CN113999801B

CN113999801B - Bacillus belicus capable of modifying wheat bran and application thereof

Info

Publication number: CN113999801B
Application number: CN202111416617.8A
Authority: CN
Inventors: 龚魁杰; 陈利容; 张守梅; 王兴亚; 郭玉秋; 刘开昌
Original assignee: CROP Research Institute of Shandong Academy of Agricultural Sciences
Current assignee: CROP Research Institute of Shandong Academy of Agricultural Sciences
Priority date: 2021-11-25
Filing date: 2021-11-25
Publication date: 2023-05-02
Anticipated expiration: 2041-11-25
Also published as: CN113999801A

Abstract

The invention provides bacillus beljavensis capable of modifying wheat bran and application thereof, and belongs to the technical field of microorganisms. By adopting the strain to carry out solid state fermentation on wheat bran, the modification on wheat bran is effectively realized, and experiments prove that the strain can obviously inhibit the growth of fusarium graminearum in the fermentation process, prevent fusarium graminearum from erupting and produce mycotoxin to cause secondary pollution, and compared with unfermented wheat bran, the fermented wheat bran has obviously increased total phenols, oxidation resistance, soluble pentosans and total pentosans. The water retention of the fermented wheat bran is in an ascending trend, and the oil retention is reduced to a certain extent, so that the quality of the wheat bran is comprehensively and effectively improved. Meanwhile, the fermentation equipment is simple, can realize no sewage and no odor emission, and is a technology which accords with green environmental protection and energy conservation. Therefore, the method has excellent and wide practical application value.

Description

Bacillus belicus capable of modifying wheat bran and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to bacillus beljavensis capable of modifying wheat bran and application thereof.

Background

The disclosure of this background section is only intended to increase the understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art already known to those of ordinary skill in the art.

Wheat bran is also called wheat bran, is a byproduct in the wheat flour manufacturing process, the annual output of wheat bran in China exceeds 3000 ten thousand tons, but the wide application of wheat bran in China is still at a lower level, and the edible and commercial values are lower.

The wheat bran is rich in nutrients, contains multiple vitamins, polysaccharides, polyphenol substances and dietary fibers, and is beneficial to human health. But for the following reasons: the wheat bran contains more cellulose, hemicellulose and other insoluble substances, and has poor edible mouthfeel; wheat bran has poor physical and chemical properties, and can not efficiently utilize certain functional substances; the wheat bran contains Deoxynivalenol (DON) which is produced by fusarium graminearum and has chemical property belonging to trichothecene compound, wherein the DON is higher than that in flour. Because it can cause animal vomit reaction, also called vomit toxin, the wheat product containing vomit toxin has a great threat to human health, and the toxicology experiment shows that vomit toxin has toxicity to cells and nerves, and vomit is the most main symptom. When wheat is polluted by fusarium graminearum, namely scab, the vomitoxin has the highest detection rate in the wheat, and is mycotoxin with high hazard.

Common methods for modifying wheat bran include physical methods, chemical methods, biological methods. The physical modification mainly changes the structure of the dietary fiber through the internal effect, and common physical methods comprise extrusion puffing treatment, ultra-high static pressure, superfine grinding, hot steam and the like to increase the dissolution of substances, so that the method is a relatively common method. The chemical method can break the chemical bond of dietary fiber, but the addition of chemical substances easily causes food safety problems, and has certain limitation on wheat bran modification. Enzyme-modified preparations commonly used for biological treatment of wheat bran are cellulases, xylanases and hemicellulases. At present, the wheat bran modification method is generally combined with physical, chemical and biological methods, so that a better wheat bran modification effect can be achieved. However, DON in wheat bran is not generally destroyed during processing, storage and cooking.

Disclosure of Invention

Based on the defects of the prior art, the invention provides the bacillus beljavensis capable of modifying wheat bran and the application thereof, the strain is obtained from corn yellow serofluid through screening, purifying, identifying and other technologies, the wheat bran can be effectively modified by adopting the strain to carry out solid state fermentation on the wheat bran, and experiments prove that the strain can obviously inhibit the growth of fusarium graminearum in the fermentation process, prevent the fusarium graminearum from eruption, generate mycotoxin to cause secondary pollution, and comprehensively and effectively improve the quality of the wheat bran, thereby having good practical application value.

In order to achieve the technical purpose, the invention relates to the following technical scheme:

in a first aspect of the present invention, there is provided a Bacillus bailii (Bacillus Velezensis) YH03 strain which has been deposited at the China center for type culture Collection (address: university of Wuhan, china) for 1 month 27, having a deposit number of CCTCC NO: m2021164.

The bacillus belgium YH03 has the following characteristics: gram positive (+) bacteria, in the form of rods, have spores, basic anaerobism. The contact enzyme is positive and the citric acid test is positive. The bacterial colony is milky white on an LB culture medium, the initial surface is smooth, the mucus is not easy to pick up, and the edge is irregular; later colony surface is membrane.

The metabolites of Bacillus bailii YH03 also fall within the scope of the present invention.

In a second aspect of the present invention, there is provided a method for culturing the above bacillus belicus YH03, comprising inoculating the bacillus belicus YH03 to a fermentation medium for fermentation culture.

Wherein, the fermentation medium can be LB liquid medium, and the LB liquid medium comprises the following specific components: 3g of tryptone, 1.5g of yeast extract, 3g of NaCl and distilled water to 300mL, and the pH value is 7.0.

In a third aspect of the present invention, there is provided a microbial inoculum comprising bacillus belicus YH03 or a fermentation product or a metabolite thereof according to the first aspect.

The metabolites of the present invention include intracellular and/or extracellular metabolites of the bacterial cell.

In a fourth aspect of the present invention, there is provided a microbial agent comprising the Bacillus belicus YH03 and/or a metabolite comprising the Bacillus belicus YH03.

In a fifth aspect of the present invention, the use of the bacillus beijerinckii YH03 and/or the microbial agent described above in all or part of the following 1) -3) is also within the scope of the present invention:

1) The application of the composition in inhibiting pathogenic bacteria and/or preparing pathogenic bacteria inhibitors;

2) The application of the composition in inhibiting diseases and/or preparing disease inhibitors;

3) The application in solid state fermentation and/or preparation of solid state starter.

