antibody, cell line and application thereof |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
PB01 | Publication | ||
PB01 | Publication | ||
SE01 | Entry into force of request for substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
GR01 | Patent grant | ||
GR01 | Patent grant |