CN114045351A - Specific primer and method for identifying leeches and leech products - Google Patents

Specific primer and method for identifying leeches and leech products Download PDF

Info

Publication number
CN114045351A
CN114045351A CN202111562083.XA CN202111562083A CN114045351A CN 114045351 A CN114045351 A CN 114045351A CN 202111562083 A CN202111562083 A CN 202111562083A CN 114045351 A CN114045351 A CN 114045351A
Authority
CN
China
Prior art keywords
leeches
primer
leech
products
identifying
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN202111562083.XA
Other languages
Chinese (zh)
Inventor
解盈盈
林永强
汪冰
于雅萌
周倩倩
栾永福
崔伟亮
梅桂雪
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shandong Institute for Food and Drug Control
Original Assignee
Shandong Institute for Food and Drug Control
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shandong Institute for Food and Drug Control filed Critical Shandong Institute for Food and Drug Control
Priority to CN202111562083.XA priority Critical patent/CN114045351A/en
Publication of CN114045351A publication Critical patent/CN114045351A/en
Pending legal-status Critical Current

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6858—Allele-specific amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Microbiology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention belongs to the technical field of molecular biology, and particularly relates to a specific primer and a method for identifying leeches and products thereof. The specific primer for identifying leeches and products thereof consists of a primer KTA-F and a primer KTA-R, wherein the primer KTA-F and the primer KTA-R are single-stranded DNA molecules, and the nucleotide sequences are a sequence 1(5 'TTTGCTTACTTCTTTCACTA 3') and a sequence 2(5 'ACACCCTTCGTATCAAGT 3') in a sequence table. The specificity primer of the invention has good specificity to leeches and products thereof, can effectively distinguish leeches from other leeches and common counterfeit products, is quick and simple, and improves the detection efficiency and accuracy. The identification method provided by the invention is characterized in that a specific PCR identification method is applied, a specific primer is designed based on SNP locus difference, the method is strong in specificity, accurate in result and good in durability, and leeches can be identified from other leeches and common counterfeits.

