CN113999801A

CN113999801A - Bacillus belgii capable of modifying wheat bran and application thereof

Info

Publication number: CN113999801A
Application number: CN202111416617.8A
Authority: CN
Inventors: 龚魁杰; 陈利容; 张守梅; 王兴亚; 郭玉秋; 刘开昌
Original assignee: CROP Research Institute of Shandong Academy of Agricultural Sciences
Current assignee: CROP Research Institute of Shandong Academy of Agricultural Sciences
Priority date: 2021-11-25
Filing date: 2021-11-25
Publication date: 2022-02-01
Anticipated expiration: 2041-11-25
Also published as: CN113999801B

Abstract

The invention provides a bacillus beilesensis capable of modifying wheat bran and application thereof, belonging to the technical field of microorganisms. The wheat bran is subjected to solid state fermentation by adopting the strain, so that the modification of the wheat bran is effectively realized, experiments prove that the strain can obviously inhibit the growth of fusarium graminearum in the fermentation process, prevent the fusarium graminearum from bursting and generate mycotoxin to cause secondary pollution, and compared with unfermented wheat bran, the fermented wheat bran has the advantages that the total phenols, the inoxidizability, the soluble pentosan and the total pentosan of the fermented wheat bran are obviously increased. The water retention capacity of the fermented wheat bran is in an increasing trend, and the oil retention is reduced to some extent, so that the quality of the wheat bran is comprehensively and effectively improved. Meanwhile, the fermentation equipment is simple, can realize the discharge of no sewage and no odor, and is a technology which accords with the environmental protection and energy saving. Therefore, it has excellent and wide practical application value.

Description

Bacillus belgii capable of modifying wheat bran and application thereof

Technical Field

The invention belongs to the technical field of microorganisms, and particularly relates to a bacillus beilesiensis strain capable of modifying wheat bran and application thereof.

Background

The information in this background section is only for enhancement of understanding of the general background of the invention and is not necessarily to be construed as an admission or any form of suggestion that this information forms the prior art that is already known to a person of ordinary skill in the art.

Wheat bran, also called wheat bran, is a byproduct in the wheat flour production process, the annual wheat bran yield of China exceeds 3000 ten thousand tons, but the wide application of China to wheat bran is still at a lower level, and the edible and commercial values are lower.

The wheat bran is rich in nutrients, contains various vitamins, polysaccharides, polyphenol substances and dietary fibers, and is beneficial to human health. But for the following reasons: the wheat bran contains more cellulose, hemicellulose and other insoluble matters, and has poor edible mouthfeel; wheat bran has poor physicochemical properties, and certain functional substances cannot be efficiently utilized; the wheat bran contains higher content of Deoxynivalenol (DON) than flour, the DON is generated by fusarium graminearum, and the chemical property of the DON belongs to trichothecene compounds. Because it can cause animal vomiting reaction and is called vomiting toxin, the wheat product containing vomiting toxin has great threat to human health, and toxicology experiments show that vomiting toxin is toxic to cells and nerves, and vomiting is the most main symptom. When fusarium graminearum pollutes wheat, namely scab, the vomitoxin has the highest detectable rate in the wheat, and the fusarium graminearum is a mycotoxin with high harmfulness.

Common methods for modifying wheat bran include physical, chemical and biological methods. The physical modification mainly changes the structure of dietary fiber through the internal action, and the commonly used physical method comprises extrusion and expansion treatment, ultrahigh static pressure, superfine grinding, hot steam and other methods to increase the dissolution of substances, and is a more commonly used method. The chemical method can break the chemical bond of the dietary fiber, but the food safety problem is easily caused by adding chemical substances, and the method has certain limitation on wheat bran modification. Commonly used enzyme-modified preparations for treating wheat bran by a biological method comprise cellulase, xylanase and hemicellulase. At present, the method for modifying wheat bran is researched, and physical, chemical and biological methods are combined for treatment, so that a better wheat bran modification effect can be achieved. However, DON in wheat bran is generally not destroyed during processing, storage and cooking, whether by physical or chemical treatment.

Disclosure of Invention

Based on the defects of the prior art, the invention provides the belief bacillus capable of modifying wheat bran and the application thereof, the strain is obtained from corn yellow serofluid through the technologies of screening, purification, identification and the like, the wheat bran can be effectively modified by adopting the strain to carry out solid state fermentation on the wheat bran, and experiments prove that the strain can obviously inhibit the growth of fusarium graminearum in the fermentation process, prevent the fusarium graminearum from outbreak, generate mycotoxin to cause secondary pollution, and comprehensively and effectively improve the quality of the wheat bran, so the belief bacillus has good practical application value.

In order to achieve the technical purpose, the invention relates to the following technical scheme:

in a first aspect of the present invention, a strain of Bacillus belgii (Bacillus Velezensis) YH03, which has been deposited at the chinese type culture collection (address: china, wuhan university) at 1 month and 27 days 2021, with the deposition number of CCTCC NO: m2021164.

The characteristics of bacillus belgii YH03 were as follows: gram-positive (+) bacterium, rod-shaped thallus, spore-containing and alkaline-anaerobic. Catalase positive, citrate test positive. The fungus colonies are milky white on an LB culture medium, the surface is smooth in the initial stage, the mucus is not easy to pick up, and the edges are not neat; the surface of the later colony is a film.

The metabolite of the bacillus belgii YH03 also belongs to the protection scope of the invention.

In a second aspect of the present invention, there is provided a method for culturing the above bacillus belgii YH03, said method comprising inoculating said bacillus belgii YH03 to a fermentation medium for fermentation culture.

Wherein, the fermentation medium can be LB liquid medium, the LB liquid medium is composed of: 3g of tryptone, 1.5g of yeast extract, 3g of NaCl and distilled water, wherein the total volume is 300mL, and the pH value is 7.0.

In a third aspect of the present invention, there is provided a microbial agent comprising bacillus belgii YH03 or a fermentation product thereof or a metabolite thereof according to the first aspect.

The metabolite of the invention comprises a thallus intracellular metabolite and/or an extracellular metabolite.

In a fourth aspect of the present invention, there is provided a microbial agent comprising the bacillus belgii YH03 and/or a metabolite comprising bacillus belgii YH 03.

