CN114149503B - anti-TSH protein monoclonal antibody, cell line, preparation method and application thereof - Google Patents

Abstract

The invention relates to the field of biological detection, and provides an anti-TSH protein monoclonal antibody, wherein the amino acid sequences of heavy chain and light chain variable regions of the anti-TSH protein monoclonal antibody are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3. According to the technical scheme, a nucleotide sequence SEQ ID NO.6 corresponding to the amino acid fragment at the 220 th to 443 th positions of the GLHA protein and a nucleotide sequence SEQ ID NO.7 corresponding to the amino acid fragment at the 18 th to 136 th positions of the TSHB protein are selected for homologous recombination on a PET27b vector according to the fact that the TSH protein is in a dimer structure consisting of an alpha chain and a beta chain, antigenicity, hydrophilicity and hydrophobicity and a secondary structure of the constituent amino acids, and a nucleotide sequence shown as SEQ ID NO.1 is prepared; and carrying out recombinant expression by using escherichia coli, immunizing a mouse, carrying out cell fusion, screening and cloning to obtain a monoclonal cell line 11A2A8B7 capable of efficiently secreting the anti-TSH protein monoclonal antibody, and carrying out in-vitro culture. The antibody obtained by the scheme is suitable for immunological detection.

Description

anti-TSH protein monoclonal antibody, cell line, preparation method and application thereof

Technical Field

The invention relates to the field of biological detection, in particular to an anti-TSH protein monoclonal antibody, a cell line, a preparation method and application thereof.

Background

TSH (thyroid stimulating hormone, TSH) is an important glycoprotein hormone secreted from the anterior pituitary. Human TSH is a glycoprotein containing 211 amino acids and carbohydrates accounting for about 15% of the entire molecule. The entire molecule consists of two peptide chains, an alpha chain and a beta chain. The adenohypophysis secretes thyroid stimulating hormone, which is affected on the one hand by the stimulation of thyroid stimulating hormone releasing hormone (TRH) secreted by the hypothalamus and on the other hand by the inhibition of thyroid hormone feedback, and antagonizes each other, and they constitute the hypothalamic-adenohypophysis-thyroid axis. Thyroid stimulating hormone activates cyclic adenosine monophosphate (cAMP) by binding to a TSH receptor (TSHR), and causes thyroid cells to secrete growth factors, vascular endothelial growth factors, insulin-like growth factors and the like, which can promote the growth of tumor cells to some extent.

The most common of pituitary diseases is the pituitary tumor. Pituitary tumors are a group of tumors arising from residual cells of the anterior and posterior pituitary and the craniopharyngeal canal epithelium, also known as pituitary adenomas, which are the most common tumors in the saddle, accounting for about 15% of intracranial tumors. The clinical manifestations of pituitary tumors are abnormal hormone secretion, neurological symptoms caused by tumor pressing the tissues around the pituitary, pituitary stroke and other hypofunction of anterior pituitary. Pituitary tumors are most benign and are rare. Hormone-secreting pituitary tumors can be classified into Prolactin (PRL) -secreting pituitary tumors, growth Hormone (GH) -secreting pituitary tumors, adrenocorticotropic hormone (ACTH) -secreting pituitary tumors, and Thyroid Stimulating Hormone (TSH) -secreting pituitary tumors, depending on the type of hormone secretion.

Pituitary TSH-secreting tumors are a rare clinical pituitary glycoprotein hormone-secreting tumor, accounting for approximately 1% to 2% of pituitary tumors. In the early nineties of the twentieth century, it has been documented that TSH adenomas are of monoclonal origin, i.e., formed by the uncontrolled proliferation of a single, mutated cell, which is transformed into a pituitary tumor, resulting in the activation of oncogenes and/or the inactivation of oncogenes, and the development of pituitary tumors progresses due to the continuous proliferation of the mutated cell, which is a single clone, under the promotion of internal and external factors. It has also been discovered by researchers that thyroid hormone receptor (TR) defects or mutations in thyroid stimulating hormone cells are associated with TSH adenomas. Another study demonstrated that post-transcriptional TRmRNA defective products are associated with abnormal negative feedback regulation of thyroid hormone. TSH tumors are mostly large adenomas, and studies have reported that 34% of patients with TSH tumors who are not treated with an antithyroid drug are micro adenomas, while only 19% of patients with TSH tumors who are treated with an antithyroid drug are micro adenomas. Thyrotropin cells are mainly distributed in the anterior pituitary, which may explain in part that most invasive tumors are located in the middle of the pituitary. TSH tumor cells share many points with other functional pituitary tumors. They are difficult to stain, have diverse morphologies under light, and are large in nuclei and prominent in nucleoli.

Disclosure of Invention

The inventor provides an anti-TSH protein monoclonal antibody, and the amino acid sequences of heavy chain and light chain variable regions of the monoclonal antibody are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3.

Furthermore, the heavy chain and light chain variable region amino acid sequences of the monoclonal antibody are respectively encoded by the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO. 5.