Description

Specific primer and method for identifying leeches and leech products
Technical Field
The invention belongs to the technical field of molecular biology, and particularly relates to a specific primer and a method for identifying leeches and products thereof.
Background
In 2015 edition "Chinese pharmacopoeia" stipulates that leeches are processed products of dried whole leeches, leeches or leeches of leeches belonging to the family of leeches. Modern traditional Chinese medicine considers that leeches belong to blood-activating and stasis-removing herbs and belong to classified blood-activating and menstruation-regulating herbs, and can inhibit the release of platelets, reduce blood fat and inhibit the proliferation of fibroblasts; can be used for preventing and treating thrombosis, and controlling cancer cell metastasis and proliferation. The efficacy of leeches is closely related to their anticoagulant effect, the most important anticoagulant active substance with the best curative effect being Hirudin (Hirudin), which is the most effective and safest natural thrombin inhibitor in the world to date and has a very high medicinal value.
With the continuous development of traditional Chinese medicine preparations of leeches in recent years, the market demand of leeches is increased, so that the resource of traditional Chinese medicine leeches is extremely short, and leeches are common in the market at present and belong to one variety of leeches. However, the production of leeches lacks of industrial specifications, the source is disordered, the problem of medication confusion of leeches and other leeches of other basic sources exists, and because the leeches and other leeches of other basic sources have difference in pharmacological action and pseudo-product mixture are circulated in the medicinal material market, the safety and curative effect of clinical medication are seriously influenced. For safe, accurate and effective clinical medication, it is an urgent need to establish an effective and accurate identification method for leeches with similar shapes and leeches of other basic sources.
At present, leech identification accuracy is questioned, and controllability is poor; in addition, the leech powder product after being processed cannot directly identify dry powder during identification, and the operation is complex.
Disclosure of Invention
In order to solve the problems in the prior art, the invention provides the specific primer for identifying the leeches and the leech products, the specific primer pair has good specificity, can effectively distinguish the leeches from other leeches of other basic sources and common counterfeit products thereof, is quick and simple, and improves the detection efficiency and accuracy.
In order to achieve the purpose, the invention adopts the following technical scheme:
the invention aims to: the specific primer for identifying leeches and products thereof is composed of a primer KTA-F and a primer KTA-R, wherein the primer KTA-F and the primer KTA-R are single-stranded DNA molecules, and the nucleotide sequences are a sequence 1(5 'TTTGCTTACTTCTTTCACTA 3') and a sequence 2(5 'ACACCCTTCGTATCAAGT 3') in a sequence table.
The second purpose of the invention is that: discloses the application of the specific primer in identifying leeches and leech products, wherein the application comprises the following steps:
(1) detecting or assisting to detect whether the sample to be detected contains or is candidate to contain a corresponding leech variety leech by combining the primer;
(2) and detecting or assisting to detect whether the sample to be detected is or is candidate to be the leech which is the corresponding leech variety by combining the primer.
The third purpose of the invention is: discloses a method for identifying leeches and products thereof, which mainly comprises the following steps:
(1) extracting the total DNA of a sample to be detected;
(2) preparing a PCR reaction system by taking the extracted DNA as a template, setting an amplification program, and carrying out PCR amplification by adopting the specific primer of claim 1;
(3) and carrying out agarose gel electrophoresis detection on the amplification product, and carrying out specificity identification on leeches and products thereof according to the result of gel imaging.
Preferably, the PCR reaction system described in step 2 is: 2 XTaq PCR Mix (premixed reagents containing DNA polymerase, dNTPS, MgCl) in a total volume of 20. mu.L2Reaction buffer solution) 10. mu.L, 0.25umol/L primer KTA-F0.4. mu.L, 0.25umol/L primer KTA-R0.4. mu. L, DNA template 2. mu.L, sterileThe double distilled water is filled to 20 mu L.
Preferably, the amplification procedure described in step 2 is: pre-denaturation at 95 deg.C for 4min, circulation at 95 deg.C for 30s, 50 deg.C for 30s, and 72 deg.C for 30s for 35 times, extension at 72 deg.C for 5min, and heat preservation at 4 deg.C.
Preferably, the specific identification of leeches and leech products according to the gel imaging result in the step 3 comprises the following steps:
(1) when a single bright strip is observed at a corresponding position, identifying leeches which are the corresponding leech varieties and are contained or are candidate to be contained in the sample to be detected; when no single bright strip is observed, identifying that the leech variety to be tested does not contain or is candidate to contain no leech;