In a fifth aspect of the present invention, the use of the above mentioned bacillus belgii YH03 and/or microbial agents in whole or in part in the following 1) -3) is also within the scope of the present invention:

1) the application in inhibiting pathogenic bacteria and/or preparing pathogenic bacteria inhibitor;

2) the application in inhibiting diseases and/or preparing disease inhibitors;

3) the application in solid fermentation and/or preparation of solid leaven.

In the above-mentioned application 1), the pathogenic bacteria include fusarium graminearum, which can produce a mycotoxin, i.e., deoxynivalenol (i.e., vomitoxin, DON);

in the above-mentioned application 2), the disease may be a plant disease caused by fusarium graminearum, and the plant disease may be wheat scab;

in the above-mentioned application 3), the solid state fermentation may be wheat bran solid state fermentation; experiments prove that the wheat bran can be modified by performing solid fermentation treatment on the wheat bran by using the bacillus beilesiensis YH03, the content of soluble dietary fiber pentosan and the content of total polyphenol in the wheat bran can be increased, and the fermented wheat bran has stronger antioxidant activity and is beneficial to human bodies or animals; and simultaneously effectively reduces vomitoxin (DON) in the wheat bran.

Accordingly, in a sixth aspect of the invention, there is provided a wheat bran solid state fermentation process comprising: adding the Bacillus belgii YH03 and/or a microbial agent into wheat bran.

The beneficial technical effects of one or more technical schemes are as follows:

according to the technical scheme, the bacillus beiLeisi capable of modifying wheat bran is obtained by screening for the first time, the wheat bran is subjected to solid state fermentation by adopting the strain, experiments prove that the bacillus beiLeisi capable of modifying wheat bran can obviously inhibit the growth of fusarium graminearum in the fermentation process, prevent the fusarium graminearum from outbreak and produce mycotoxin to cause secondary pollution, and compared with unfermented wheat bran, the fermented wheat bran has the advantages that the total phenols, the inoxidizability, the soluble pentosan and the total pentosan of the fermented wheat bran are obviously increased. The water retention capacity of the fermented wheat bran is in an increasing trend, and the oil retention is reduced to some extent, so that the quality of the wheat bran is comprehensively and effectively improved. Meanwhile, the fermentation condition is mild, the equipment is simple, the discharge of no sewage and no odor can be realized, and the method is a green, environment-friendly and energy-saving technology. Therefore, it has excellent and wide practical application value.

Drawings

The accompanying drawings, which are incorporated in and constitute a part of this specification, are included to provide a further understanding of the invention, and are incorporated in and constitute a part of this specification, illustrate exemplary embodiments of the invention and together with the description serve to explain the invention and not to limit the invention.

FIG. 1 shows a plate and microscopic image of Bacillus beijerinckii YH03 in examples of the present invention.

FIG. 2 shows the stand-off of Bacillus beilesiensis YH03 plate in an example of the present invention.

FIG. 3 is a graph showing the bacteriostatic effect of Bacillus beleisi YH03 fermentation broth in the examples of the present invention.

FIG. 4 shows a phylogenetic tree of Gyrb of Bacillus belgii YH03 in example of the present invention.

FIG. 5 is a diagram of the lyophilized powder of Bacillus belgii YH03 in example of the present invention.

FIG. 6 is a graph showing the effect of fermentation of Bacillus YH03 on wheat bran vomitoxin content in examples of the present invention.

FIG. 7 is a graph showing the effect of fermentation of Bacillus YH03 on wheat bran soluble pentosan and total pentosan content in examples of the present invention.

FIG. 8 is a graph showing the effect of fermentation of Bacillus YH03 on total phenols content in wheat bran in examples of the present invention.

FIG. 9 is a graph showing the effect of fermentation of Bacillus YH03 on wheat bran antioxidant activity in examples of the present invention.

FIG. 10 is a graph showing the effect of fermentation of Bacillus YH03 on wheat bran protein in examples of the present invention.

FIG. 11 is a graph showing the effect of fermentation of Bacillus YH03 on wheat bran protein in examples of the present invention.

FIG. 12 is a graph showing the effect of fermentation of Bacillus YH03 on the oil retention of wheat bran in examples of the present invention.

Detailed Description

It is to be understood that the following detailed description is exemplary and is intended to provide further explanation of the invention as claimed. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

It is noted that the terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of example embodiments in accordance with the present application. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, and it should be understood that when the terms "comprises" and/or "comprising" are used in this specification, they specify the presence of stated features, steps, operations, devices, components, and/or combinations thereof, unless the context clearly indicates otherwise.

In one embodiment of the present invention, a strain of Bacillus beilai ensis (Bacillus Velezensis) YH03, which has been deposited in the chinese type culture collection (address: wuhan university, china) at 1 month 27 in 2021, with the deposition number of CCTCC NO: m2021164.

The characteristics of bacillus belgii YH03 were as follows: gram-positive (+) bacterium, rod-shaped thallus, spore-containing and alkaline-anaerobic. Catalase positive, citrate test positive. The fungus colonies are milky white on an LB culture medium, the surface is smooth in the initial stage, the mucus is not easy to pick up, and the edges are not neat; the surface of the later colony is a film. The sequencing result of the Gyrb fragment is shown in SEQ ID NO. 1.

In another embodiment of the present invention, there is provided a method for culturing the bacillus beijerinckii YH03, wherein the method comprises inoculating the bacillus beijerinckii YH03 into a fermentation medium for fermentation culture.

In another embodiment of the present invention, there is provided a microbial agent comprising the bacillus belgii YH03 or a fermentation product thereof or a metabolite thereof.

In the present invention, the term "fermentate" is used to refer to a fermentation product. The corresponding fermentation product may be a liquid obtained from the process of fermentatively culturing the bacillus beleisi YH03 bacterium, and thus, may also be referred to as a fermentation broth; the liquid may contain bacteria (bacteria cells), but does not necessarily need to contain bacteria. The liquid preferably contains a metabolite produced by bacillus belgii YH03 of the present invention.