In application 1) described above, the pathogenic bacteria include fusarium graminearum, which produces mycotoxins, namely deoxynivalenol (i.e., vomitoxin, DON);

in the above application 2), the disease may be a plant disease caused by fusarium graminearum, and the plant disease may be wheat scab;

in application 3) described above, the solid state fermentation may be wheat bran solid state fermentation; experiments prove that the bacillus bailii YH03 is adopted to carry out solid fermentation treatment on wheat bran, so that the wheat bran can be modified, the content of soluble dietary fiber pentosan and the content of total polyphenol in the wheat bran are increased, and the fermented wheat bran has stronger antioxidant activity and is beneficial to human bodies or animals; simultaneously, the vomitoxin (DON) in wheat bran is effectively reduced.

Accordingly, in a sixth aspect of the present invention, there is provided a wheat bran solid state fermentation method, the method comprising: the bacillus beijerinus YH03 and/or the microbial agent are added into the wheat bran.

The beneficial technical effects of one or more of the technical schemes are as follows:

according to the technical scheme, bacillus belicus capable of modifying wheat bran is obtained by first screening, and the wheat bran is subjected to solid state fermentation by adopting the strain, so that the strain can obviously inhibit the growth of fusarium graminearum in the fermentation process, prevent fusarium graminearum from erupting and generate mycotoxin to cause secondary pollution, and compared with unfermented wheat bran, the fermented wheat bran has obviously increased total phenols, oxidation resistance, soluble pentosans and total pentosans. The water retention of the fermented wheat bran is in an ascending trend, and the oil retention is reduced to a certain extent, so that the quality of the wheat bran is comprehensively and effectively improved. Meanwhile, the fermentation condition is mild, the equipment is simple, no sewage and no odor can be discharged, and the technology is environment-friendly and energy-saving. Therefore, the method has excellent and wide practical application value.

Drawings

The accompanying drawings, which are included to provide a further understanding of the invention and are incorporated in and constitute a part of this specification, illustrate embodiments of the invention and together with the description serve to explain the invention.

FIG. 1 is a plate and a microscopic image of Bacillus bailii YH03 in an example of the present invention.

FIG. 2 is a diagram showing the confronting relationship of Bacillus belicus YH03 plates in the examples of the present invention.

Fig. 3 is a diagram showing the bacteriostatic effect of bacillus belicus YH03 fermentation broth in the embodiment of the invention.

FIG. 4 is a phylogenetic tree of Gyrb of Bacillus bailii YH03 in an example of the present invention.

FIG. 5 is a diagram of lyophilized powder of Bacillus bailii YH03 according to an embodiment of the present invention.

FIG. 6 is a graph showing the effect of fermentation of Bacillus YH03 on the vomitoxin content of wheat bran in the examples of the present invention.

FIG. 7 is a graph showing the effect of Bacillus YH03 fermentation on wheat bran soluble pentosan and total pentosan content in examples of the present invention.

FIG. 8 is a graph showing the effect of Bacillus YH03 fermentation on total phenol content of wheat bran in the examples of the present invention.

FIG. 9 is a graph showing the effect of fermentation of Bacillus YH03 on the antioxidant property of wheat bran in the examples of the present invention.

FIG. 10 is a graph showing the effect of fermentation of Bacillus YH03 on wheat bran proteins in the examples of the present invention.

FIG. 11 is a graph showing the effect of fermentation of Bacillus YH03 on wheat bran proteins in the examples of the present invention.

FIG. 12 is a graph showing the effect of Bacillus YH03 fermentation on wheat bran oiliness in the examples of the present invention.

Detailed Description

It should be noted that the following detailed description is exemplary and is intended to provide further explanation of the invention. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of exemplary embodiments in accordance with the present application. As used herein, the singular is also intended to include the plural unless the context clearly indicates otherwise, and furthermore, it is to be understood that the terms "comprises" and/or "comprising" when used in this specification are taken to specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof.

In one embodiment of the present invention, there is provided a Bacillus bailii (Bacillus Velezensis) YH03 strain deposited at the China center for type culture Collection (address: university of Wuhan, china) with a accession number of CCTCC NO: m2021164.

The bacillus belgium YH03 has the following characteristics: gram positive (+) bacteria, in the form of rods, have spores, basic anaerobism. The contact enzyme is positive and the citric acid test is positive. The bacterial colony is milky white on an LB culture medium, the initial surface is smooth, the mucus is not easy to pick up, and the edge is irregular; later colony surface is membrane. The sequencing result of the Gyrb fragment is shown as SEQ ID NO. 1.

In still another embodiment of the present invention, there is provided the above-mentioned method for culturing bacillus belicus YH03, comprising inoculating the bacillus belicus YH03 to a fermentation medium for fermentation culture.

In still another embodiment of the present invention, there is provided a microbial agent comprising the Bacillus bailii YH03 or a fermented product or a metabolite thereof.

In the present invention, the term "ferment" is used to refer to a fermented product. The corresponding fermentation product may be a liquid obtained from a process of fermentatively culturing bacillus beijerinus YH03 bacteria, and thus may also be referred to as a fermentation broth; the liquid may contain bacteria (thallus), but need not necessarily contain bacteria. The liquid preferably contains a metabolite produced by bacillus belgium YH03 of the invention.

And, in an embodiment of the present invention, the fermentation broth or culture broth containing the cells is centrifuged, filtered, settled or other means known in the art to separate the cells grown in the fermentation broth or culture broth from the liquid, the liquid remaining when the cells are removed being "supernatant", and in the present invention, the extracellular metabolite of bacillus bailii YH03 is contained in the supernatant. In an embodiment of the present invention, the microbial inoculum may also include the supernatant.