(2) when a single bright strip is observed at a corresponding position, identifying the sample to be detected as leech of a corresponding leech variety; and when no single bright strip is observed, identifying that the sample to be tested is not leech which is the corresponding leech variety.
Advantageous effects
Compared with the prior art, the invention has the beneficial effects that:
firstly, the invention discloses a pair of novel primers, which have good specificity, can be used for quickly and accurately identifying the authenticity of leech varieties, can effectively distinguish leeches and leeches of a leech base source and common counterfeit products thereof, is quick and simple, and improves the detection efficiency and accuracy. The primers all respond to the target species without generating non-specific reactions to other species.
The invention further discloses a method for identifying leeches and products thereof, the identification method adopts a specific PCR identification method, the specific PCR identification method is based on SNP locus difference, specific primers are designed, and the leeches and other leech-based leeches and other common counterfeit products are identified. Secondly, the identification method can also be used for directly detecting the leech powder, is simple and convenient to operate, and realizes the rapid detection of the leech powder.
Drawings
FIG. 1: a detection result diagram of the DNA extraction process kit;
FIG. 2: a detection result graph of Taq enzyme;
FIG. 3: different primer investigation result graphs;
FIG. 4: a survey result graph of different cycle times;
FIG. 5: a survey result graph of different annealing temperatures and extension times;
FIG. 6: a graph of the results of investigation of the amount of different DNA templates;
FIG. 7: a survey result chart of common Taq enzyme;
FIG. 8: a high-fidelity Taq enzyme investigation result graph;
FIG. 9: a leech medicinal material repeatability investigation result graph;
FIG. 10: leech powder repeatability investigation result graph
FIG. 11: leech powder detection limit result
FIG. 12: leech powder verification result
FIG. 13: a first sample gel electrophoresis map;
FIG. 14: a second sample gel electrophoresis pattern;
FIG. 15: and (5) performing gel electrophoresis pattern III on the sample.
Detailed Description
Hereinafter, the present invention will be described in detail. Before the description is made, it should be understood that the terms used in the present specification and the appended claims should not be construed as limited to general and dictionary meanings, but interpreted based on the meanings and concepts corresponding to technical aspects of the present invention on the basis of the principle that the inventor is allowed to define terms appropriately for the best explanation. Accordingly, the description proposed herein is just a preferable example for the purpose of illustrations only, not intended to limit the scope of the invention, so it should be understood that other equivalents and modifications could be made thereto without departing from the spirit and scope of the invention.
The following examples are given by way of illustration of embodiments of the invention and are not to be construed as limiting the invention, and it will be understood by those skilled in the art that modifications may be made without departing from the spirit and scope of the invention. Unless otherwise specified, reagents and equipment used in the following examples are commercially available products.
Examples
A method for identifying leeches and products thereof:
1. sample collection
Collecting 20 batches of leech medicinal materials and 10 batches of leech powder from each place. The identification shows that 7 batches of leeches, 4 batches of Japanese leeches and the rest batches of leech pseudolites are leech. Sample information is shown in table 1.
TABLE 1 sample Collection
Figure BDA0003418676110000041
The leech of the present invention is a processed product of a dried whole leech Whitmania pigra Whitman belonging to the family Hirudinidae.
The processing method comprises the following steps:
(1) leech
Leech is cleaned, cut and dried. The leech segments are taken out and evenly stirred with yellow wine, and are moistened. Spreading wheat bran into a hot pot, adding wine-wetted leech shreds when smoking, stir-frying until the surface is yellow and special smell escapes, quickly taking out, sieving to remove the scorched wheat bran, and cooling. 10kg of yellow wine and 10kg of wheat bran are used for every 100kg of leech filaments.
(2) Leech powder
Taking clean leeches, removing impurities, cleaning, drying, putting into a superfine pulverizer, and pulverizing into superfine powder.
2. Instrument and reagent
Analytical balance (Sartorius CP225D), water purifier, centrifuge (Eppendorf), mini centrifuge (MinStar), constant temperature mixer (Richenne instruments Co., Ltd., TS100), AB gradient PCR instrument (Proflex, ABI Co., Ltd.), gel imaging system (VILBER Quantum ST5), electrophoresis instrument (BIO-RAD Bio-Rad BaSice PowerPac Basic), Tissue DNA Kit (OMEGA animal genome DNA extraction Kit D3396-02), DNEASy Blood & Tissue Kit (Kajie animal genome DNA extraction Kit 69504), absolute ethanol (analytically pure), primers (synthesized by Shanghai Bioengineering Co., Ltd.), leech (Midson, batch No.: 121061 201305), agarose (111860, BIOWEST), GelRed (41003, Biotium).