And, in the embodiments of the present invention, the liquid remaining when the bacterial cells are removed is a "supernatant" by separating the bacterial cells growing in the fermentation broth or culture broth from the liquid by centrifugation, filtration, sedimentation or other means known in the art, and in the present invention, the extracellular metabolite of bacillus belgii YH03 is contained in the supernatant. In the embodiment of the present invention, the microbial agent may also contain the supernatant.

In the embodiment of the present invention, the fermentation liquid or culture liquid containing the bacterial cells is centrifuged, filtered, settled or separated from the liquid to obtain the bacterial cells, the bacterial cells can be disrupted by ultrasound (e.g., ultrasonic cell disruption in ice bath) or other means known in the art, or the disrupted bacterial cells are centrifuged to collect the supernatant, which is referred to as cell-free extract, and the disrupted bacterial cells or cell-free extract contains intracellular metabolites of bacillus beilesiensis YH 03. In the embodiment of the present invention, the microbial agent may contain a disrupted product or a cell-free extract of the microbial agent.

And, in the embodiment of the present invention, the microbial inoculum may also be a solid, and more preferably a freeze-dried powder, for the convenience of storage, transportation, improvement of the survival rate of the strain, and the like. Namely, the bacillus belgii YH03 or the fermentation product thereof or the metabolite thereof is further subjected to freeze drying, and the freeze drying technology (including vacuum freeze drying technology) can be carried out by a conventional method. In one embodiment of the present invention, the freeze-drying method comprises: adding soluble starch into the fermentation culture solution, freezing at-80 deg.C overnight, and freeze-drying in a freeze-drying machine; the cold well temperature is-56 deg.C, the pressure is 0.1mbar, the main drying time is 24-48h, the final drying time is 3h, and the vacuum pressure is 0.001 mbar.

Wherein the adding amount of the soluble starch is controlled to be 5-15% (w/v), preferably 10%.

In another embodiment of the present invention, the microbial agent further contains a carrier in addition to the active ingredient. The carrier may be one that is commonly used in the art of microbial preparation and is biologically inert.

The carrier can be a solid carrier or a liquid carrier;

the solid carrier can be mineral materials, plant materials and/or high molecular compounds; the mineral material may be at least one of clay, talc, medical stone, kaolin, montmorillonite, white carbon, zeolite, silica and diatomaceous earth; the plant material can be at least one of corn flour, bean flour, rice hull flour and starch; the high molecular compound can be polyvinyl alcohol or/and polyglycol;

the liquid carrier can be an organic solvent, vegetable oil, mineral oil, or water; the organic solvent may be decane or/and dodecane.

The preparation formulation of the microbial inoculum can be various preparation formulations, such as liquid, emulsion, suspending agent, powder, granules, wettable powder or water dispersible granules; preferably a powder.

According to the requirement, the microbial inoculum can also be added with a surfactant (such as Tween 20, Tween 80 and the like), a binder, a stabilizer (such as an antioxidant), a pH regulator and the like.

In another embodiment of the present invention, the application of the bacillus belgii YH03 and/or the microbial agent in whole or in part in the following 1) -3) is also within the protection scope of the present invention:

2) the application in inhibiting diseases and/or preparing disease inhibitors;

3) the application in solid fermentation and/or preparation of solid leaven.

Thus, in a further embodiment of the present invention, there is provided a wheat bran solid state fermentation process comprising: adding the Bacillus belgii YH03 and/or a microbial agent into wheat bran.

Specifically, the method comprises the following steps: adding the bacillus beilesensis YH03 and/or the microbial agent according to the proportion of 0.1-10% (preferably 1%) of the wheat bran, then adding water according to the material ratio of 1-5: 1 (preferably 2:1), stirring and mixing uniformly, and carrying out fermentation treatment after sealing; the fermentation temperature is controlled to be 25-35 ℃ (preferably 37 ℃), the pH is not required to be adjusted, and the solid state fermentation time is controlled to be 8 hours or more, preferably 8-168 hours, such as 8 hours, 24 hours, 48 hours, 72 hours, 96 hours and 168 hours.

The invention is further illustrated by the following examples, which are not to be construed as limiting the invention thereto. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention.

Examples

1. Materials and methods

1.1 materials and instruments

1.1.1 materials

TABLE 1 Main reagents

1.1.2 instruments

TABLE 2 test instruments and apparatus

1.2 Experimental methods

1.2.1 Bacillus screening and culture purification

Culture medium

Inorganic salt culture medium: adding 0.25g KH into 1L distilled water₂PO₄；0.25g MgSO₄·7H₂O；0.5gKNO₃；0.5g(NH₄)₂SO₄；0.05gCaCl₂；0.003gFeCl₃·H₂O, 15g agar. Sterilizing with high pressure steam at 121 deg.C for 15min, cooling to 50-60 deg.C, adding DON sterilized by filtration to obtain final concentration of 10 μ L/m L. And (4) uniformly mixing, pouring into a disposable culture dish of 9cm, and cooling and solidifying for later use.

LB culture medium: adding 10g of tryptone into 1L of distilled water; 5g yeast extract; 10g of sodium chloride, 15g of agar, natural pH. Sterilizing with high pressure steam at 121 deg.C for 15min, cooling to 50 deg.C, pouring into 9cm disposable culture dish, cooling, and solidifying.

PDA culture medium: 6g/L of potato extract powder, 20g/L of glucose and 15g/L of agar. Sterilizing with high pressure steam at 121 deg.C for 15min, cooling to 50 deg.C, pouring into 9cm disposable culture dish, cooling, and solidifying.

Samples are collected from various environments such as soil, leaves, fresh water, corn steep liquor and the like in 3 months in 2020 and are packaged in self-sealing bags, and the collection time and place are marked. A sample (10 g) was weighed into 90ml of sterilized distilled water, and placed in a shaker at 37 ℃ for 30min with 150rpm shaking. Standing for 15min, and gradually diluting the supernatant by 10 steps^-3、10^-4、10^-5、10^-6. Sucking 100ul of the diluted solution, uniformly spreading the diluted solution in an inorganic salt culture medium with DON concentration of 10ug/ml, and culturing at room temperature of 25-30 ℃ for about 1 week. After the bacteria grow out, a small amount of bacteria are picked and dropped into a new inorganic salt culture medium containing 10ug/ml for streak culture, and a single bacterial colony is separated.