And, in an embodiment of the present invention, the fermentation broth or culture broth containing the cells is centrifuged, filtered, settled or other means known in the art to separate cells grown in the fermentation broth or culture broth from the liquid to obtain cells, which may be disrupted by ultrasound (such as ice bath ultrasonication of the cells) or other means known in the art, or, further, the disrupted cells are centrifuged to collect a supernatant, which is noted as a cell-free extract, and in the present invention, the disrupted cells or cell-free extract contains intracellular metabolites of bacillus beliei YH03. In an embodiment of the present invention, the microbial agent may contain a disrupted cell product or a cell-free extract of the microbial agent.

In addition, in the embodiment of the invention, the microbial inoculum can be solid, and is more preferably freeze-dried powder for convenience in storage and transportation, improvement of the survival rate of strains and the like. I.e., the Bacillus bailii YH03 or a fermented product or a metabolite thereof, which is obtained by further freeze-drying the above-mentioned Bacillus bailii YH03 or a fermented product or a metabolite thereof, the freeze-drying technique (including vacuum freeze-drying technique) can be carried out by a conventional method. In one embodiment of the present invention, the freeze-drying method comprises: adding soluble starch into the fermentation culture solution, freezing at-80deg.C overnight, and freeze drying on a freeze dryer; the cold well temperature is-56 ℃, the pressure is 0.1mbar, the main drying is 24-48h, the final drying is 3h, and the vacuum pressure is 0.001mbar.

Wherein the addition amount of the soluble starch is controlled to be 5-15% (w/v), preferably 10%.

In still another embodiment of the present invention, the microbial agent further comprises a carrier in addition to the active ingredient. The carrier may be a carrier commonly used in the field of microbial preparations and which is biologically inert.

The carrier may be a solid carrier or a liquid carrier;

the solid support may be a mineral material, a plant material and/or a polymeric compound; the mineral material can be at least one of clay, talcum, medical stone, kaolin, montmorillonite, white carbon, zeolite, silica and diatomite; the plant material can be at least one of corn flour, bean flour, rice hull powder and starch; the high molecular compound can be polyvinyl alcohol or/and polyglycol;

the liquid carrier may be an organic solvent, vegetable oil, mineral oil, or water; the organic solvent can be decane or/and dodecane.

The dosage form of the microbial inoculum can be various dosage forms, such as liquid, emulsion, suspending agent, powder, granule, wettable powder or water dispersible granule; preferably a powder.

Surfactants (such as Tween 20, tween 80, etc.), binders, stabilizers (such as antioxidants), pH regulators, etc. can also be added into the microbial inoculum according to the need.

In still another embodiment of the present invention, the use of the bacillus belicus YH03 and/or the microbial agent in all or part of the following 1) to 3) is also within the scope of the present invention:

Accordingly, in yet another embodiment of the present invention, there is provided a wheat bran solid state fermentation method comprising: the bacillus beijerinus YH03 and/or the microbial agent are added into the wheat bran.

Specifically, the method comprises the following steps: adding the bacillus belicus YH03 and/or the microbial agent according to the mass ratio of 0.1-10% (preferably 1%) of wheat bran, then adding water according to the material ratio of 1-5:1 (preferably 2:1), stirring and mixing uniformly, sealing and then fermenting; the fermentation temperature is controlled to 25-35 ℃ (preferably 37 ℃), pH is not required to be regulated, and the solid state fermentation time is controlled to 8h and above, preferably 8-168h, such as 8h, 24h, 48h, 72h, 96h and 168h.

The invention is further illustrated by the following examples, which are not to be construed as limiting the invention. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention.

Examples

1. Materials and methods

1.1 materials and instruments

1.1.1 materials

TABLE 1 Main reagents

/>

1.1.2 instruments

Table 2 test instrument and apparatus

/>

1.2 Experimental methods

1.2.1 Bacillus screening and culture purification

Culture medium

Inorganic salt culture medium: 1L distilled water was added with 0.25g KH ₂ PO ₄ ；0.25g MgSO ₄ ·7H ₂ O；0.5gKNO ₃ ；0.5g(NH ₄ ) ₂ SO ₄ ；0.05gCaCl ₂ ；0.003gFeCl ₃ ·H ₂ O,15g agar. Sterilizing with steam at 121deg.C for 15min, cooling to 50-60deg.C, and adding filtered sterilized DON to final concentration of 10 μL/m L. After being mixed evenly, the mixture is poured into a disposable culture dish with the thickness of 9cm, and is cooled and solidified for later use.

LB medium: 10g of tryptone was added to 1L of distilled water; 5g of yeast extract; 10g of sodium chloride, 15g of agar and a natural pH value. Sterilizing with steam at 121deg.C for 15min, cooling to 50deg.C, pouring into 9cm disposable culture dish, cooling, and solidifying.

PDA medium: 6g/L of potato extract powder, 20g/L of glucose and 15g/L of agar. Sterilizing with steam at 121deg.C for 15min, cooling to 50deg.C, pouring into 9cm disposable culture dish, cooling, and solidifying.

Samples are collected from various environments such as soil, leaves, fresh water, corn steep liquor and the like in the month 3 of 2020, and are packaged in self-sealing bags, so that the time and the place of collection are noted. 10g of the weighed sample is added to 90ml of sterilized distilled water and placed in a shaking table at 37℃and shaking at 150rpm for 30min. Standing for 15min, and collecting supernatant, and gradually diluting 10 ^-3 、10 ^-4 、10 ^-5 、10 ^-6 . 100ul of the diluted solution is sucked and evenly coated in an inorganic salt culture medium with DON concentration of 10ug/ml, and the culture is carried out for about 1 week at room temperature of 25-30 ℃. After bacterial colonies grow out, a small amount of bacterial colonies are picked up and cultured by streaking on a new inorganic salt culture medium containing 10ug/ml, and single bacterial colonies are separated.

1.2.2 antagonism of Fusarium graminearum

Plate counter experiment

Resuscitates fusarium graminearum: fusarium graminearum stored at 4℃was inoculated onto PDA medium, cultured at 25-30℃for 3-5 days, and colony diameter was 5-7cm. The bacterial cake was inoculated onto new PDA medium using a sterile punch (6 mm diameter) to punch the colony near the edge.