Furthermore, in the preparation process of the monoclonal antibody, an antigen used by an immunized mouse is a recombinant protein which is coded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination.

Further, the monoclonal antibody specifically recognizes the human TSH protein.

Further, the monoclonal antibody is produced by a hybridoma cell line with the preservation number of CGMCC NO.22318. The cell line is a mouse hybridoma cell line 11A2A8B7, and is classified and named as: a mouse hybridoma cell line which has been deposited at 29.29.04 in 2021 at the center of China Committee for culture Collection of microorganisms and is addressed to the institute of microorganisms of the national academy of sciences, china, institute of sciences, no.3, west Lu 1, beijing, chaoyang, and the quarter.

Further, the anti-TSH protein is a mouse IgG1 subtype monoclonal antibody.

The inventor also provides a preparation method of the anti-TSH protein monoclonal antibody, and an antigen used by an immune mouse is a recombinant protein which is encoded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination.

Furthermore, homologous recombination is carried out on the PET27b carrier by adopting the nucleotide sequence SEQ ID NO.6 corresponding to the amino acid fragment from the 220 th to the 443 th positions of the GLHA protein and the nucleotide sequence SEQ ID NO.7 corresponding to the amino acid fragment from the 18 th to the 136 th positions of the TSHB protein, so as to prepare the nucleotide sequence shown in SEQ ID NO. 1. Further, in the preparation process, the upstream primer and the downstream primer of the nucleotide sequence SEQ ID NO.6 are respectively the nucleotide sequences shown in SEQ ID NO.8 and SEQ ID NO. 9; the upstream primer and the downstream primer of the nucleotide sequence SEQ ID NO.7 are respectively the nucleotide sequences shown in SEQ ID NO.8 and SEQ ID NO. 9.

The inventor also provides a hybridoma cell line for secreting anti-TSH protein, wherein the cell line is a mouse hybridoma cell line 11A2A8B7, the cell line is preserved in China general microbiological culture Collection center with the preservation number: CGMCC NO.22318. The cell line is a mouse hybridoma cell line 11A2A8B7, and is classified and named as follows: a mouse hybridoma cell line which has been deposited at 29.29.04 in 2021 at the center of China Committee for culture Collection of microorganisms and is addressed to the institute of microorganisms of the national academy of sciences, china, institute of sciences, no.3, west Lu 1, beijing, chaoyang, and the quarter.

The inventors also provide the use of any of the anti-TSH protein monoclonal antibodies described above in immunoassays for human TSH proteins.

Further, the immunodetection includes immunohistochemistry, immunoblotting and enzyme-linked immunoassay.

The invention further provides a human TSH protein immunoassay reagent, and the immunoassay reagent contains any one of the anti-TSH protein monoclonal antibodies as an effective component.

Different from the prior art, according to the technical scheme, the nucleotide sequence SEQ ID NO.6 corresponding to the amino acid fragment at the 220 th-443 th positions of the GLHA protein and the nucleotide sequence SEQ ID NO.7 corresponding to the amino acid fragment at the 18 th-136 th positions of the TSHB protein are selected for homologous recombination on a PET27b vector according to the dimeric structure, antigenicity, hydrophilicity and hydrophobicity and secondary structure of the constituent amino acids of the alpha chain and the beta chain of the TSH protein, so as to prepare the nucleotide sequence shown in SEQ ID NO. 1; and carrying out recombinant expression by using escherichia coli, immunizing a mouse, carrying out cell fusion, screening and cloning to obtain a monoclonal cell line 11A2A8B7 which efficiently secretes the anti-TSH protein monoclonal antibody, carrying out in-vitro culture on the monoclonal cell line 11A2A8B7, and obtaining the anti-TSH protein monoclonal antibody secreted by the cell line. The antibody obtained by the scheme has high specificity and sensitivity, can specifically identify cells expressing TSH protein, and is suitable for immunological detection, particularly immunohistochemical detection.

The above description of the present invention is only an overview of the technical solutions of the present application, and in order to make the technical solutions of the present application more clearly understood by those skilled in the art, the present invention may be further implemented according to the content described in the text and drawings of the present application, and in order to make the above objects, other objects, features, and advantages of the present application more easily understood, the following description is made in conjunction with the detailed description of the present application and the drawings.

Drawings

FIG. 1 is a graph showing the results of electrophoresis of the TSH protein after purification in example 3; m: and (4) marking the molecular weight.

FIG. 2 is a graph showing immunohistochemical staining results for pituitary tumors: the right is TSH secreted by 11A2A8B7, and the left is commercial TSH (TSH 01+ TSH 02).

Detailed Description

To explain in detail the possible application scenarios, technical principles, and practical embodiments of the present application, and to achieve the objectives and effects thereof, the following detailed description is given with reference to the accompanying drawings. The embodiments described herein are only used for clearly illustrating the technical solutions of the present application, and therefore are only used as examples, and the scope of the present application is not limited thereby.