1.2.2 antagonistic action against Fusarium graminearum

Experiment of slab confrontation

Recovering fusarium graminearum: inoculating Fusarium graminearum stored at 4 deg.C to PDA culture medium, culturing at 25-30 deg.C for 3-5 days, and the colony diameter is 5-7 cm. The cake was inoculated on fresh PDA medium by punching a hole near the edge of the colony using a sterile punch (6 mm diameter).

Bacteria culture solution: and (3) carrying out liquid culture on the screened DON-degrading microorganisms. One loop of the single colony was scraped and added to sterilized LB liquid medium. Culturing for 18-24h at 150rpm of shaking table, dropping 5ul of the bacterial liquid on PDA culture medium 2cm away from the bacterial cake, and culturing at 25-30 deg.C for one week.

Bacteriostatic effect of fermentation supernatant

The bacterial culture was centrifuged at 4000rpm for 5min and the supernatant was passed through a 0.22um filter (filter sterilized). Respectively and uniformly coating 200ul of sterile supernatant and 400ul of sterile supernatant on an LB liquid culture medium, and inoculating fusarium graminearum cakes on the LB culture medium coated with the sterile supernatant after the liquid on the flat plate is dried. Culturing at 25-30 deg.C for one week.

1.2.3 Strain identification

Morphological identification

Screening out a strain YH03 which can degrade vomitoxin and inhibit fusarium graminearum, streaking and inoculating the strain YH03 to LB culture, and culturing at room temperature for 2-3 days. The colony morphology was observed, slides were prepared by gram staining, and microscopic morphology was observed under a microscope.

Physiological characterization

Molecular biological identification:

bacterial genome DNA is extracted by using a bacterial genome DAN kit, primers of the Gyrb fragments are used for amplification, and the amplification result is subjected to 1% agarose gel electrophoresis detection and then sequenced by a sequencing company. Primer sequences of the Gyrb fragments:

UP-1：5’-GAAGTCATCATGACCGTTCTGCA-3’(SEQ ID NO.2)；UP-2Sr：5’-AGCAGGGTACGGATGTGCG AGCC-3’(SEQ ID NO.3)。

1.2.4 preparation of fungal powder

Activating strains: YH03 stored at 4 ℃ slant was streaked onto solid LB medium and cultured at 25-37 ℃ for 12-24 hours.

Seed culture: activated colonies were picked and inoculated into LB medium. Incubated at 37 ℃ and 150rpm for 24 h.

Fermentation culture solution: inoculating the seed liquid to a fermentation bottle or a fermentation tank according to the proportion of 10% for continuous fermentation culture for 24-48 h.

Freeze-drying: adding 10% soluble starch into the fermentation culture solution, freezing at-80 deg.C overnight, and freeze drying in a freeze dryer. The cold well temperature is-56 deg.C, the pressure is 0.1mbar, the main drying time is 24-48h, the final drying time is 3h, and the vacuum pressure is 0.001 mbar.

Freeze drying the bacteria liquid to obtain bacteria powder, packing in aseptic bag to prevent moisture absorption, and storing at-20 deg.c for long period.

1.2.5 inoculation of Bacillus solid fermentation wheat bran

Crushing wheat bran, sieving with a 80-mesh sieve, weighing 100g of wheat bran in a marked triangular flask respectively, adding 50mL of distilled water, inoculating YH03 strain powder according to 1% of the mass of the wheat bran, and repeating for 3 times without inoculating the strain liquid as a control. The fermentation temperature is 37 ℃, the humidity is 60%, and samples are taken when the wheat bran is fermented for 8h, 1d, 2d, 3d, 4d and 7d, and are used for analyzing and detecting each index.

1.2.6 vomitoxin detection

The enzyme-linked immunosorbent assay (ELISA) is simple, sensitive and low in cost. The experiment adopts an enzyme-linked immunosorbent assay to detect the vomitoxin and investigate the ability of bacillus to degrade the vomitoxin.

Taking 5.0g of the wheat bran sample with the constant weight, putting the wheat bran sample into a 100mL conical flask with a plug, and supplementing 25mL of sterile water to mix with the wheat bran sample; shaking on an intelligent constant temperature culture oscillator for 10 minutes (150/min); centrifuging the liquid after shaking in a centrifuge tube at 4000r/min for 5min, taking 1mL of supernatant, and adding 4mL of sterile water; shake well and take 50 μ L for detection.

Taking out the required reagent from a refrigerator at the temperature of-4 ℃, and placing the reagent at the temperature of 20-25 ℃ for over 30min, wherein each reagent is shaken up before use. Standards and samples were made 2 wells in parallel and the locations of the standard and sample wells were recorded. Adding 50 mu L/hole of standard substance, sequentially adding 50 mu L/hole of vomitoxin enzyme label in sequence of sample 50 mu L/hole, then adding 50 mu L/hole of vomitoxin anti-reagent, slowly shaking and shaking up, covering with light-shielding substance, and reacting for 30min at 25 ℃ in a dark environment. After the reaction is finished, slowly removing the light-shading object, pouring out the liquid to quickly avoid pollution, adding 250 mu L of washing liquid per hole, shaking and cleaning for 4 times at intervals of 10s every time, beating the toilet paper to be dry, and puncturing bubbles in the holes by using a sterilized gun head. Adding 50 mu L/hole of reagent A liquid and 50 mu L/hole of substrate liquid B liquid in sequence, slowly shaking and shaking uniformly, covering with a shade, and placing at 25 ℃ for reaction in a dark environment. And (3) after the reaction is finished, quickly adding 50 mu L of stop solution into the reaction chamber, slowly and uniformly vibrating the reaction chamber, and respectively measuring OD values of 450nm and 630nm by using an enzyme-labeling instrument, wherein the data are required to be read within 5 min.

And calculated according to equation (1):

wherein, B-absorbance value of the standard or sample; b is₀-absorbance value of 0 μ g/kg standard.

1.2.7 Total pentosan content determination

Drawing a standard curve: preparing the D-xylose into a standard solution of 100 mu g/mL, adding the standard solution of the D-xylose into a test tube respectively by 0.0mL, 0.4mL, 0.8mL, 1.2mL, 1.6mL and 2.0mL, and adding distilled water to 3 mL.