3. Establishment of specific PCR detection method
Extraction of DNA
(1) Selection of kits
In order to ensure the DNA extraction efficiency, simultaneously, an OMEGA animal genome DNA extraction kit and a Qiagen animal genome DNA extraction kit are adopted to extract the DNA of a sample, and an animal universal primer COI is adopted for amplification.
Extracting template DNA: taking about 30-60 mg of samples (serial numbers: SZ-01, KT-02, SZWP-01, SZWP-02 and KT-03), sampling 2 parts of each sample in parallel, extracting by using an OMEGA animal genome DNA extraction kit and a Qiagen animal genome DNA extraction kit respectively to obtain a template DNA solution, and storing at-20 ℃.
Extracting template DNA of reference medicinal materials: taking about 30mg of the reference medicinal material powder, and preparing into a reference medicinal material template DNA solution by the same method for preparing the sample template DNA.
(2) PCR amplification and electrophoresis
The PCR reaction is carried out in a 200 mu L centrifuge tube, the total reaction volume is 20 mu L, the reaction system comprises 10 mu L of 2 xTaq PCR Mix, 0.4 mu L of animal universal primer COI (0.25 mu mol/L), 8.2 mu L of sterilized double distilled water and 1 mu L of DNA template. Placing the centrifugal tube in a PCR instrument, wherein the reaction parameters are as follows: pre-denaturation at 95 deg.C for 4min, cyclic reaction for 35 times (95 deg.C for 30s, 50 deg.C for 30s,72 deg.C for 1min), extension at 72 deg.C for 7min, and heat preservation at 4 deg.C. After the PCR amplification reaction is finished, taking 4 mu L of PCR amplification product, detecting the PCR amplification product by GelRed-stained 1.5% agarose gel electrophoresis, carrying out electrophoresis for 15min under the voltage of 120V, and after the electrophoresis is finished, taking a gel slice and placing the gel slice on a gel imager for inspection.
As a result, the two kits can extract the template DNA, the concentration of the DNA has no obvious difference, and in order to save the test cost, the OMEGA animal genome DNA extraction kit is selected. The results are shown in FIG. 1.
Investigation of Taq enzyme
In order to further ensure the sequencing quality, the influence of common Taq enzyme (Tiangen Biotechnology Co., Ltd.) and high fidelity Taq enzyme (Samiefei Biotechnology Co., Ltd.) on PCR amplified bands is respectively considered.
The result shows that the two enzymes can amplify DNA bands, the high-fidelity Taq enzyme PCR band is brighter, and the amplified product is sent to a farm institute for sequencing to prepare for subsequent experiments. The results are shown in FIG. 2.
General Taq enzyme sample information: 1. RY-01; 3. KT-01; 5. KT-02; 7. SZWP-01; 9. 10, SZWP-02; KT-03; 12. blank; marker 13. Marker.
High fidelity Taq enzyme sample information: 1. RY-01; 3. KT-01; 5. KT-02; 7. SZWP-01; 9. 10, SZWP-02; KT-03; 12. blank; KT-03; marker 14.
3-3. design and screening of specific primers
(1) Primer design
Downloading COI sequences of all logged leeches, hirulog and common artifacts thereof from a GenBank database, downloading a whole genome sequence without the COI sequence, carrying out homologous alignment with a sequence obtained by sequencing by using BioEdit software together, and searching for differential SNP loci after manual correction. A leech specific identifying Primer 4 pair is designed by Primer Premier 5.0 software, and the primers are synthesized by bioengineering (Shanghai) Limited company. The primer sequences are shown in Table 2.
TABLE 2 primer sequence Listing
Figure BDA0003418676110000061
(2) Primer screening
Taking sample (No. RY-01, KT-02, SZWP-01, SZWP-02 and KT-03) template DNA, respectively amplifying by using the 4 primers, wherein the selection of the annealing temperature during amplification is based on the annealing temperature during primer synthesis.
The total volume of the reaction is 20. mu.L, the reaction system comprises 10. mu.L of 2 XTaq PCR Mix, 10. mu.L of primers (2.5. mu. mol/L), 8.2. mu.L of sterilized double distilled water, and 1. mu.L of DNA template. Placing the centrifugal tube in a PCR instrument, wherein the reaction parameters are as follows: pre-denaturation at 95 ℃ for 5min, cycling reaction for 35 times (95 ℃ for 30s, primer A, D annealing temperature for 50 ℃ for 30s, primer B, C annealing temperature for 45 ℃ for 30s, and primer B, C annealing temperature for 1min), extension at 72 ℃ for 7min, and heat preservation at 4 ℃. After the PCR amplification reaction is finished, taking 4 mu L of PCR amplification product, detecting the PCR amplification product by GelRed-stained 1.5% agarose gel electrophoresis, carrying out electrophoresis for 15min under the voltage of 120V, and after the electrophoresis is finished, taking a gel slice and placing the gel slice on a gel imager for inspection.
The result shows that the amplification product of the primer A for leeches (numbers: KT-01, KT-02 and KT-03) has a weaker single band at 400-600 bp, the amplification product of the primer D also has a weaker single band at 400-600 bp, and simultaneously has a stronger miscellaneous band, while the amplification products of the primer A and the primer D for Japanese leeches (numbers: RY-01), poecilobdella manillensis (numbers: SZWP-01) and northeast leeches (numbers: SZWP-02) have no obvious band at 400-600 bp. No obvious band was observed in the amplification products of all the primers B and C for the test samples. Therefore, primer A, D was selected for continued optimization of the assay conditions. The specific results are shown in FIG. 3. In the figure: 1. RY-01;