Reference herein to "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment can be included in at least one embodiment of the application. The appearances of the phrase "an embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or related to other embodiments specifically defined. In principle, in the present application, the technical features mentioned in the embodiments can be combined in any manner to form a corresponding implementable technical solution as long as there is no technical contradiction or conflict.

Unless defined otherwise, technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs; the use of relational terms herein is intended only to describe particular embodiments and is not intended to limit the present application.

In the description of the present application, the term "and/or" is a expression for describing a logical relationship between objects, meaning that three relationships may exist, for example a and/or B, meaning: there are three cases of A, B, and both A and B. In addition, the character "/" herein generally indicates that the former and latter associated objects are in a logical relationship of "or".

In this application, terms such as "first" and "second" are used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions.

Without further limitation, in this application, the use of the phrases "comprising," "including," "having," or other similar expressions, is intended to cover a non-exclusive inclusion, and these expressions do not exclude the presence of additional elements in a process, method, or article that includes the elements, such that a process, method, or article that includes a list of elements may include not only those elements defined, but other elements not expressly listed, or may include other elements inherent to such process, method, or article.

As is understood in the examination of the guidelines, the terms "greater than", "less than", "more than" and the like in this application are to be understood as excluding the number; the expressions "above", "below", "within" and the like are understood to include the present numbers. In addition, in the description of the embodiments of the present application, "a plurality" means two or more (including two), and expressions related to "a plurality" similar thereto are also understood, for example, "a plurality of groups", "a plurality of times", and the like, unless specifically defined otherwise.

Example 1 preparation of recombinant TSH protein fragments

1. Antigen fragment selection

The human glycoprotein hormones gonadotropins (CG), luteinizing Hormone (LH), follicle Stimulating Hormone (FSH) and Thyroid Stimulating Hormone (TSH) are dimers consisting of alpha and beta chains that are not covalently associated. Wherein, GLHA protein is the shared alpha chain of the four human glycoprotein hormones; the TSHB proteins are the specific beta-strands of TSH.

According to the dimeric structure composed of alpha chain and beta chain, antigenicity, hydrophilicity and hydrophobicity of amino acids and the secondary structure of TSH protein, the GLHA protein sequence with the number of P01215 is selected from a Uniprot database (http:// www.uniprot.org), the amino acid fragment from the 220 th position to the 443 th position is intercepted, and the corresponding nucleotide sequence is SEQ ID NO.6. Alternatively to the TSHB protein sequence with the selection number P01222, a fragment from amino acid 18 to amino acid 136 is truncated, and the corresponding nucleotide sequence is SEQ ID NO.7.

Homologous recombination is carried out on the carrier PET27b by the SEQ ID NO.6 and the SEQ ID NO.7, and the obtained recombined TSH nucleotide sequence is shown as SEQ ID NO. 1.

Based on 2 base sequences corresponding to the amino acid sequences (SEQ ID NO.6 and SEQ ID NO. 7), software Primer 5.0 was used to design specific primers for two protein sequences:

when 2 different sequences (the first sequence and the second sequence) are subjected to homologous recombination, it is necessary to design suitable primers so that the amplified sequence of the first sequence contains a sequence of about 20bp of the 5 'end or the 3' end of the second sequence, and the amplified sequence of the second sequence contains a sequence of about 20bp of the 3 'end or the 5' end of the first sequence.

Primer corresponding to SEQ ID NO. 6:

an upstream primer: 5 'TTATGGATCCGCTCCGGGATGTACAG 3' (SEQ ID NO.8 restriction site, bamH I)

A downstream primer: 5 'GCCCTCGAGGATTTGTAATAACAGGT 3' (SEQ ID NO.9, cleavage site, xho I).

The primer corresponding to SEQ ID NO. 7:

an upstream primer: 5 'CGGGATCCGCTACTGTCTTTCTGCATTC 3' (SEQ ID NO.10 restriction site, bamH I)

A downstream primer: 5 'CCTCGAGAAGCCGACCAGATAAGATT 3' (SEQ ID NO.11, cleavage site, xho I).

After the design of the primers is completed, the subsequent homologous recombination is specifically carried out according to the following four steps:

the first step is as follows: PCR amplification is carried out on the SEQ ID NO.6 by upstream and downstream primers (SEQ ID NO.8 and SEQ ID NO. 9) of the SEQ ID NO.6, and a band fragment A with 20bp around the 5' end of the SEQ ID NO.7 is obtained after purification;

secondly, PCR amplification is carried out on the SEQ ID NO.7 by upstream and downstream primers (SEQ ID NO.10 and SEQ ID NO. 11) of the SEQ ID NO.7, and a band fragment B with about 20bp of a 3' segment of the SEQ ID NO.6 is obtained after purification;

thirdly, enzyme digestion is carried out on pET27b by the selected enzyme digestion sites (BamH I and Xho I), and a carrier C is obtained after purification;

and fourthly, mixing A \ B \ C according to a ratio (45.5 ng. And (4) sequencing and analyzing the clone with positive target gene shown by PCR, and using the clone with completely correct sequence for next experiment.