0.3mL of 1% orcinol absolute ethyl alcohol solution is taken firstly, then 3mL of 0.1% ferric chloride hydrochloric acid solution is added, the mixture is plugged by a rubber stopper, and the mixture is shaken uniformly by a vortex mixer. Placing into boiling water bath for 30min, taking out the test tube, washing with cold water, cooling, pouring into 10mL brown volumetric flask, and diluting to constant volume with distilled water. A blank control was prepared using 0.0mL of the reagent solution, and the difference between the two wavelengths at 670nm and 580nm was measured using a 1cm cuvette. Taking the difference value of the two wavelengths as the ordinate and the D-xylose amount as the abscissa, obtaining a standard curve with y being 0.0012x-0.0116 and R²＝0.998。

And (3) sample determination: weighing 0.10g of wheat bran sample, putting the wheat bran sample into a test tube, adding 20mL of prepared 2mol/L hydrochloric acid solution, plugging the test tube with a rubber stopper, putting the test tube into a boiling water bath for 2 hours, flushing the test tube with cold water after the completion of the process, cooling the test tube, filtering the test tube with filter paper, collecting filtrate, and properly diluting the filtrate for later use. Transferring 3mL of sample diluent into a test tube, taking 0.3mL of 1% orcinol absolute ethyl alcohol solution, and performing subsequent determination steps according to a standard curve drawing method.

X-Total pentosan content in the sample in grams per hundred grams (g/100g)

C-represents the D-xylose content in micrograms (. mu.g) from the D-xylose standard curve

0.88-conversion coefficient of monosaccharide to glycan

N-dilution multiple

M-sample Dry weight in grams (g)

1.2.8 detection of content of water-soluble pentosan

Weighing 2.00g of sample into a triangular flask, adding 100mL of water, extracting for 120 minutes by using an intelligent constant temperature oscillator at the temperature of not more than 30 ℃, shaking uniformly, and transferring the mixture into a centrifuge tube. The centrifugal force was 4000 xg and the centrifugation time was 15 minutes. 10mL of the centrifuged supernatant was taken, and 10mL of a 4mol/L prepared hydrochloric acid solution was added to the tube, followed by hydrolysis in a boiling water bath for 2 hours. After cooling, the filtrate was collected by filtration through filter paper and then diluted appropriately for use. Transferring 3mL of sample diluent into a test tube, taking 0.3mL of 1% orcinol absolute ethyl alcohol solution, and performing subsequent determination steps according to a standard curve drawing method in 1.2.7.

X-soluble pentosan content in the sample in grams per hundred grams (g/100g)

0.88-conversion coefficient of monosaccharide to glycan

N-dilution multiple

M-sample Dry weight in grams (g)

1.2.9 Total phenol content determination

Preparation of a reference liquid: accurately weighing 50mg of gallic acid reference substance, dissolving with distilled water, and diluting to constant volume with a 50mL volumetric flask to obtain a standard solution with mass concentration of 1.0 mg/mL.

Drawing a standard curve: respectively adding 6mL of distilled water into 0.0125mL, 0.025mL, 0.05mL, 0.1mL, 0.2mL to 10mL brown volumetric flasks, uniformly shaking, adding 0.5mL of FoLin reagent, and uniformly shaking. Standing for 1min, adding 75g/L sodium carbonate 1.5mL, shaking and oscillating uniformly, fixing volume with distilled water, preparing into standard solutions with concentrations of 1.25 μ g/mL, 2.5 μ g/mL, 5 μ g/mL, 10 μ g/mL and 20 μ g/mL respectively, water bathing at 75 deg.C for 10min, measuring absorbance at wavelength of 760nm, establishing standard curve with mass concentration (μ g/mL) as abscissa and absorbance A as ordinate, and obtaining standard curve with y being 0.0877x +0.05, R²＝0.999。

Preparing a sample stock solution: weighing 1.00g of sample, and mixing the materials according to the proportion of 1: adding 2mol/L NaOH into 50, shaking under sealed condition for 1 hr, adjusting pH to 3.0, centrifuging (9000rpm, 15min, 4 deg.C), collecting supernatant, extracting total polyphenols with ethyl acetate, and repeating for 3 times. The extract is subjected to rotary evaporation at 40 ℃ until condensed water does not drip, and distilled water is added to the extract to reach a constant volume of 50 mL.

Add 1mL of liquid to a 10mL brown flask, add 5mL of distilled water, shake and then continue to add 0.5mL of LFoLin reagent and shake well. Standing for 1min, adding 1.5mL of 75g/L sodium carbonate, mixing, diluting with distilled water to desired volume, heating in 75 deg.C water bath for 10min, selecting wavelength of 760nm, and measuring absorbance.

1.2.10 determination of wheat bran DPPH clearance

Sample solution dilution: 2mL of the 1.2.9 sample stock solution was taken and made up to 10mL with distilled water.

Preparing 1.5mL of 0.1mmol/LDPPH 95% ethanol solution, mixing 1.5mL of sample solution with the ethanol solution uniformly, standing at room temperature in a dark place for 30min, measuring absorbance at wavelength of 517nm, and using distilled water as blank control. DPPH radical clearance was calculated according to the following formula:

DPPH clearance (%) - [1- (a)₁-A₂)/A₃]×100

Wherein: a. the₁Absorbance of sample + DPPH, A₂Absorbance of sample + 95% ethanol, A₃Absorbance of distilled water + DPPH was used.

1.2.11 measurement of wheat bran protein content

And measuring the protein content in the wheat bran by using a full-automatic Kjeldahl apparatus.

Weighing about 0.2g of sample into a clean digestion tube, adding 1 catalytic sheet (potassium sulfate and copper sulfate) and 12mL of concentrated sulfuric acid, covering a small funnel above the digestion tube, placing the digestion tube into a digester for digestion, setting the final temperature to be 420 ℃, and keeping for 1 h. 2 blank control tubes were set.