Bacterial culture solution: and (3) culturing the screened microorganism with the DON degradation in a liquid way. A single colony of the inoculating loop is scraped and added to the sterilized LB liquid medium. Culturing at 150rpm for 18-24 hr, and culturing at 25-30deg.C for one week by spotting 5ul of fungus solution onto PDA culture medium 2cm away from fungus cake.

Antibacterial effect of fermentation supernatant

The bacterial culture was centrifuged at 4000rpm for 5min and the supernatant was filtered through a 0.22um filter (filter sterilization). 200ul of sterile supernatant and 400ul of sterile supernatant are respectively and evenly coated on LB liquid medium, and after the liquid on the flat plate is dried, fusarium graminearum cakes are inoculated on the LB medium coated with the sterile supernatant. Culturing at 25-30deg.C for one week.

1.2.3 Strain identification

Morphological identification

Screening out strain YH03 capable of degrading vomitoxin and inhibiting fusarium graminearum, streaking and inoculating the strain YH03 onto LB culture, and culturing for 2-3 days at room temperature. Colony morphology was observed, slides were prepared by gram staining, and microscopic morphology was observed under a microscope.

Physiological characterization

Molecular biology identification:

bacterial genome DAN kit is adopted to extract colony genome DNA, primer of the Gyrb fragment is utilized to amplify, and the amplified result is detected by 1% agarose gel electrophoresis and then sequenced to sequencing company. Gyrb fragment primer sequence:

UP-1：5’-GAAGTCATCATGACCGTTCTGCA-3’(SEQ ID NO.2)；UP-2Sr：5’-AGCAGGGTACGGATGTGCG AGCC-3’(SEQ ID NO.3)。

1.2.4 preparation of bacterial powder

Activating strains: YH03 deposited on the inclined plane at 4 ℃ is streaked on a solid LB medium and cultured for 12-24 hours at 25-37 ℃.

Seed culture: activated colonies were picked and inoculated into LB medium. The culture was carried out at 37℃and 150rpm for 24 hours.

Fermentation culture solution: inoculating 10% of the seed solution into a fermentation bottle or a fermentation tank for continuous fermentation culture for 24-48h.

And (3) freeze-drying: the fermentation broth was added with 10% soluble starch, frozen overnight at-80 ℃, and then lyophilized on a freeze dryer. The cold well temperature is-56 ℃, the pressure is 0.1mbar, the main drying is 24-48h, the final drying is 3h, and the vacuum pressure is 0.001mbar.

After the bacterial liquid is frozen and dried into bacterial powder, the bacterial powder is packaged by a sterile bag to prevent moisture absorption and is stored for a long time at the temperature of minus 20 ℃.

1.2.5 inoculation of Bacillus solid State fermentation wheat bran

Crushing wheat bran, sieving with a 80-mesh sieve, respectively weighing 100g of wheat bran in a marked triangular flask, adding 50mL of distilled water, inoculating YH03 bacteria powder according to 1% of the mass of the wheat bran, and repeating for 3 times without inoculating bacteria liquid as a reference. The fermentation temperature is 37 ℃ and the humidity is 60%, and samples are taken when wheat bran is fermented for 8h, 1d, 2d, 3d, 4d and 7d and are used for analysis and detection of each index.

1.2.6 vomitoxin detection

The enzyme-linked immunosorbent assay (ELISA) is simple, sensitive and low in cost. The experiment adopts an enzyme-linked immunosorbent assay to measure vomitoxin and examines the ability of bacillus to degrade vomitoxin.

Taking 5.0g of crushed constant weight wheat bran sample, putting the crushed constant weight wheat bran sample into a 100mL conical flask with a plug, and adding 25mL of sterile water to mix with the crushed constant weight wheat bran sample; shaking uniformly on an intelligent constant temperature culture oscillator for 10 minutes (150/min); centrifuging the liquid after shaking in a centrifuge tube at 4000r/min for 5min, taking 1mL of supernatant, and adding 4mL of sterile water; shake well and take 50 μl for detection.

Taking out the required reagents from a refrigerator at the temperature of minus 4 ℃, placing the required reagents at the temperature of 20-25 ℃ for more than 30min, and shaking each reagent uniformly before use. The standard and sample were 2-well parallel and the positions of the standard and sample wells were recorded. Adding 50 mu L/hole of standard substance, sequentially adding 50 mu L/hole of vomitoxin enzyme label, sequentially adding 50 mu L/hole of vomitoxin anti-reagent, slowly shaking, covering with shade, and reacting in dark environment at 25deg.C for 30min. After the reaction is finished, slowly removing the shading object, pouring out the liquid, quickly avoiding pollution, adding 250 mu L/hole of washing liquid, shaking and cleaning for 4 times, wherein each time is 10 seconds, beating the mixture on toilet paper, and puncturing the hole with a sterilized gun head when bubbles exist. Sequentially adding 50 mu L/hole of reagent A and 50 mu L/hole of substrate liquid B, slowly shaking and shaking uniformly, covering with a shading material, and standing at 25deg.C for reaction in dark environment. After the completion, 50. Mu.L/well of the stop solution was rapidly added, and the mixture was slowly and uniformly shaken, and OD values of 450nm and 630nm were measured by using an ELISA reader, respectively, and the data were read out within 5 minutes.

And performing calculation according to a formula (1):

/>

wherein, B- -absorbance value of standard or sample; b (B) ₀ Absorbance value of-0 μg/kg standard.

1.2.7 detection of Total pentosan content

Drawing a standard curve: the D-xylose was prepared as a 100. Mu.g/mL standard solution, and 0.0mL, 0.4mL, 0.8mL, 1.2mL, 1.6mL, and 2.0mL of the D-xylose standard solution were added to the test tube, respectively, and distilled water was added to 3mL.