2. Expression and purification of recombinant TSH protein fragments

100ul of competent cells (Rosetta) stored at-80 ℃ were removed, thawed, and 5ul of TSH plasmid DNA was added and left on ice for 30min. After heat shock at 42 ℃ for 90 seconds and ice bath for 5min, 800. Mu.L of non-resistant LB medium was added. Recovering and culturing at 37 deg.C for 60min, plating, and culturing overnight. The transformed plate was picked up and single colonies were cultured in 4ml of LB liquid medium overnight at 37 ℃ and 200rpm, and then the cells were maintained.

4ul of the bacterial liquid is taken to be put into 4ml of LB liquid culture medium and cultured overnight for recovery. The cultured cells were inoculated into 200ml of LB liquid medium, mixed, cultured at 37 ℃ and 200rpm until OD =0.6-0.8, and then IPTG (0.5 mM) was added thereto for overnight induction at low temperature. The cells were collected by centrifugation in a 400ml large centrifuge bowl at 4000rpm for 10min and the supernatant was discarded. The precipitate was dispersed in 20-30ml of 10mM Tris-HCl (pH 6.5) and NaCl at a final concentration of 0.5M, and the cells were disrupted by sonication. After centrifugation at 12000rpm for 20 minutes, the centrifuged supernatant was applied to a Ni-NTA nickel column (QIAGEN) for purification, and then eluted with 10mM Tris-HCl (pH 6.5) (containing 0.5M sodium chloride) containing 50mM imidazole, 250mM imidazole, and 500mM imidazole, respectively, to collect protein peaks, followed by electrophoresis for detection.

EXAMPLE 2 establishment of the 11A2A8B7 hybridoma cell line

1. Immunization

The corresponding amino acid sequence of the recombinant TSH protein obtained in the example 1 is shown as SEQ ID NO. 12; 18-20g Balb/c mice (purchased from Wu's laboratory animal, fuzhou) were immunized by abdominal injection at a dose of 50. Mu.g/mouse, emulsified in an equal volume of complete Freund's adjuvant (CFA, sigma). Thereafter, the booster was administered every 14 days, and the antigen was emulsified with Freund's incomplete adjuvant (IFA, sigma Co.) at a dose of 25. Mu.g/mouse. The multi-antibody titer of the anti-immunogen in the mouse serum is detected by indirect ELISA (wavelength of 450 nm) 14 days after the 2 nd boosting immunization, the mouse with the highest titer is subjected to impact immunization by tail vein injection, and the antigen is uniformly mixed by PBS solution, and the dosage is 50 mu g/mouse.

2. Cell fusion:

a mouse spleen cell suspension with up to standard immunity is prepared aseptically, mixed with mouse myeloma cells sp2/0 (ATCC) at a ratio of 5. Standing at room temperature for 90s, adding 4mL of serum-free DMEM (Hyclone company) culture medium preheated to 37 ℃ from slow to fast within 2min, then adding 10mL of preheated serum-free DMEM culture medium within 2min, finally adding the rest preheated serum-free DMEM culture medium within 2min, and fixing the volume to 50mL, wherein the centrifugal tube needs to be slowly shaken in the whole adding process to ensure uniform mixing and reduce the damage to cells. Standing at room temperature for 10min, centrifuging (1000rpm, 5 min), discarding the supernatant, resuspending the cells in 10-20mLHAT (Sigma) medium, and diluting with HAT medium to a final concentration of 0.5X 10 ⁶ cells/mL, all solutions were transferred to 96-well plates at 200. Mu.L/well and labeled. The 96-well plate was carefully transferred to 37℃，5％CO ₂ Culturing in an incubator. The growth state and potential pollution of cells are regularly checked, and the incubator is opened and closed as little as possible to ensure the stability of the culture environment. On day 5 post-fusion, plates were supplemented with HAT medium at 50. Mu.L/well.

3. Cloning and ELISA screening positive hybridoma cells:

when the fused cell diameter is about 1-2mm, 50-200. Mu.L of culture supernatant is aspirated for the first cell selection (ELISA, IHC-P and other methods of detection), and HAT medium is added to the culture wells to 200. Mu.L. And (3) detecting the culture solution supernatant by ELISA, transferring all cell culture solution in the culture hole with the positive result obtained by detection to a 24-hole culture plate, supplementing HT medium, culturing for 3 days at a concentration of 2 mL/hole.

And repeatedly screening each cell line in the 24-well plate, and removing culture well cells which are not positive results to obtain culture well cells with better positive results. Performing subclone screening on the positive well cells obtained from the 24-well culture plate by limiting dilution method, namely adding cell sap obtained by limiting dilution method into 96-well culture plate, and transferring to CO ₂ Culturing in an incubator for 11 days, and repeating cell screening when the diameter of the cloned cell is 1-2 mm. According to the detection result, 4 well-grown monoclonal positive culture wells are selected from each subcloned cell line, and transferred to a 24-well plate for continuous culture. And after a period of time, screening the positive clone cell line cloned in the 24-pore plate again, namely the hybridoma cell line 11A2A8B7 secreting the specific monoclonal antibody. The cell line is transferred into a T-75 culture flask to be amplified to a logarithmic growth phase for seed preservation or subsequent experiments are carried out.