Respectively filling boric acid solution, sodium hydroxide solution and distilled water into corresponding large barrels, then adding the color developing agent into the boric acid barrels, and uniformly mixing. Adding 0.1mol/L standard hydrochloric acid solution into the inner barrel, opening a condensed water switch of a Kjeldahl azotometer, starting up for preheating, placing an empty digestion tube at a corresponding position, opening a set program, and measuring a blank sample, wherein the blank difference value of the two times is not more than 0.02. The sample is then tested for protein content.

1.2.12 wheat bran Water and oil Retention test

Water retention (WAI): pouring a certain mass of wheat bran powder into water, slowly stirring for 30min at room temperature, then centrifuging for 15min at 3000rpm, and pouring out supernatant.

WAI sediment quality/sample quality … … … … … … … … … … (4) after removal of supernatant

Weighing 0.5g wheat bran sample, adding 10mL oil (purchased from supermarket), mixing, standing in a pre-weighed centrifuge tube for 10min, centrifuging for 25min (3000rpm), pouring out supernatant, inverting for 10min, and weighing.

Oil retention (OAC) ═ W₂-W₁)/W₀*100………………………………(5)

W_O- -mass of dried sample (g)

W₁- -Total mass of dried sample and centrifuge tube (g)

W₂- -the residue after centrifugation and the total mass of the centrifuge tube (g)

2. Results

2.1 selection of Bacillus

A bacillus strain is separated from corn steep liquor, is named YH03 and can degrade vomitoxin DON. The corn steep liquor is formed in the concentration of the corn steep liquor, is rich in nutrient substances, has a pH value of 4.0, and belongs to an acidic environment.

2.2 antagonistic action against Fusarium graminearum

The results of the plate confrontation experiments are shown in figure 2, and obvious antibacterial zones appear; the bacteriostatic effect of the fermented supernatant is shown in fig. 3, and the bacteriostatic effect is obviously increased along with the increase of the concentration.

2.3 identification of the Strain

And (3) morphological identification result: the colonies are milky white on an LB culture medium, the surface is smooth in the initial stage, the mucus is not easy to pick up, and the edges are irregular. The surface of the later colony is a film.

Physiological characteristic results: gram positive (+), bacilliform, sporulated, alkaline anaerobic. Catalase positive, citrate test positive.

Through molecular biological identification, the sequencing result of the Gyrb fragment is shown in SEQ ID NO. 1. The homology with Bacillus velezensis (MT300194.1) is highest and the similarity is 100 percent when searched in NCBI database. A Gyrb fragment phylogenetic tree was constructed using MEGA7.0 phylogenetic tree, as shown in FIG. 4, YH03 and Bacillus velezensis (DQ903176) were grouped into one. Identification of YH03 as Bacillus beleisi in combination with morphological and physiological characteristics. The strain is preserved in China center for type culture at 27.1.2021, with the preservation number being CCTCC NO: m2021164.

Sequencing sequence of the Gyrb fragment:

GTGTAGGGGCATCCGTCGTAAACGCCTTGTCGACCACTCTTGACGTTACGGTTCATCGTGACGGAAAAATCCATTATCAGGCGTACGAGCGCGGTGTACCTGTGGCCGATCTTGAAGTGATCGGCGAAACTGATAAGACCGGAACGATTACGCACTTCGTTCCGGACCCGGAAATTTTCAAAGAAACAACTGTATATGACTATGATCTGCTTTCAAACCGTGTCCGGGAATTGGCCTTCCTGACAAAAGGCGTAAACATCACGATTGAAGACAAACGTGAAGGACAAGAACGGAAAAACGAGTACCACTACGAAGGCGGAATCAAAAGCTATGTTGAGTACTTAAACCGTTCCAAAGAAGTCGTTCATGAAGAGCCGATTTATATCGAAGGCGAGAAAGACGGCATAACGGTTGAAGTTGCATTGCAATACAACGACAGCTATACAAGCAATATTTATTCTTTCACAAATAATATCAACACATACGAAGGCGGCACGCACGAGGCCGGATTTAAAACCGGTCTGACCCGTGTCATAAACGACTATGCAAGAAGAAAAGGGATTTTCAAAGAAAATGATCCGAATTTAAGCGGGGATGATGTGAGAGAAGGGCTGACTGCCATTATTTCAATTAAGCACCCTGATCCGCAATTCGAAGGGCAGACGAAAACCAAGCTCGGCAACTCCGAAGCGAGAACGATCACTGATACGCTGTTTTCTTCTGCGCTGGAAACATTCCTTCTTGAAAATCCGGACTCAGCCCGCAAAATCGTTGAAAAAGGTTTAATGGCCGCAAGAGCGCGGATGGCGGCGAAAAAAGCCCGGGAATTGACCCGGCGCAAAAGTGCGCTTGAGATTTCCAATCTGCCGGGCAAACTGGCGGACTGTTCTTCTAAAGATCCGAGCATTTCCGAGCTGTATATCGTAGAGGGTGACTCTGCGGGCGGATCAGCGAAACAGGGACGGGACCGTCATTTCCAAGCCATTCTGCCGCTGCGCGGTAAGATTCTGAACGTTGAGAAAGCCAGACTTGATAAGATTCTCTCAAACAATGAGGTCAGATCAATGATCACGGCCCTCGGAACAGGAATCGGAGAAGATTTT(SEQ ID NO.1)

2.4 preparation of fungal powder

Freeze drying the bacteria liquid to obtain bacteria powder, packing in aseptic bag to prevent moisture absorption, and storing at-20 deg.c for long period. The bacterial powder is shown in figure 5.

2.5 influence of Bacillus fermentation on the content of vomitoxin in wheat bran

As can be seen from FIG. 6, the vomitoxin of wheat bran is significantly reduced by bacillus fermentation, the vomitoxin is significantly different from the wheat bran vomitoxin which is not fermented in 8-168 hours (P is less than 0.05), the vomitoxin is reduced by 8.5 times in 8 hours compared with the original wheat bran, the vomitoxin is not significantly different in 24-72 hours, the vomitoxin slightly rises after 96 hours, and possibly organic matters are greatly consumed, so that the proportion of the wheat bran vomitoxin per unit mass is larger, but is still lower than the vomitoxin before wheat bran fermentation.

