CN113994003A - Novel promoter and use thereof - Google Patents

Abstract

Provided are a novel promoter and a method for producing a target material using the same. More specifically, provided are novel polynucleotides having promoter activity, gene expression cassettes and host cells each comprising the polynucleotides, and a method for producing a target material using a microorganism.

Description

Novel promoter and use thereof

Technical Field

The present disclosure relates to a novel promoter and a method for producing a target material using the same. More specifically, the present disclosure relates to novel polynucleotides having promoter activity, vectors and host cells each comprising the polynucleotides, and methods for producing target materials using microorganisms.

Background

L-amino acids are basic structural units of proteins and are used as important raw materials for pharmaceutical raw materials, food additives, animal feeds, nutraceuticals, agricultural chemicals, bactericides and the like. Among L-amino acids, L-lysine is an essential amino acid, does not undergo biosynthesis in vivo, and is known to be essential for promoting growth, calcium metabolism, promoting gastric secretion, and resisting diseases. L-lysine is widely used in feeds, pharmaceuticals, foods and the like. L-tryptophan is also one of essential amino acids for human body, and can be used as feed additive, infusion solution, medicinal material, health food material, etc.

Common methods for producing Amino acids mainly include Fermentation methods using microorganisms such as Brevibacterium or Corynebacterium (Amino Acid Fermentation, Gakkai Shuppan Center: 195-215, 1986), and industrial methods by synthesis such as the monochloroacetate method, Strecker method, etc., in addition to Escherichia coli, Bacillus, Streptomyces, Penicillium, Klebsiella, Erwinia, Pantoea, etc. (U.S. Pat. Nos. 3,220,929 and 6,682,912).

In addition, many studies on the efficient production of amino acids have been conducted, for example, efforts to develop microorganisms or fermentation techniques having high amino acid production efficiency. Specifically, a target material-specific method has been developed to increase the expression of genes encoding enzymes involved in amino acid biosynthesis or to remove genes unnecessary in amino acid biosynthesis in Corynebacterium strains (Korean patent Nos. 10-0924065 and 1208480). In addition to these methods, a method of deleting a gene not involved in amino acid production and a method of deleting a gene whose specific function in amino acid production is unknown are also used. However, there is still a need to develop a method capable of producing an L-amino acid with high efficiency at high yield.

In view of this technical background, the present inventors have developed a novel polynucleotide having promoter activity, which is capable of producing a target material in a microorganism of corynebacterium genus with high yield, and they have found that the productivity of the target material can be improved when the polynucleotide is introduced into the microorganism, thereby completing the present disclosure.

The present inventors have made extensive efforts to produce novel polynucleotides having promoter activity, and as a result, have found that when a target gene promoter is modified by base substitution, the modified promoter can regulate the expression of a gene to which it is operably linked, thereby completing the present disclosure.

Disclosure of Invention

It is an object of the present invention to provide a polynucleotide having promoter activity, wherein SEQ ID NO:1 by a G substitution at position 268 of the nucleotide sequence set forth in fig.

It is another object of the present disclosure to provide a gene expression cassette comprising the polynucleotide and a target gene.

It is a further object of the present disclosure to provide a host cell comprising said polynucleotide or said gene expression cassette.

It is a further object of the present disclosure to provide a method of producing a target material, the method comprising culturing the host cell in a culture medium; and recovering the target material from the culture medium.

It is a further object of the present invention to provide the use of a polynucleotide as a promoter, wherein SEQ ID NO:1 by another nucleotide at position 268.

Detailed Description

The present disclosure will be described in detail below. Meanwhile, each description and embodiment disclosed in the present disclosure may also be applied to other descriptions and embodiments. That is, all combinations of the various elements disclosed in this disclosure are within the scope of this disclosure. Furthermore, the scope of the present disclosure is not limited by the specific description set forth below.

Further, those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the disclosure described herein. Further, such equivalents are to be construed as falling within the scope of the present disclosure.

To achieve the above objects, one aspect of the present invention provides a polynucleotide having promoter activity, wherein SEQ ID NO:1 by a G substitution at position 268 of the nucleotide sequence set forth in fig.

As used herein, the term "SEQ ID NO:1 "may refer to a part of the promoter sequence of NCgl1416 gene.

In this regard, the term "NCgl 1416 gene" refers to a gene inherently present in a microorganism of the genus Corynebacterium or a gene encoding a hypothetical protein of unknown function.

Corresponding to SEQ ID NO:1 may be derived from Corynebacterium (Corynebacterium sp), in particular from Corynebacterium glutamicum. However, a sequence having activity equal to or greater than that of the polynucleotide may be included in the promoter of the present disclosure without limitation.

As used herein, the term "polynucleotide" refers to a polymer of nucleotides in which nucleotide monomers are covalently bonded into a long chain, referring to a DNA strand of a predetermined length or longer.

As used herein, the term "promoter" refers to an untranslated nucleotide sequence upstream of a coding region that includes a binding site for a polymerase and that has the activity of initiating transcription of a promoter target gene into mRNA, i.e., a DNA domain that binds to the polymerase to initiate transcription of the gene. The promoter may be located in the 5' domain of the mRNA transcription initiation domain.