EXAMPLE 3 preparation of monoclonal antibodies by in vitro culture

1. In vitro culture

After obtaining the stable hybridoma cell line, the monoclonal antibody is obtained mainly by an in vitro culture method.

The hybridoma cells were cultured in DMEM complete medium containing 10% fetal bovine serum, and then centrifuged at low speed to collect culture supernatant, which was stored at 4 ℃ for further use.

2. Purification of monoclonal antibodies

Antibody purification using rProtein a sepharose Fast Flow (GE) affinity column: (1) loading the column, loading a proper amount of purchased ProteinA filler into a gravity chromatography column, and washing with an equilibrium buffer (1.5M Tris solution containing 1.5M NaCl, pH 7.0) until equilibrium is reached; (2) loading, namely adding cell supernatant filtered by a 0.22-micron filter membrane into a packed chromatographic column, and controlling the flow rate to be 1 drop/second; (3) balancing, and washing the sample solution to balance by using a balance buffer solution after the sample solution is loaded; (4) eluting, adding elution buffer (0.1M citric acid solution, pH4.5) to wash the column, and collecting eluate; (5) regenerating, adding an equilibrium buffer solution to wash the column to balance after the elution is finished, washing the column with 2 times of column volume of 20% ethanol, and storing at 4 ℃. And finally, identifying the purity of the antibody by adopting an SDS-PAGE method. The result is shown in figure 1, the polyacrylamide gel electrophoresis picture of the purified TSH monoclonal antibody has the purity of more than 95 percent, and the concentration of the antibody is measured by an ultraviolet micro-spectrophotometer method and reaches more than 3.0 mg/mL.

EXAMPLE 4 monoclonal antibody characterization

1. Subtype identification

Coated goat anti-mouse IgG (Beijing China fir Jinqiao Biotechnology Co., ltd.) was diluted to 0.5. Mu.g/ml with 100. Mu.l/well at 4 ℃ overnight in 100mM PBS (pH 7.4). The liquid was decanted, washed 3 times with PBS containing 0.05% Tween (PBS-T), 200. Mu.l of blocking solution (PBS containing 2% BSA and 3% sucrose) was added to each well, and incubated at 37 ℃ for 1h. The liquid was decanted and washed 3 times with PBS-T. 0.1ml of hybridoma supernatant was added to each well and incubated at 37 ℃ for 1h. The decanted solution was washed 3 times with PBS-T. Using a confining liquid 1:1000 dilution of HRP-labeled goat anti-mouse (κ, λ) antibody or 1: HRP-labeled goat anti-mouse (IgM, igG1, igG1a, igG1b, igG3, igA) antibodies (Southern Biotech) were diluted at 2000 and added in an amount of 0.1ml per well, and incubated at 37 ℃ for 1 hour. The liquid was decanted and washed 3 times with PBS-T. 0.15% ABTS (Southern Biotech) and 0.03% H in 50. Mu.L per well ₂ O ₂ The reaction was performed in the citric acid buffer (pH 4.0), and the OD value at a wavelength of 405nm was measured within 10 to 20 min. The results show that the monoclonal antibody of the invention is an IgG1 type murine monoclonal antibody.

2. Determination of affinity constant

Coating TSH protein with coating concentration of 2 μ g/ml,100 μ L/well, coating overnight at 4 deg.C, PBS-TWashing for 3 times. Add 200. Mu.l of blocking solution per well and block at 37 ℃ for 2h, wash 3 times with PBS-T. The monoclonal antibody purified in example 3 was prepared from 1:200 began a 2-fold gradient dilution, and finally 1 well was blank, incubated at 37 ℃ for 1h and washed 3 times with PBS-T. HRP-labeled goat anti-mouse secondary antibody 1:20000 dilution, 100. Mu.L per well, incubation at 37 ℃ for 1h, PBS-T wash 3 times. 0.1% of TMB (Sigma) and 0.03% of H by adding 100. Mu.l per well ₂ O ₂ The reaction was stopped by adding 50. Mu.L of 0.5M sulfuric acid solution to the buffer solution of citric acid-phosphoric acid after 10min of color development. And measuring the light absorption value with the wavelength of 450nm by using a microplate reader. Drawing a curve of the OD value corresponding to the dilution factor of the antibody, and finding out the dilution factor A corresponding to the 'platform OD value' of more than or equal to 1/2. The affinity constant of 7.22X 10 was calculated by the following formula ⁹ 。

Example 5 tissue chip staining and characterization

1. Tissue wax block preparation

HE section staining was performed on the sample tissue to determine the tumor lesion site. And (5) circling the lesion site and preparing to punch. When the receptor wax block is manufactured, a plastic frame is placed on a mould, melted paraffin (the melting point is 56-58 ℃) is poured into the mould, the tissue block is placed into wax liquid in the mould, then a proper amount of wax liquid is added to completely embed the tissue block in the wax liquid, the mould is placed into a refrigerator with the temperature of-20 ℃ for 6min after being cooled to room temperature, the wax block is taken out of the mould, and the section is sliced or placed into the refrigerator with the temperature of 4 ℃ for storage and standby. Trimming, slicing continuously with a thickness of 4 μm, rinsing the slices in 40% ethanol, spreading naturally, transferring the divided slices to 45 deg.C warm water for 30 s, mounting the slices on glass slides treated with 2% APES acetone solution, baking the prepared tissue chips in an oven at 60 deg.C for 2 hr, taking out, cooling at room temperature, and storing in a refrigerator at-4 deg.C.