KT-01; KT-02; 5. SZWP-01; 7, SZWP-02; KT-03; 9, Marker; 10. blank control.
(3) Investigation of different numbers of cycles
When the PCR reaction system is 35 cycles, the primer A and the primer D have bands of 400-600 bp but weaker bands, so the cycle times of the primer A and the primer D are increased, 5 cycles are respectively increased, and the brightness of a target band is improved.
The electrophoresis detection result shows that single bands of 400-600 bp of amplification products of the primers A for leeches (the numbers of KT-01, KT-02 and KT-03) are brightened, but associated miscellaneous bands, and the single bands of 400-600 bp of amplification products of the primers D for leeches (the numbers of KT-01, KT-02 and KT-03) are not obviously changed, but the brightness of non-specific bands is increased, while the amplification products of the primers A and the primers D for Japanese leeches (the number of RY-01), poecilobdella manillensis (the number of SZWP-01) and northeast leeches (the number of SZWP-02) have no obvious bands in 400-600 bp. The specificity of the primer D is not high, the primer A is selected to continue to optimize the test conditions, and meanwhile, the main band of the amplification product becomes bright after the cycle number is increased according to the measurement result, but more impurity bands exist, so that the quality of the amplification product is not adjusted by changing the cycle number any more. The results are shown in FIG. 4. In the figure: 1. RY-01; KT-01; KT-02; 5. SZWP-01; 7, SZWP-02; KT-03; 9. blank; marker 10.
3-4. annealing temperature and extension time investigation
The primer A is a single band although the main band is weaker under the amplification conditions that the annealing temperature is 50 ℃ for 30s, the annealing temperature is 72 ℃ for 1min, and the annealing temperature is 72 ℃ for 7min for 35 cycles; after 5 cycles are added, the main band becomes bright, but the number of the impurity bands is large, so that the annealing temperature can be increased and the extension time can be reduced to improve the brightness of the main band without considering the increase of the number of cycles.
Setting 50 ℃, 53 ℃ and 55 ℃ respectively, inspecting the influence of different annealing temperatures on amplification, screening the optimal annealing temperature, adjusting the extension time from original 72 ℃ for 1min and 35 cycles, and 72 ℃ for 7min to 72 ℃ for 30s and 35 cycles, and 72 ℃ for 5min, and inspecting the influence of the extension time on amplification.
The result shows that when the annealing temperature is 50 ℃,72 ℃ for 30s and 72 ℃ is extended for 5min, and 35 cycles are carried out, the amplification products of leeches (numbered: KT-01, KT-02 and KT-03) become bright in a single band of 400-600 bp without associated impurity bands, while the amplification products of Japanese leeches (numbered: RY-01), Poecilobdella manillensis (numbered: SZWP-01) and small leeches in northeast China (numbered: SZWP-02) have no obvious bands in 400-600 bp. The results are shown in FIG. 5. In the figure: 1. RY-01; KT-01; KT-02; 5. SZWP-01; 7, SZWP-02; KT-03; and 9. Marker.
3-5 examination of template quantity
The amount of template DNA in a 20. mu.L reaction system was examined, and 1. mu.L, 2. mu.L and 3. mu.L of template DNA were added, respectively, to compare the intensities of specific bands under different template conditions.
The result shows that the amplification product added with 1-3 mu L of template DNA (number: KT-01, KT-02 and KT-03) has a single band in 400-600 bp, wherein the amplification band is brightest when 2 mu L is added, and the band brightness trend is not obvious along with the increase of the template amount, so that the addition amount of the DNA template in a PCR reaction system is determined to be 2 mu L. The results of no obvious bands of the amplification products of hirudo nipponica (No. RY-01), hirudo poecilobii (No. SZWP-01) and hirudo donbergii (No. SZWP-02) in 400-600 bp are shown in figure 6. In the figure: 1. RY-01; KT-01; KT-02; 5. SZWP-01; 7, SZWP-02; KT-03; 9. blank; marker 10.
Taq enzyme Secondary examination
The influence of common Taq enzyme (Tiangen Biotechnology Co., Ltd.) and high fidelity Taq enzyme (Samiefei Biotechnology Co., Ltd.) on PCR amplified bands was examined, respectively.
PCR reaction is carried out in a 200 mu L centrifuge tube, the total reaction volume is 20 mu L, the common Taq enzyme reaction system comprises 2 xTaq PCR Mix 10 mu L, a primer A (0.25 mu mol/L)0.4 mu L, sterilized double distilled water 7.2 mu L and a DNA template 2 mu L; the high fidelity Taq enzyme reaction system comprises 10 mu L of Platinum SuperFi PCR MaSter Mix, 1 mu L of GC, 1 mu L of primer A (0.25 mu mol/L), 5 mu L of sterilized double distilled water and 2 mu L of DNA template. Placing the centrifugal tube in a PCR instrument, wherein the reaction parameters are as follows: pre-denaturation at 95 deg.C for 4min, cyclic reaction for 35 times (95 deg.C for 30s, 50 deg.C for 30s,72 deg.C for 30s), extension at 72 deg.C for 5min, and keeping at 4 deg.C. After the PCR amplification reaction is finished, taking 4 mu L of PCR amplification product, detecting the PCR amplification product by GelRed-stained 1.5% agarose gel electrophoresis, carrying out electrophoresis for 15min under the voltage of 120V, and after the electrophoresis is finished, taking a gel slice and placing the gel slice on a gel imager for inspection.