2.6 Effect of Bacillus fermentation on wheat bran soluble pentosan and Total pentosan content

Pentosans are non-starch polysaccharides, which are classified into soluble pentosans and insoluble pentosans, which constitute the total pentosans. Pentosan is widely present in wheat, but is present in small amounts and is the main constituent of the outer thin wall of the aleurone layer cells. As can be seen from FIG. 7, the soluble pentosan and the total pentosan have significant difference compared with the unfermented wheat bran within 8-168 hours, the total pentosan and the soluble non-glycan have no significant difference (P <0.05) within 24-96 hours of fermentation time, after the wheat bran is subjected to solid state fermentation by the bacillus, the total pentosan reaches the maximum value of 35.76g/100g within 168 hours, the maximum value of 6.53g/100g within 48 hours of the soluble pentosan, and the content of the soluble pentosan and the total pentosan is significantly increased, which indicates that the transformation of the insoluble pentosan into the soluble pentosan can be promoted by the fermentation of the bacillus, possibly due to the interaction between the endogenous xylanase in the wheat bran and the metabolite of the bacillus.

2.7 influence of Bacillus fermentation on the Total phenols content of wheat bran

As can be seen from fig. 8, after the wheat bran is subjected to solid state fermentation by the bacillus, there is no significant difference between 8h and unfermented wheat bran, the fermentation time is too short, the bound polyphenol is not sufficiently released, the total phenol content is significantly increased after 24h of fermentation, there is no significant difference between the total phenol content of 24h, 48h and 168h of fermentation (P <0.05), after the bacillus is added into the wheat bran, the total phenol content is first increased, and reaches a maximum value of 3.618mg/g after 72h of fermentation, which is 2.34 times of the raw material, and then the content is decreased, but during 168h of fermentation, the total phenol content in the wheat bran is higher than the unfermented total phenol content, which may be that the enzyme system generated by the bacillus-fermented wheat bran destroys the structure of the bound polyphenol. After 96h the total phenol content decreased, probably because the bacillus released the substance and was partly consumed.

2.8 Effect of Bacillus fermentation on wheat bran antioxidant Properties

According to the graph of fig. 9, the wheat bran fermented for 8 hours has no significant difference with the wheat bran not fermented, the fermentation time is too short, the release amount of antioxidant components is very small, the DPPH free radical scavenging rate is obviously increased (P is less than 0.05) after 24 hours of fermentation, the change trend of DPPH free radical scavenging capacity is similar to the change condition of the total phenol content, the DPPH free radical scavenging rate is increased and then decreased, the maximum 59.5% is reached when the bacillus is fermented for 72 hours, and the DPPH free radical scavenging rate is increased by 1.7 times compared with that before the fermentation. It can be concluded that the oxidation resistance is closely related to the total phenol content.

2.9 Effect of Bacillus fermentation on wheat bran proteins

As can be seen in FIG. 10, the solid-fermented bran protein was reduced and then increased compared to unfermented bran, but the increase was small. The wheat bran protein content is the lowest after the wheat bran is fermented for 8 hours, the wheat bran protein content is obviously different from that of unfermented wheat bran (P is less than 0.05), the reason is probably that protease generated by bacillus hydrolyzes protein in the wheat bran, so the wheat bran protein content is slightly reduced after 8 hours, the bacillus which is inoculated into the wheat bran carries the protein, the number of the bacillus is increased along with the prolonging of the fermentation time, the protein content is also increased, the bacillus in the wheat bran is killed and decomposed under the condition of high-temperature drying of the wheat bran, the protein content in the wheat bran is increased, and the protein content in the wheat bran is firstly reduced and then increased.

2.10 Effect of Bacillus fermentation on wheat bran Water and oil Retention

This experiment measured the effect of bacillus-fermented wheat bran on its water uptake index (WAI), as shown in fig. 11. The WAI of the wheat bran fermented by the bacillus is in an ascending trend along with the prolonging of the fermentation time, and compared with the wheat bran which is not fermented and is fermented for 72h and 168h, the wheat bran which is fermented for 72h and 168h is obviously different from the wheat bran which is not fermented (P)<0.05), the WAI is highest after 7 days of fermentation, and is increased by 11.11 percent compared with unfermented wheat bran. The reason may be that the wheat bran fiber is degraded in the fermentation process, so that the fiber structure becomes loose, the specific surface area is increased, and the water absorption index is increased. Meanwhile, during fermentation, the protein in the wheat bran undergoes hydrolysis reaction, and the spatial structure of the protein is destroyed, so that the hydrophobic interaction between molecules is weakened^[24]. In addition, during the fermentation process, soluble substances are increased, insoluble dietary fibers are converted into soluble dietary fibers, and the water solubility index of wheat bran can be increased due to the reasons.

As can be seen from FIG. 12, the bran oil retention property after fermentation with Bacillus was slightly increased after 72h fermentation, and was not significantly different from that of unfermented bran (P <0.05), and after 168h fermentation, the bran oil retention property was significantly decreased (P <0.05), probably because the bran oil retention property was relatively high when the bran particle size was 80 mesh. Secondly, the fiber structure of the fermented wheat bran is damaged to different degrees, and the mesh structure of the wheat bran is damaged to a certain extent, so that the retention of the fermented wheat bran on the grease is reduced. After the wheat bran is fermented again, part of dietary fibers are degraded, so that hydrophilic substances are easy to overflow, and the adsorption capacity of the wheat bran on grease is reduced.