2. IHC staining and analysis

Conventional xylene dewaxing was performed 3 times for 6 minutes each time with 100%, 95%, 85% gradient ethanol hydration for 3 minutes each time and finally tap water rinse. Performing antigen modificationAfter this time, the sections were placed in a wet box and washed 3X 3 min with PBS. Dropwise addition of 3% of ₂ O ₂ Incubate for 10min and wash with PBS for 3 × 3 min. The PBS was spun off and the peroxidase blocker was added dropwise and incubated for 10 minutes at room temperature. Spin-drying the slices, dripping primary antibody diluted in a proper proportion (the dilution proportion of the antibody is designed according to the concentration of the antibody in the primary dilution) and incubating for 1 hour at room temperature (25 ℃), washing for 3X 3 minutes by PBS, dripping secondary antibody and incubating for 30 minutes at room temperature, washing for 3X 3 minutes by PBS, throwing off the PBS, and developing for 3-10 minutes by using a freshly prepared DAB developing solution. Hematoxylin counterstain for 20 seconds, PBS turns blue. Dehydration was carried out in a gradient of 85% (3 min), 95% (3 min), 100% (3 min) and 100% (3 min) in order, and finally two times xylene was cleared for 10min, followed by sealing with neutral gum.

The immunohistochemical staining results were divided into: positive and negative. Positive expression must be at a specific antigenic site in cells and tissues to be considered positive. Under the conditions of clear tissue staining distribution and accurate cell positioning, the staining results are further divided according to the difference of staining intensity, and the specific steps are as follows:

1. the sample is weakly positive; marked "+";

2. the sample is moderately positive; marked "+";

3. the sample is highly positive; marked as "+++".

4. The sample was negative and marked "-".

3. And (3) sample detection results:

the results of synchronous detection of the anti-TSH protein monoclonal antibody (11A 2A8B 7) prepared by the invention and the commercial anti-TSH protein monoclonal antibody (TSH 01+ TSH 02) in 10 pituitary tumors are shown in the following table

The result shows that the staining of the anti-TSH protein monoclonal antibody (11A 2A8B 7) is accurately positioned, the staining is clear, non-specific staining does not exist, the background is clean, and the anti-TSH protein monoclonal antibody (11A 2A8B 7) is strong in specificity. In 10 cases of pituitary tumors, the number of positive cells and the positive intensity were higher with the anti-TSH protein monoclonal antibody (11 A2A8B 7) than with the control reagent. In particular, in the 1 pituitary tumor sample shown in FIG. 2, the staining intensity of the anti-TSH protein monoclonal antibody (11A 2A8B 7) was +++, whereas the staining intensity of the control reagent was only +; further, the monoclonal antibody (11A 2A8B 7) against TSH protein is more sensitive to differential diagnosis of pituitary tumor than the commercially available antibody, and can avoid the risk of detection omission of pituitary tumor.

And the anti-TSH protein monoclonal antibody (11A 2A8B 7) and the control antibody (TSH 01+ TSH 02) are adopted to carry out synchronous detection on 30 normal tissue chips, and the positive and negative results of the sample are consistent, which indicates that the specificity of the antibody on the commercial tissue is equivalent to that of the commercial antibody.

The 30 normal tissues include: brain, heart, cerebellum, esophagus, adrenal gland, stomach, ovary, small intestine, pancreas, colorectal, parathyroid, liver, pituitary, salivary gland, testis, kidney, thyroid, prostate, breast, uterus, spleen, bladder, tonsil, skeletal muscle, thymus (young child), skin, bone marrow, peripheral nerve, lung, mesothelial cells.

Finally, it should be noted that, although the above embodiments have been described in the text and drawings of the present application, the scope of the patent protection of the present application is not limited thereby. All technical solutions which are generated by replacing or modifying the equivalent structure or the equivalent flow according to the contents described in the text and the drawings of the present application, and which are directly or indirectly implemented in other related technical fields, are included in the scope of protection of the present application.