Firstly, 1% of the ground is taken0.3mL of a solution of the phenol in absolute ethanol is added, 3mL of a solution of 0.1% ferric chloride salt is added, the mixture is plugged by a rubber plug, and the mixture is shaken and homogenized by a vortex mixer. Placing in boiling water bath for 30min, taking out test tube, washing with cold water, cooling, pouring into 10mL brown volumetric flask, and fixing volume with distilled water. A blank was prepared from 0.0mL of the reagent solution, and the difference between the wavelengths at 670nm and 580nm was measured using a 1cm cuvette. Taking the difference of the two wavelengths as an ordinate and the D-xylose amount as an abscissa, obtaining a standard curve of y=0.0012 x-0.0116, R ² ＝0.998。

Sample measurement: weighing 0.10g of wheat bran sample, placing the wheat bran sample into a test tube, adding 20mL of prepared 2mol/L hydrochloric acid solution, plugging the test tube by a rubber plug, placing the test tube into a boiling water bath for 2 hours, washing and cooling the test tube by cold water after the test tube is ended, filtering the test tube by filter paper, collecting filtrate, and properly diluting the filtrate for later use. 3mL of the sample diluent is removed into a test tube, 0.3mL of a 1% solution of lichen phenol in absolute ethanol is taken, and the subsequent measurement steps are carried out according to a standard curve drawing method.

X-Total pentosan content in the sample in grams per hundred grams (g/100 g)

C-represents the D-xylose content in micrograms (. Mu.g) from the D-xylose standard curve

0.88 conversion coefficient of monosaccharide to glycan

N-dilution factor

M-dry weight of sample in grams (g)

1.2.8 detection of water-soluble pentosan content

2.00g of the sample was weighed into an Erlenmeyer flask, 100mL of water was added, the extraction time was 120 minutes with an intelligent constant temperature shaker, the temperature did not exceed 30 ℃, and the mixture was transferred to a centrifuge tube after shaking. Centrifugal force is 4000×g, centrifugal time is 15 minutes. 10mL of the centrifuged supernatant was taken, and 10mL of a 4mol/L hydrochloric acid solution prepared was added to the test tube, followed by hydrolysis in a boiling water bath for 2 hours. After cooling, the filtrate was collected by filtration with filter paper and then diluted appropriately for use. 3mL of the sample dilution was removed to a test tube, 0.3mL of a 1% solution of lichen phenol in absolute ethanol was removed, and the subsequent assay steps were performed according to the standard curve drawing method in 1.2.7.

X-soluble pentosan content in unit of gram per hundred grams (g/100 g)

0.88 conversion coefficient of monosaccharide to glycan

N-dilution factor

M-dry weight of sample in grams (g)

1.2.9 detection of Total phenol content

Preparing a reference liquid: accurately weighing gallic acid reference substance 50mg, dissolving with distilled water, and fixing volume with 50mL volumetric flask to obtain 1.0mg/mL standard solution.

Drawing a standard curve: taking 0.0125mL, 0.025mL, 0.05mL, 0.1mL, 0.2mL to 10mL brown volumetric flasks, adding distilled water 6mL respectively, shaking uniformly, adding FoLin reagent 0.5mL, and shaking uniformly. Standing for 1min, adding 75g/L sodium carbonate 1.5mL, shaking, and homogenizing, and finally fixing volume with distilled water to obtain standard solutions with concentrations of 1.25 μg/mL, 2.5 μg/mL, 5 μg/mL, 10 μg/mL, and 20 μg/mL, respectively, standing in water bath at 75deg.C for 10min at 760nm, measuring absorbance, and establishing standard curve with mass concentration (μg/mL) as abscissa and absorbance A as ordinate to obtain standard curve with y=0.0877x+0.05, and R ² ＝0.999。

Preparing a sample stock solution: 1.00g of sample is weighed, in proportion 1:50 adding 2mol/L NaOH, shaking and extracting for 1 hr under sealed condition, adjusting pH to 3.0, centrifuging (9000 rpm,15min, 4deg.C) to obtain supernatant, extracting total polyphenols with ethyl acetate, and repeating for 3 times. The extract was rotary evaporated at 40 ℃ until no more condensate was allowed to drip, and distilled water was added to a constant volume of 50mL.

Add 1mL of liquid to a 10mL brown volumetric flask, make up 5mL of distilled water, shake with shaking, and then continue to add 0.5mL of LFOLin reagent and shake well. Standing for 1min, adding 75g/L sodium carbonate 1.5mL, mixing, fixing volume with distilled water, heating in water bath at 75deg.C for 10min, selecting wavelength 760nm, and measuring absorbance.

1.2.10 determination of wheat bran DPPH clearance

Sample solution dilution: taking 2mL of 1.2.9 sample stock solution, and fixing the volume to 10mL by distilled water.

1.5mL of a 95% ethanol solution of 0.1mmol/LDPPH is prepared, 1.5mL of a sample solution is taken and uniformly mixed with the solution, the mixture is kept away from light at room temperature for 30min, the wavelength of 517nm is measured, and the absorbance is measured, wherein distilled water is used as a blank control. DPPH radical scavenging was calculated according to the following formula:

DPPH clearance (%) = [1- (a) ₁ -A ₂ )/A ₃ ]×100

Wherein: a is that ₁ Absorbance of sample +DPPH, A ₂ Absorbance of sample +95% ethanol, A ₃ The absorbance was distilled water+DPPH.

1.2.11 determination of wheat bran protein content

And measuring the protein content in the wheat bran by using a full-automatic Kai-type azotometer.

About 0.2g of the sample is weighed into a clean digestion tube, 1 catalytic piece (potassium sulfate and copper sulfate) and 12mL of concentrated sulfuric acid are added, a small funnel is covered above the digestion tube, the digestion tube is put into a digestion instrument for digestion, and the final temperature is set at 420 ℃ and maintained for 1h. 2 blank control tubes were set.

Respectively filling boric acid solution, sodium hydroxide solution and distilled water into corresponding barrels, then adding a color developing agent into the boric acid barrels, and uniformly mixing. Adding 0.1mol/L standard hydrochloric acid solution into the inner barrel, opening a condensate water switch of the Kjeldahl nitrogen determination instrument, starting up for preheating, placing an empty digestive tube at a corresponding position, opening a set program, and measuring a blank sample, wherein the difference value between the two blank samples is not more than 0.02. The protein content of the sample is then measured.