In conclusion, the wheat bran is subjected to solid-state fermentation by using the Bacillus beleisi, and the toxin removal condition, the content change of the total pentosan and the water-soluble pentosan, the protein, the total phenol, the oxidation resistance, the oil retention property and the water retention property of the wheat bran are analyzed before and after the solid-state fermentation of the Bacillus. The main study results are as follows:

compared with unfermented wheat bran, the fermented wheat bran has the advantages that the total phenols, inoxidizability, soluble pentosan and total pentosan of the fermented wheat bran are obviously increased. The trend of the total phenols is increased firstly and then reduced, and the maximum value is 3.62mg/g which is 2.34 times of the raw materials when the fermentation is carried out for 72 hours. The oxidation resistance has the same change trend with total phenol, and the free radical clearance reaches the maximum 59.5 percent in 72 hours, which is 1.7 times of that of the raw material. The change trend of the soluble pentosan is similar to that of the total pentosan, the maximum value of the soluble pentosan is 6.53g/100g at 48h of fermentation, and the maximum value of the total pentosan is 35.76g/100g at 168 h. Since the protein content is slightly increased after fermentation and may be the cell protein itself, the present invention considers that the bran protein after fermentation is almost unchanged. The water retention of the fermented wheat bran tends to increase, and the oil retention of the fermented wheat bran tends to decrease. The bacillus has good detoxification capability, the content of vomitoxin in the whole fermentation process is very low, and the vomitoxin is reduced to the minimum in 8h, the vomitoxin value is 2.85 muk/kg, and is reduced by 8.5 times compared with unfermented wheat bran.

It should be noted that the above-mentioned embodiments are only preferred embodiments of the present invention, and the present invention is not limited thereto, and although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that modifications and equivalents can be made in the technical solutions described in the foregoing embodiments, or equivalents thereof. Any modification, equivalent replacement, or improvement made within the spirit and principle of the present invention should be included in the protection scope of the present invention. Although the present invention has been described with reference to the specific embodiments, it should be understood by those skilled in the art that various changes and modifications may be made without departing from the spirit and scope of the invention.

SEQUENCE LISTING

<110> institute of agricultural sciences of Shandong province

<120> bacillus beilesensis capable of modifying wheat bran and application thereof

<130>

<160> 3

<170> PatentIn version 3.3

<210> 1

<211> 1103

<212> DNA

<213> Bacillus belgii (Bacillus Velezensis)

<400> 1

gtgtaggggc atccgtcgta aacgccttgt cgaccactct tgacgttacg gttcatcgtg 60

acggaaaaat ccattatcag gcgtacgagc gcggtgtacc tgtggccgat cttgaagtga 120

tcggcgaaac tgataagacc ggaacgatta cgcacttcgt tccggacccg gaaattttca 180

aagaaacaac tgtatatgac tatgatctgc tttcaaaccg tgtccgggaa ttggccttcc 240

tgacaaaagg cgtaaacatc acgattgaag acaaacgtga aggacaagaa cggaaaaacg 300

agtaccacta cgaaggcgga atcaaaagct atgttgagta cttaaaccgt tccaaagaag 360

tcgttcatga agagccgatt tatatcgaag gcgagaaaga cggcataacg gttgaagttg 420

cattgcaata caacgacagc tatacaagca atatttattc tttcacaaat aatatcaaca 480

catacgaagg cggcacgcac gaggccggat ttaaaaccgg tctgacccgt gtcataaacg 540

actatgcaag aagaaaaggg attttcaaag aaaatgatcc gaatttaagc ggggatgatg 600

tgagagaagg gctgactgcc attatttcaa ttaagcaccc tgatccgcaa ttcgaagggc 660

agacgaaaac caagctcggc aactccgaag cgagaacgat cactgatacg ctgttttctt 720

ctgcgctgga aacattcctt cttgaaaatc cggactcagc ccgcaaaatc gttgaaaaag 780

gtttaatggc cgcaagagcg cggatggcgg cgaaaaaagc ccgggaattg acccggcgca 840

aaagtgcgct tgagatttcc aatctgccgg gcaaactggc ggactgttct tctaaagatc 900

cgagcatttc cgagctgtat atcgtagagg gtgactctgc gggcggatca gcgaaacagg 960

gacgggaccg tcatttccaa gccattctgc cgctgcgcgg taagattctg aacgttgaga 1020

aagccagact tgataagatt ctctcaaaca atgaggtcag atcaatgatc acggccctcg 1080

gaacaggaat cggagaagat ttt 1103

<210> 2

<211> 23

<212> DNA

<213> Artificial sequence

<400> 2

gaagtcatca tgaccgttct gca 23

<210> 3

<211> 23

<212> DNA

<213> Artificial sequence

<400> 3

agcagggtac ggatgtgcga gcc 23

Claims

1. A Bacillus belgii (Bacillus Velezensis) YH03 strain is preserved in China center for type culture Collection at 1 month and 27 days 2021, with the preservation number being CCTCC NO: m2021164.

2. The method for culturing Bacillus belgii YH03 as claimed in claim 1, wherein the method comprises inoculating the Bacillus belgii YH03 into a fermentation medium for fermentation culture;

preferably, the fermentation medium is LB liquid medium.

3. A microbial agent comprising Bacillus belgii YH03 or a fermentation product thereof or a metabolite thereof according to claim 1.

4. The microbial inoculant according to claim 3, wherein the inoculant is a solid, preferably a lyophilized powder.

5. The microbial inoculant of claim 3, further comprising a carrier; preferably, the carrier is one that is commonly used in the art of microbial preparation and is biologically inert.

6. Use of bacillus beilesensis YH03 according to claim 1 and/or a microbial agent according to any one of claims 3-5 in whole or in part in 1) -3) as follows:

2) the application in inhibiting diseases and/or preparing disease inhibitors;

3) the application in solid fermentation and/or preparation of solid leaven.

7. The use according to claim 6, wherein in use 1) the pathogenic bacteria comprise Fusarium graminearum;

in the application 2), the disease is a plant disease caused by fusarium graminearum; preferably, the plant disease is wheat scab;

in the application 3), the solid-state fermentation is wheat bran solid-state fermentation.

8. A wheat bran solid state fermentation method is characterized by comprising the following steps: adding the Bacillus belgii YH03 of claim 1 and/or the microbial agent of any one of claims 3 to 5 to wheat bran.

9. The method of claim 8, wherein the method comprises: adding the Bacillus beilesensis YH03 and/or the microbial agent according to the proportion of 0.1-10% (preferably 1%) of the wheat bran, then adding water according to the material ratio of 1-5: 1 (preferably 2:1), stirring and mixing uniformly, and carrying out fermentation treatment after sealing.

10. The method according to claim 9, wherein the fermentation temperature is controlled to be 25 to 35 ℃ (preferably 37 ℃), and the solid state fermentation time is controlled to be 8 hours or more, preferably 8 to 168 hours.