Sequence listing

<110> Fuzhou mai New Biotechnology development Co., ltd

<120> anti-TSH protein monoclonal antibody, cell line, preparation method and application thereof

<130> 2021

<160> 12

<170> SIPOSequenceListing 1.0

<210> 1

<211> 633

<212> DNA

<213> Artificial sequence (Artificial)

<400> 1

gctccggatg tacaggattg tccagaatgt accctgcagg aaaacccgtt tttcagccag 60

ccgggtgcac cgattctgca gtgtatgggc tgttgcttct cccgtgctta tccgactcct 120

ctgcgctcta aaaaaaccat gctggttcag aaaaacgtta ctagcgaatc cacctgctgc 180

gttgctaaat cctataatcg cgtaaccgta atgggtggtt tcaaagttga aaaccacacc 240

gcgtgccact gctctacctg ttattatcac aaatctgcta tgtctttctg cattccgact 300

gaatacacca tgcatatcga acgtcgtgaa tgcgcttact gcctgacgat caacactact 360

atttgcgcgg gttactgcat gactcgtgat attaacggta aactgttcct gccgaaatac 420

gcactgagcc aagacgtttg cacctaccgt gatttcatct accgcaccgt tgaaatcccg 480

ggctgtccgc tgcatgtcgc tccgtatttc tcctacccgg tagcgctgtc ctgtaaacgt 540

ggcaaatgca acaccgatta tagcgattgc atccacgagg cgatcaaaac caactactgt 600

accaagccgc agaaatctta tctggtcggc ttc 633

<210> 2

<211> 138

<212> PRT

<213> Artificial sequence (Artificial)

<400> 2

Met Asp Trp Leu Trp Asn Leu Leu Phe Leu Met Ala Ala Ala Gln Ser

1 5 10 15

Ala Gln Thr Gln Ile Gln Leu Val Gln Ser Gly Pro Glu Val Lys Lys

20 25 30

Pro Gly Glu Thr Val Lys Ile Ser Cys Lys Ala Ser Gly Tyr Thr Phe

35 40 45

Thr Asn Asn Gly Met Asn Trp Val Lys Gln Ala Pro Gly Lys Gly Leu

50 55 60

Lys Trp Met Gly Trp Ile Asn Thr Tyr Thr Ser Glu Pro Thr Tyr Ala

65 70 75 80

Asp Asp Phe Lys Gly Arg Phe Ala Phe Ser Leu Glu Thr Ser Ala Ser

85 90 95

Thr Ala Tyr Leu Gln Ile Asn Asn Leu Lys Asn Glu Asp Met Ala Thr

100 105 110

Tyr Phe Cys Ala Arg Ala Arg Ala Ser Gly Ala Trp Phe Ala Tyr Trp

115 120 125

Gly Gln Gly Thr Leu Val Thr Val Ser Ala

130 135

<210> 3

<211> 131

<212> PRT

<213> Artificial sequence (Artificial)