1.2.12 detection of Water and oil holding Property of wheat bran

Water retention (WAI): pouring wheat bran powder with a certain mass into water, slowly stirring for 30min at room temperature, centrifuging at 3000rpm for 15min, and pouring out supernatant.

WAI = precipitate mass after removal of supernatant/sample mass … … … … … … … … … … (4)

0.5g of wheat bran sample is weighed, 10mL of oil (purchased in supermarket) is added and mixed, then the mixture is placed in a pre-weighed centrifuge tube for standing for 10min, the mixture is centrifuged for 25min (3000 rpm), the supernatant is poured out, and the mixture is inverted for 10min and weighed.

Oil retention (OAC) = (W) ₂ -W ₁ )/W ₀ *100………………………………(5)

W _O Mass of dried sample (g)

W ₁ Total mass of dried sample and centrifuge tube (g)

W ₂ Total mass of residue and centrifuge tube after centrifugation (g)

2. Results

2.1 screening of Bacillus

Bacillus is separated from corn steep liquor and named YH03, and can degrade vomitoxin DON. Corn steep liquor is formed by concentrating corn steep liquor, has rich nutrient substances and pH value of 4.0, and belongs to an acidic environment.

2.2 antagonism of Fusarium graminearum

The results of the plate counter experiment are shown in figure 2, and obvious antibacterial zones appear; the bacteriostatic effect of the fermentation supernatant is shown in fig. 3, and the increase of the bacteriostatic effect with the increase of the concentration can be obviously seen.

2.3 identification of strains

Morphological identification results: the bacterial colony is milky white on LB culture medium, the initial surface is smooth, the mucus is not easy to pick up, and the edge is irregular. Later colony surface is membrane.

Physiological characterization results: gram positive (+), the thallus is rod-shaped, has spores and is alkaline anaerobic. The contact enzyme is positive and the citric acid test is positive.

The sequencing result of the Gyrb fragment is shown as SEQ ID NO.1 through molecular biological identification. The homology with Bacillus velezensis (MT 300194.1) is highest and the similarity is 100% as retrieved in NCBI database. The phylogenetic tree of the Gyrb fragment was constructed using the MEGA7.0 phylogenetic tree, as shown in fig. 4, YH03 and Bacillus velezensis (DQ 903176) were clustered together. The YH03 is identified as bacillus beijerinus by combining morphology and physiological characteristics. The strain is preserved in China Center for Type Culture Collection (CCTCC) in 2021, 1 and 27 days, and the preservation number is CCTCC NO: m2021164.

Gyrb fragment sequencing sequence:

GTGTAGGGGCATCCGTCGTAAACGCCTTGTCGACCACTCTTGACGTTACGGTTCATCGTGACGGAAAAATCCATTATCAGGCGTACGAGCGCGGTGTACCTGTGGCCGATCTTGAAGTGATCGGCGAAACTGATAAGACCGGAACGATTACGCACTTCGTTCCGGACCCGGAAATTTTCAAAGAAACAACTGTATATGACTATGATCTGCTTTCAAACCGTGTCCGGGAATTGGCCTTCCTGACAAAAGGCGTAAACATCACGATTGAAGACAAACGTGAAGGACAAGAACGGAAAAACGAGTACCACTACGAAGGCGGAATCAAAAGCTATGTTGAGTACTTAAACCGTTCCAAAGAAGTCGTTCATGAAGAGCCGATTTATATCGAAGGCGAGAAAGACGGCATAACGGTTGAAGTTGCATTGCAATACAACGACAGCTATACAAGCAATATTTATTCTTTCACAAATAATATCAACACATACGAAGGCGGCACGCACGAGGCCGGATTTAAAACCGGTCTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTTTCAAAGAAAATGATCCGAATTTAAGCGGGGATGATGTGAGAGAAGGGCTGACTGCCATTATTTCAATTAAGCACCCTGATCCGCAATTCGAAGGGCAGACGAAAACCAAGCTCGGCAACTCCGAAGCGAGAACGATCACTGATACGCTGTTTTCTTCTGCGCTGGAAACATTCCTTCTTGAAAATCCGGACTCAGCCCGCAAAATCGTTGAAAAAGGTTTAATGGCCGCAAGAGCGCGGATGGCGGCGAAAAAAGCCCGGGAATTGACCCGGCGCAAAAGTGCGCTTGAGATTTCCAATCTGCCGGGCAAACTGGCGGACTGTTCTTCTAAAGATCCGAGCATTTCCGAGCTGTATATCGTAGAGGGTGACTCTGCGGGCGGATCAGCGAAACAGGGACGGGACCGTCATTTCCAAGCCATTCTGCCGCTGCGCGGTAAGATTCTGAACGTTGAGAAAGCCAGACTTGATAAGATTCTCTCAAACAATGAGGTCAGATCAATGATCACGGCCCTCGGAACAGGAATCGGAGAAGATTTT(SEQ ID NO.1)

2.4 preparation of bacterial powder

After the bacterial liquid is frozen and dried into bacterial powder, the bacterial powder is packaged by a sterile bag to prevent moisture absorption and is stored for a long time at the temperature of minus 20 ℃. The bacterial powder is shown in figure 5.

2.5 influence of Bacillus fermentation on the vomitoxin content of wheat bran

As can be seen from fig. 6, the bacillus fermentation significantly reduced the vomitoxin of wheat bran, the vomitoxin was significantly different from the unfermented wheat bran vomitoxin (P < 0.05) at 8-168h, 8.5 times reduced as compared with the original state, no significant difference was observed at 24-72 h, and the vomitoxin was slightly increased after 96h, possibly caused by the consumption of a large amount of organic matter, so that the ratio of the vomitoxin per unit mass of wheat bran was larger, but still lower than that before wheat bran fermentation.