The result shows that the two enzymes can amplify DNA strips, the high-fidelity Taq enzyme PCR strip has higher brightness, but the high-fidelity enzyme has higher cost, and the common Taq enzyme is selected for reducing the experiment cost. The results are shown in FIGS. 7 and 8.
3-7 DEG repeatability test of leech medicinal material
Taking a proper amount of sample (number: KT-03), splitting and cleaning, sequentially cleaning with 75% ethanol and sterilized ultrapure water, sucking off surface water, parallelly sampling 6 parts (each about 60 mg) in a 1.5ml centrifuge tube, extracting with OMEGA animal genome DNA extraction kit, and determining according to determined method and conditions.
The determination method mainly comprises the following steps:
(1) extracting the total DNA of a sample to be detected;
(2) preparing a PCR reaction system by taking the extracted DNA as a template, setting an amplification program, and carrying out PCR amplification by adopting the specific primer of claim 1;
(3) carrying out agarose gel electrophoresis detection on the amplification product, and carrying out specificity identification on leeches and products thereof according to the result of gel imaging; when a single bright strip is observed at a corresponding position, identifying leeches and products thereof which contain or are candidate to contain correspondingly in the sample to be tested; identifying that the test sample does not contain or is a candidate for not containing corresponding leeches and preparations thereof, when no single bright band is observed; when a single bright strip is observed at a corresponding position, identifying the sample to be detected as corresponding leech and the product thereof; when no single bright band is observed, the test sample is identified as not corresponding leech and its preparation.
The results are shown in FIG. 9. The results show that the method is highly reproducible.
3-8 leech powder repeatability test
Taking a proper amount of leech powder (number: SZF-03), sampling 6 parts in parallel, putting each part of about 30mg into a 1.5ml centrifuge tube, extracting by using an OMEGA animal genome DNA extraction kit, and determining according to a determined method and conditions. The result shows that 6 samples can amplify the target band, and the method has good repeatability. The results are shown in FIG. 10.
3-9 leech powder detection limit test
To examine the detection sensitivity of the established method, Poecilobdella manillensis (SZWP-01) was added in different amounts at 5%, 12.5%, 25%, 37.5%, 50%, 62.5%, 75%, 87.5% to a sample (No.: SZF-03) in which no band corresponding to the control drug was detected. The electrophoresis detection result shows that more than 12.5 percent of the leech powder can be detected. The results are shown in FIGS. 11 and 12.
3-10 summary of
Through screening of primers and investigation of key factors affecting PCR reaction, such as Taq enzyme, cycle times, annealing temperature, extension time and DNA template dosage, the specific PCR reaction system of leech and products thereof is finally determined as follows: the total volume of the reaction is 20 mu L, and the reaction system comprises 2 xTaq PCR Mix (premixed reagent containing DNA polymerase, dNTPS and MgCl)2Reaction buffer solution) 10. mu.L, 0.4. mu.L each of the upstream and downstream of primer A (2.5. mu. mol/L), 7.2. mu.L of sterile double distilled water, and 2. mu.L of DNA template. Placing the centrifugal tube in a PCR instrument, wherein the reaction parameters are as follows: pre-denaturation at 95 deg.C for 4min, cyclic reaction for 35 times (95 deg.C for 30s, 50 deg.C for 30s,72 deg.C for 30s), extension at 72 deg.C for 5min, and keeping at 4 deg.C.
4. Sample assay
Specific PCR amplification is carried out on 20 collected batches of medicinal materials and 10 batches of leech powder by using the established method, and as a result, specific single bright bands exist on the positions corresponding to gel electrophoresis spectrograms of 7 batches of leech medicinal materials, 9 batches of leech powder and leech reference medicinal materials at 400-600 bp positions, and the rest samples have no bands. The results of the specific experiments are shown in FIGS. 13, 14, 15 and Table 3.
TABLE 3 results of sample measurement
Figure BDA0003418676110000101
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> Shandong province food and drug inspection research institute
<120> specific primer and identification method for identifying leeches and leech products
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 304
<212> DNA
<213> leech (Hirudo)
<400> 1
cctactacat agtattatta tcacagataa gactattaat aaaactgaaa tgtatttatg 60
aaacaacact taaatgtata atgtatatat ttctagaacc acaatctatt ggattattta 120
tcctaacatt tctactctat agaggtatca atttttattt acatttttat tttattgtcg 180
actagttaaa tatgagtttt aatgtcgaaa tttaagtacc ggattagtcc tatcattgag 240
tcgaaatcaa taatgaatac ttgtttattt taagaatgat catcagtata tagtgaaaga 300
agta 304