<400> 3

Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val Pro

1 5 10 15

Gly Ser Thr Gly Asn Ile Val Leu Thr Gln Ser Pro Ala Ser Leu Ala

20 25 30

Val Ser Leu Gly Gln Arg Ala Thr Ile Ser Cys Arg Ala Thr Glu Ser

35 40 45

Ile Asp Gly Phe Asp Asn Ser Phe Leu His Trp Tyr Gln Gln Lys Pro

50 55 60

Gly Gln Pro Pro Lys Leu Leu Ile Tyr Leu Ala Ser Asn Leu Glu Ser

65 70 75 80

Gly Val Pro Ala Arg Phe Ser Gly Ser Gly Ser Arg Thr Asp Phe Thr

85 90 95

Leu Thr Ile Asp Pro Val Glu Ala Asp Asp Ala Ala Thr Tyr Tyr Cys

100 105 110

Gln Gln Asn Ile Glu Asp Pro Phe Thr Phe Gly Ser Gly Thr Lys Leu

115 120 125

Glu Ile Lys

130

<210> 4

<211> 414

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

atggattggc tgtggaactt gctattcctg atggccgctg cccaaagtgc ccaaacacag 60

atccagttgg tgcagtctgg acctgaggtg aagaagcctg gagagactgt caagatctcc 120

tgcaaggctt ctgggtatac cttcacaaac aatggaatga actgggtgaa acaggctcca 180

ggaaagggtt taaagtggat gggctggata aacacctaca ctagcgaacc aacatatgct 240

gatgacttca agggacggtt tgccttctct ttggaaacct ctgccagcac tgcctatttg 300

cagatcaaca acctcaagaa tgaggacatg gcaacatatt tctgtgccag agctcgggct 360

tcgggggcct ggtttgctta ctggggccaa gggactctgg tcactgtctc tgcg 414

<210> 5

<211> 393

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

atggagacag acacactcct gctatgggtg ctgctgctct gggttccagg ttccacaggt 60

aacattgtgc tgacccaatc tccagcttct ttggctgtgt ctctagggca gagggccacc 120

atatcctgca gagccactga aagtattgat ggttttgaca atagtttttt gcactggtac 180

cagcagaaac caggacagcc acccaaactc ctcatctatc ttgcatccaa cctagaatct 240

ggggtccctg ccaggttcag tggcagtggg tctaggacag acttcaccct caccattgat 300

cctgtggagg ccgatgatgc tgcaacctat tactgtcagc aaaatattga ggatccattc 360

acgttcggct cggggacaaa gttggaaata aaa 393

<210> 6

<211> 346

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

gctccggatg tacaggattg tccagaatgt accctgcagg aaaacccgtt tttcagccag 60

ccgggtgcac cgattctgca gtgtatgggc tgttgcttct cccgtgctta tccgactcct 120

ctgcgctcta aaaaaaccat gctggttcag aaaaacgtta ctagcgaatc cacctgctgc 180

gttgctaaat cctataatcg cgtaaccgta atgggtggtt tcaaagttga aaaccacacc 240

gcgtgccact gctctacctg ttattatcac aaatctgcta tgtctttctg cattccgact 300

gaatacacca tgcatatcga acgtcgtgaa tgcgcttact gcctga 346

<210> 7

<211> 287

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

cgatcaacac tactatttgc gcgggttact gcatgactcg tgatattaac ggtaaactgt 60

tcctgccgaa atacgcactg agccaagacg tttgcaccta ccgtgatttc atctaccgca 120

ccgttgaaat cccgggctgt ccgctgcatg tcgctccgta tttctcctac ccggtagcgc 180

tgtcctgtaa acgtggcaaa tgcaacaccg attatagcga ttgcatccac gaggcgatca 240

aaaccaacta ctgtaccaag ccgcagaaat cttatctggt cggcttc 287

<210> 8

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 8

ttatggatcc gctccggatg tacag 25

<210> 9

<211> 30

<212> DNA

<213> Artificial sequence (Artificial)

<400> 9

gccctcgaga gatttgtgat aataacaggt 30

<210> 10

<211> 27

<212> DNA

<213> Artificial sequence (Artificial)

<400> 10

cgggatccgc tatgtctttc tgcattc 27

<210> 11

<211> 27

<212> DNA

<213> Artificial sequence (Artificial)

<400> 11

cctcgaggaa gccgaccaga taagatt 27

<210> 12

<211> 211

<212> PRT

<213> Artificial sequence (Artificial)

<400> 12

Ala Pro Asp Val Gln Asp Cys Pro Glu Cys Thr Leu Gln Glu Asn Pro

1 5 10 15

Phe Phe Ser Gln Pro Gly Ala Pro Ile Leu Gln Cys Met Gly Cys Cys

20 25 30

Phe Ser Arg Ala Tyr Pro Thr Pro Leu Arg Ser Lys Lys Thr Met Leu

35 40 45

Val Gln Lys Asn Val Thr Ser Glu Ser Thr Cys Cys Val Ala Lys Ser

50 55 60

Tyr Asn Arg Val Thr Val Met Gly Gly Phe Lys Val Glu Asn His Thr

65 70 75 80

Ala Cys His Cys Ser Thr Cys Tyr Tyr His Lys Ser Ala Met Ser Phe

85 90 95

Cys Ile Pro Thr Glu Tyr Thr Met His Ile Glu Arg Arg Glu Cys Ala

100 105 110

Tyr Cys Leu Thr Ile Asn Thr Thr Ile Cys Ala Gly Tyr Cys Met Thr

115 120 125

Arg Asp Ile Asn Gly Lys Leu Phe Leu Pro Lys Tyr Ala Leu Ser Gln

130 135 140

Asp Val Cys Thr Tyr Arg Asp Phe Ile Tyr Arg Thr Val Glu Ile Pro

145 150 155 160

Gly Cys Pro Leu His Val Ala Pro Tyr Phe Ser Tyr Pro Val Ala Leu

165 170 175

Ser Cys Lys Cys Gly Lys Cys Asn Thr Asp Tyr Ser Asp Cys Ile His

180 185 190

Glu Ala Ile Lys Thr Asn Tyr Cys Thr Lys Pro Gln Lys Ser Tyr Leu

195 200 205

Val Gly Phe

210

Claims (6)

1. The monoclonal antibody for resisting TSH protein is characterized in that the amino acid sequences of the heavy chain and light chain variable regions of the monoclonal antibody are respectively the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO. 3.

2. The monoclonal antibody of claim 1, wherein the heavy and light chain variable region amino acid sequences of the monoclonal antibody are encoded by the nucleotide sequences set forth in SEQ ID No.4 and SEQ ID No.5, respectively.

3. The monoclonal antibody of claim 1, wherein the monoclonal antibody is produced by a hybridoma cell line having a collection number of CGMCCNO.22318.

4. The monoclonal antibody of claim 1, wherein the anti-TSH protein monoclonal antibody is a mouse IgG1 subtype monoclonal antibody.

5. A hybridoma cell line for secreting anti-TSH protein monoclonal antibodies, wherein the cell line is a mouse hybridoma cell line 11A2A8B7, the cell line is preserved in the China general microbiological culture Collection center with the preservation number: CGMCC NO.22318.

6. An immunoassay reagent for human TSH protein, comprising the anti-TSH protein monoclonal antibody according to any one of claims 1 to 4 as an active ingredient.

Images