2.6 influence of Bacillus fermentation on wheat bran soluble pentosan and Total pentosan content

Pentosans are a non-starch polysaccharide, which is divided into soluble polyglutamic acid and insoluble pentosans, with soluble and insoluble pentosans constituting the total pentosans. Pentosans are widely found in wheat, but are present in small amounts, the major constituent of the extracellular thin wall of the aleurone layer. As can be seen from FIG. 7, the soluble pentosans and the total pentosans are significantly different from those of the unfermented wheat bran in 8-168 hours, the fermentation time is 24-96 hours, the total pentosans and the soluble non-pentosans have no significant difference (P < 0.05), the total pentosans reach the highest value of 35.76g/100g after the wheat bran is subjected to the solid state fermentation of bacillus, the soluble pentosans reach the maximum value of 6.53g/100g at 48 hours, the contents of the soluble pentosans and the total pentosans are significantly increased, which indicates that the bacillus fermentation can promote the conversion of the insoluble pentosans into the soluble pentosans, which is probably due to the interaction between endogenous xylanases in the wheat bran and metabolites of bacillus.

2.7 influence of Bacillus fermentation on wheat bran Total phenol content

As shown in fig. 8, after the wheat bran is subjected to solid-state fermentation by bacillus, the wheat bran has no significant difference from unfermented wheat bran, the fermentation time is too short, the bound polyphenol is not fully released, the total phenol content is significantly increased after 24 hours of fermentation, the total phenol content of 24 hours, 48 hours and 168 hours of fermentation is not significantly different (P < 0.05), after the bacillus is added into the wheat bran, the total phenol content is increased first, the maximum value of 3.618mg/g is 2.34 times of the raw material at 72 hours of fermentation, and then the total phenol content is reduced, but in the 168 hours of fermentation, the total phenol content in the wheat bran is higher than the unfermented total phenol content, which is probably that the enzyme system generated by the bacillus to ferment the wheat bran breaks the structure of the bound polyphenol. After 96 hours the total phenol content was reduced, probably because the bacillus had partially consumed the substances while releasing them.

2.8 influence of Bacillus fermentation on Oxidation resistance of wheat bran

According to FIG. 9, the wheat bran fermented for 8 hours has no significant difference from unfermented wheat bran, the fermentation time is too short, the release amount of antioxidant ingredients is very small, the DPPH free radical scavenging rate is obviously increased (P < 0.05) after 24 hours of fermentation, the change trend of the DPPH free radical scavenging capacity is similar to the change condition of the total phenol content, the DPPH free radical scavenging rate is increased and then reduced, and the DPPH free radical scavenging rate is increased by 1.7 times compared with the DPPH free radical scavenging rate before fermentation after the bacillus is fermented to 72 hours to reach the maximum of 59.5%. It can be derived that oxidation resistance is closely related to total phenol content.

2.9 influence of Bacillus fermentation on wheat bran proteins

As can be seen from fig. 10, the solid-state fermented wheat bran crude protein was decreased and then increased, but the increase was small in magnitude, compared with the unfermented wheat bran. The wheat bran protein content is the lowest in 8h fermentation, and the wheat bran protein content is obviously different from that of unfermented wheat bran (P < 0.05), the reason is probably that bacillus generates protease to hydrolyze protein in the wheat bran, so that 8h is slightly reduced, bacillus connected with the wheat bran carries protein, the quantity of bacillus is increased along with the prolongation of fermentation time, the protein content is also increased, bacillus in the wheat bran dies and decomposes under the condition of high-temperature drying, and the protein content of the bacillus in the wheat bran is increased, so that the protein content in the wheat bran is reduced firstly and then is increased.

2.10 Effect of Bacillus fermentation on wheat bran Water and oil holding Property

The effect of bacillus fermented wheat bran on its Water Absorption Index (WAI) was determined in this experiment and is shown in fig. 11. The WAI of the bacillus fermented wheat bran is in an ascending trend along with the extension of the fermentation time, compared with unfermented wheat bran, the wheat bran is fermented for 72h and 168h, and the wheat bran is obviously different from the unfermented wheat bran in 72h and 168h (P<0.05 The WAI is highest after 7 days of fermentation, and is 11.11 percent higher than that of unfermented wheat bran. The reason is probably that wheat bran fibers are degraded in the fermentation process, so that the fiber structure becomes loose, the specific surface area of the fiber structure is increased, and the water absorption index is increased. At the same time, the protein in the wheat bran undergoes hydrolysis reaction during fermentation, and the space structure of the protein is destroyed, thereby weakening the hydrophobic interaction between molecules ^[24] . In addition, the soluble matter is increased during the fermentation process, and the insoluble dietary fiber is converted into soluble dietary fiber, whichFor all these reasons, the water solubility index of wheat bran is increased.

As can be seen from fig. 12, the wheat bran fermented with bacillus has slightly increased oil holding capacity at 72h of fermentation, no significant difference from unfermented wheat bran (P < 0.05), and after 168h of fermentation, the wheat bran oil holding capacity is significantly reduced (P < 0.05), because the wheat bran has relatively high oil holding capacity at 80 mesh particle size. And secondly, the wheat bran fiber structure after fermentation is damaged to different degrees, and the mesh-shaped structure of the wheat bran is damaged to a certain extent, so that the holding power of the fermented wheat bran to grease is reduced. After the wheat bran is fermented again, part of dietary fibers are degraded, so that hydrophilic substances are easier to overflow, and the adsorption capacity to grease is reduced.

In summary, the wheat bran is subjected to solid fermentation by bacillus belicus, and the toxin removal condition, total pentosan and water-soluble pentosan content change, protein, total phenol, oxidation resistance and oil retention and water retention change of the wheat bran before and after the solid fermentation of bacillus are analyzed. The main study results were as follows:

compared with unfermented wheat bran, the fermented wheat bran has obviously increased total phenols, oxidation resistance, soluble pentosans and total pentosans. The change trend of the total phenol is that the total phenol is increased and then reduced, and the maximum value of the total phenol is 3.62mg/g when the total phenol is fermented for 72 hours, which is 2.34 times of the raw material. The oxidation resistance change trend is the same as that of the total phenol, the maximum free radical clearance rate reaches 59.5% in 72 hours, and is 1.7 times of that of the raw material. The variation trend of the soluble pentosan is similar to that of the total pentosan, the soluble pentosan reaches the maximum value of 6.53g/100g in 48 hours of fermentation, and the total pentosan reaches the maximum value of 35.76g/100g in 168 hours. The protein content slightly increases after fermentation, and may be the self protein of the thallus, so the wheat bran protein after fermentation is hardly changed. The water retention of the fermented wheat bran tends to increase, while the oil retention is opposite and decreases. The bacillus has better detoxification capability, the vomit toxin content in the whole fermentation process is very low, the vomit toxin is minimized in 8h, the vomit toxin value is 2.85 mu k/kg, and the vomit toxin is reduced by 8.5 times compared with unfermented wheat bran.