Claims (7)

1. A specific primer for identifying leeches and products thereof is characterized in that: the kit consists of a primer KTA-F and a primer KTA-R, wherein the primer KTA-F and the primer KTA-R are single-stranded DNA molecules, and the nucleotide sequences are a sequence 1(5 'TTTGCTTACTTCTTTCACTA 3') and a sequence 2(5 'ACACCCTTCGTATCAAGT 3') in a sequence table in sequence.
2. Use of the specific primer of claim 1 for identifying leeches and products thereof.
3. The application according to claim 2, wherein the application comprises:
(1) detecting or assisting in detecting whether a test sample contains or is candidate for containing corresponding leech by combining the primer of claim 1;
(2) detecting or assisting in detecting whether a sample to be detected is or is candidate for being corresponding leech by combining the primer of claim 1.
4. A method for identifying leeches and products thereof is characterized by mainly comprising the following steps:
(1) extracting the total DNA of a sample to be detected;
(2) preparing a PCR reaction system by taking the extracted DNA as a template, setting an amplification program, and carrying out PCR amplification by adopting the specific primer of claim 1;
(3) and carrying out agarose gel electrophoresis detection on the amplification product, and carrying out specificity identification on leeches and products thereof according to the result of gel imaging.
5. The method of claim 4, wherein the PCR reaction system in step (2) is: when the total volume is 20. mu.L, 2 XTaq PCR Mix 10. mu.L, 0.25. mu. mol/L primer KTA-F0.4. mu.L, 0.25. mu. mol/L primer KTA-R0.4. mu. L, DNA template 2. mu.L, and sterile double distilled water make up 20. mu.L.
6. The method of claim 5, wherein the amplification procedure in step (2) is: pre-denaturation at 95 deg.C for 4min, circulation at 95 deg.C for 30s, 50 deg.C for 30s, and 72 deg.C for 30s for 35 times, extension at 72 deg.C for 5min, and heat preservation at 4 deg.C.
7. The method of claim 4, wherein the specific identification of leeches and leech products according to the gel imaging result in the step 3 comprises the following steps:
(1) when a single bright strip is observed at a corresponding position, identifying leeches and products thereof which contain or are candidate to contain correspondingly in the sample to be tested; identifying that the test sample does not contain or is a candidate for not containing corresponding leeches and preparations thereof, when no single bright band is observed;
(2) when a single bright strip is observed at a corresponding position, identifying the sample to be detected as corresponding leech and the product thereof; when no single bright band is observed, the test sample is identified as not corresponding leech and its preparation.
CN202111562083.XA 2021-12-17 2021-12-17 Specific primer and method for identifying leeches and leech products Pending CN114045351A (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111562083.XA CN114045351A (en) 2021-12-17 2021-12-17 Specific primer and method for identifying leeches and leech products