Finally, it should be noted that the above-mentioned embodiments are only preferred embodiments of the present invention, and the present invention is not limited to the above-mentioned embodiments, but may be modified or substituted for some of them by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention should be included in the protection scope of the present invention. While the foregoing describes the embodiments of the present invention, it should be understood that the present invention is not limited to the embodiments, and that various modifications and changes can be made by those skilled in the art without any inventive effort.

SEQUENCE LISTING

<110> institute of crop and academy of agricultural sciences in Shandong province

<120> Bacillus beijerinus strain capable of modifying wheat bran and application thereof

<130>

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 1103

<212> DNA

<213> Bacillus bailii (Bacillus Velezensis)

<400> 1

gtgtaggggc atccgtcgta aacgccttgt cgaccactct tgacgttacg gttcatcgtg 60

acggaaaaat ccattatcag gcgtacgagc gcggtgtacc tgtggccgat cttgaagtga 120

tcggcgaaac tgataagacc ggaacgatta cgcacttcgt tccggacccg gaaattttca 180

aagaaacaac tgtatatgac tatgatctgc tttcaaaccg tgtccgggaa ttggccttcc 240

tgacaaaagg cgtaaacatc acgattgaag acaaacgtga aggacaagaa cggaaaaacg 300

agtaccacta cgaaggcgga atcaaaagct atgttgagta cttaaaccgt tccaaagaag 360

tcgttcatga agagccgatt tatatcgaag gcgagaaaga cggcataacg gttgaagttg 420

cattgcaata caacgacagc tatacaagca atatttattc tttcacaaat aatatcaaca 480

catacgaagg cggcacgcac gaggccggat ttaaaaccgg tctgacccgt gtcataaacg 540

actatgcaag aagaaaaggg attttcaaag aaaatgatcc gaatttaagc ggggatgatg 600

tgagagaagg gctgactgcc attatttcaa ttaagcaccc tgatccgcaa ttcgaagggc 660

agacgaaaac caagctcggc aactccgaag cgagaacgat cactgatacg ctgttttctt 720

ctgcgctgga aacattcctt cttgaaaatc cggactcagc ccgcaaaatc gttgaaaaag 780

gtttaatggc cgcaagagcg cggatggcgg cgaaaaaagc ccgggaattg acccggcgca 840

aaagtgcgct tgagatttcc aatctgccgg gcaaactggc ggactgttct tctaaagatc 900

cgagcatttc cgagctgtat atcgtagagg gtgactctgc gggcggatca gcgaaacagg 960

gacgggaccg tcatttccaa gccattctgc cgctgcgcgg taagattctg aacgttgaga 1020

aagccagact tgataagatt ctctcaaaca atgaggtcag atcaatgatc acggccctcg 1080

gaacaggaat cggagaagat ttt 1103

<210> 2

<211> 23

<212> DNA

<213> artificial sequence

<400> 2

gaagtcatca tgaccgttct gca 23

<210> 3

<211> 23

<212> DNA

<213> artificial sequence

<400> 3

agcagggtac ggatgtgcga gcc 23

Claims

1. Bacillus bailii (Bacillus Velezensis) YH03 which has been deposited at China Center for Type Culture Collection (CCTCC) with a deposit number of CCTCC NO: m2021164.

2. The method for culturing bacillus beleidsi YH03 according to claim 1, wherein the method comprises inoculating bacillus beldsi YH03 to a fermentation medium for fermentation culture.

3. The method for culturing bacillus bailii YH03 according to claim 2, wherein the fermentation medium is an LB liquid medium.

4. A microbial agent comprising Bacillus bailii YH03 according to claim 1.

5. The microbial agent of claim 4, wherein the agent is a solid.

6. The microbial agent of claim 5, wherein the agent is a lyophilized powder.

7. The microbial agent of claim 4, further comprising a carrier.

8. The microbial agent of claim 7, wherein the carrier is a carrier commonly used in the art of microbial formulation and is biologically inert.

9. Use of bacillus belgium YH03 according to claim 1 and/or a microbial agent according to any one of claims 4-7 in all or part of the following 1) -3):

3) The application in solid state fermentation and/or preparation of solid state starter;

in the application 1), the pathogenic bacteria are fusarium graminearum;

in the application 2), the disease is a plant disease caused by fusarium graminearum;

in the application 3), the solid state fermentation is wheat bran solid state fermentation.

10. The use according to claim 9, wherein in application 2) the plant disease is wheat scab.

11. A wheat bran solid state fermentation process, comprising: the bacillus beijerinus YH03 according to claim 1 and/or the microbial agent according to any one of claims 4 to 7 are added to wheat bran.

12. The method of claim 11, wherein the method comprises: adding the bacillus beijerinus YH03 and/or the microbial agent according to the mass ratio of 0.1-10% of wheat bran, then adding water according to the material ratio of 1-5:1, stirring and mixing uniformly, sealing and then fermenting.

13. The method of claim 12, wherein the method comprises: adding the bacillus beijerinus YH03 and/or the microbial agent according to the proportion of 1% of the wheat bran mass, then adding water according to the material ratio of 2:1, stirring and mixing uniformly, sealing and then carrying out fermentation treatment.

14. The method according to claim 12 or 13, wherein the fermentation temperature is controlled to 25 to 35 ℃ and the solid state fermentation time is controlled to 8 hours and more.

15. The method of claim 12 or 13, wherein the fermentation temperature is controlled to 37 ℃ and the solid state fermentation time is controlled to 8-168 hours.