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111562083.XA CN114045351A (en) 2021-12-17 2021-12-17 Specific primer and method for identifying leeches and leech products

Publications (1)

Publication Number Publication Date
CN114045351A true CN114045351A (en) 2022-02-15

Family

ID=80213008

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111562083.XA Pending CN114045351A (en) 2021-12-17 2021-12-17 Specific primer and method for identifying leeches and leech products

Country Status (1)

Country Link
CN (1) CN114045351A (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN103898235A (en) * 2014-04-21 2014-07-02 牡丹江友搏药业股份有限公司 DNA (deoxyribonucleic acid) barcoding based molecular identification method of leech
US20150031085A1 (en) * 2013-07-29 2015-01-29 Jiangnan University Novel Leech Hyaluronidase and Its Application
CN107937566A (en) * 2017-12-29 2018-04-20 江苏大学 The specific primer and its identification method of one group of identification leech
CN109504782A (en) * 2018-11-30 2019-03-22 中国食品药品检定研究院 A pair of of specificity identifies the primer of eurysome golden thread leech
CN109680071A (en) * 2018-11-30 2019-04-26 中国食品药品检定研究院 Identify the primer set and method of leech kind

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20150031085A1 (en) * 2013-07-29 2015-01-29 Jiangnan University Novel Leech Hyaluronidase and Its Application
CN103898235A (en) * 2014-04-21 2014-07-02 牡丹江友搏药业股份有限公司 DNA (deoxyribonucleic acid) barcoding based molecular identification method of leech
CN107937566A (en) * 2017-12-29 2018-04-20 江苏大学 The specific primer and its identification method of one group of identification leech
CN109504782A (en) * 2018-11-30 2019-03-22 中国食品药品检定研究院 A pair of of specificity identifies the primer of eurysome golden thread leech
CN109680071A (en) * 2018-11-30 2019-04-26 中国食品药品检定研究院 Identify the primer set and method of leech kind

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
刘亮伟 等: "《基因工程原理与实验指导》", vol. 1, 湖南科学技术出版社, pages: 178 - 53 *
王文秀 等: ""宽体金线蛭的特异性 PCR 分子鉴定"", 《天津中医药》, vol. 37, no. 11, pages 1300 - 1301 *
解盈盈 等: ""基于DNA条形码和特异性PCR技术鉴别蚂蟥及其常见伪品"", 《中国药事》, vol. 37, no. 1, pages 48 - 58 *

Similar Documents

Publication Publication Date Title
CN114085903B (en) Primer pair probe combination product for detecting mitochondria 3243A &amp; gtG mutation, kit and detection method thereof
CN114457144B (en) Method for detecting copy number of target gene
CN116814812A (en) Primer probe set for identifying scorpion of Buthus martensii Karsch and real-time fluorescence PCR identification method
CN115873993B (en) Kit for detecting 9 genotypes of hepatitis B virus and application thereof
CN105624290A (en) Application of Aspergillus fumigatus annexin anxC4 gene (anxC4 gene)
CN114807419A (en) Method for identifying lonicera confusa and preparation thereof by using TaqMan probe and specific primer
CN112029891A (en) Specific nucleic acid probe for rapidly identifying Fritillaria pallidiflora, method and application
CN108866205A (en) Identify the specific primer of hiruto based on molecular biology method
JP6466725B2 (en) Assisting identification of eel species
CN110066880A (en) A kind of method of four large Chinese carp fish product of fast qualitative detection
CN109735645B (en) Real-time fluorescent PCR (polymerase chain reaction) primer, probe and kit for detecting Sporothrix globosum
CN108754010B (en) Method for rapidly detecting genome DNA residues in total RNA sample
CN114045351A (en) Specific primer and method for identifying leeches and leech products
CN104073560B (en) The rapid molecular discrimination method of a kind of Eucommia ulmoides or former plant
CN104593510A (en) Primer, probe and method for detecting SNP allele variation of peanut FAD2 genes
CN110578013B (en) Identification method for orientation of two pepper fruit stalks and application thereof
CN110904242A (en) Primer composition and application thereof in identification of whitmania pigra
CN110468197A (en) A kind of quick analysis detection kit of ALDH2 gene G1510A polymorphism and method
CN114634992B (en) Indel mark of fritillaria unibracteata and application thereof
CN112481393B (en) PCR detection kit for identifying Hirudo japonica
CN114075564B (en) Malassezia detection composition, kit and detection method thereof
CN112481394B (en) PCR detection kit for identifying Hirudinaria manillensis
CN116970735B (en) Rapid detection method and kit for maize rust recombinant polymerase
CN111057788B (en) LAMP primer group for detecting pseudo-ginseng rust rot and detection method
CN109680077B (en) Method for detecting and identifying Haliotis discus hannai by fluorescent quantitative PCR (polymerase chain reaction)

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
RJ01 Rejection of invention patent application after publication
RJ01 Rejection of invention patent application after publication

Application publication date: 20220215