As used herein, the term "polynucleotide having promoter activity" refers to a DNA region comprising a binding site for RNA polymerase or enhancer, etc., for expressing a gene operably linked downstream thereof, i.e., a target gene, and present near the transcription site of the gene of interest. For the purposes of the present invention, the polynucleotide can serve as a universal promoter, which can regulate (e.g., increase or decrease) the expression of a target gene to which it is operably linked and the production and/or activity of a protein encoded by the target gene, as compared to a promoter or endogenous promoter existing in the cell, and which can regulate (e.g., increase or decrease) the production and/or activity of a product of interest (a biologically active material, e.g., one or more selected from the group consisting of amino acids, nucleic acids, vitamins, proteins, fatty acids, organic acids, and the like) involved in the production of the protein, but is not limited thereto.

The polynucleotide of the present disclosure may include any polynucleotide sequence without limitation so long as it has promoter activity.

In one embodiment, the polynucleotide having promoter activity of the present invention may include a polynucleotide having promoter activity, in which SEQ ID NO:1 by another nucleotide. Specifically, the polynucleotide may consist of a polynucleotide having promoter activity, wherein SEQ ID NO:1 by substitution of one or more nucleotides with another. Polynucleotides having promoter activity may be used interchangeably with "variant promoters" in the present disclosure, and all of the above terms may be used in the present disclosure.

For example, the polynucleotide having promoter activity may be a polynucleotide in which a nucleotide at a specific position of a polynucleotide sequence having existing promoter activity is substituted, thereby decreasing or increasing promoter activity.

In one embodiment, the variant promoter may be a promoter wherein SEQ ID NO:1 by substitution of the nucleotide at position 268 with another nucleotide.

There is no limitation on the "other nucleotide" as long as it is a nucleotide different from the nucleotide before the substitution. For example, when "SEQ ID NO:1 by another nucleotide "means that the nucleotide is substituted with thymine (T), cytosine (C) or guanine (G) other than adenine (a). Furthermore, unless otherwise specified, when a nucleotide is described as "substituted" in the present disclosure, it means that the nucleotide is substituted with a nucleotide different from the nucleotide before the substitution.

Also, one skilled in the art can identify sequences in any polynucleotide sequence that are identical to SEQ ID NOs: 1 at a position corresponding to position 268. Unless otherwise indicated in this disclosure, when a "nucleotide at a particular position of a particular SEQ ID NO" is described, it is clear that the nucleotide also includes "nucleotide at the corresponding position" in any polynucleotide sequence. Thus, wherein is selected from the group consisting of SEQ ID NO:1 by substitution of any one or more nucleotides of the group consisting of the nucleotide at a position corresponding to position 268 of the polynucleotide sequence of 1 with another nucleotide of any polynucleotide sequence having promoter activity is also included within the scope of the present disclosure.

The polynucleotide of the present disclosure may be wherein SEQ ID NO:1, namely the promoter sequence of the NCgl1416 gene. Specifically, the alteration may be a substitution of the nucleotide at position 268 of the sequence with another nucleotide. Specifically, it may be SEQ ID NO:1 by a G substitution at position 268.

A polynucleotide may have altered (increased or decreased) promoter activity compared to a polynucleotide that has not been altered. Thus, the expression of a target gene operably linked to the polynucleotide and the activity of a protein encoded by the target gene can be modulated (increased or decreased), and further, the expression of a gene other than the target gene can be modulated.

For example, when SEQ ID NO:1 by another nucleotide, a promoter having weaker or stronger activity than the unsubstituted (unaltered) promoter sequence may be provided.

Furthermore, the polynucleotide may be a polynucleotide involved in increasing the yield or production of a material of interest, particularly an L-amino acid, more particularly L-lysine.

The present inventors studied for the first time the effect of increasing the production of L-amino acids, more particularly L-lysine, by changing the promoter of NCgl1416 gene.

As used herein, "L-lysine" as one of basic α -amino acids is an essential amino acid that is not synthesized in vivo. L-lysine can be used in, but not limited to, various products such as feeds or feed additives, or foods, food additives, pharmaceutical products, etc.

In one embodiment, the polynucleotide having promoter activity of the present invention may comprise SEQ ID NO: 2. In particular, the polynucleotide may consist essentially of or may consist of SEQ ID NO: 2, but is not limited thereto.

In addition, without being limited to the above embodiments, various changes may be included in the polynucleotide sequence within a range where the promoter activity is not significantly reduced. For example, the nucleotide sequences of the present disclosure can be altered by known mutagenesis methods, e.g., directed evolution, site-directed mutagenesis, and the like.

In this regard, the term "alteration" refers to a genetically or non-genetically stable phenotypic change, and in the present disclosure, it may be used interchangeably with "modification" or "mutation".

Thus, in the present invention, the polynucleotide having promoter activity may be SEQ ID NO:1 or SEQ ID NO: 2, or a polynucleotide sequence identical to SEQ ID NO:1 or SEQ ID NO: 2, or a polynucleotide sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% or more homology or identity. Nucleotide sequences having homology or identity may be sequences having less than 100% identity in the above categories, except for sequences having 100% identity.

Meanwhile, although described in the present disclosure as "a polynucleotide having a nucleotide sequence represented by a specific SEQ ID NO" or "a polynucleotide comprising a nucleotide sequence represented by a specific SEQ ID NO", it is apparent that a sequence having a deletion, modification, substitution or addition of a partial sequence of a polynucleotide having a nucleotide sequence may also be used in the present disclosure as long as it has an activity identical to or corresponding to that of a polynucleotide consisting of a nucleotide sequence of a corresponding SEQ ID NO.

For example, a polynucleotide in which a meaningless sequence is added to or deleted from the inside or end of the nucleotide sequence of the corresponding SEQ ID NO is obviously also included in the scope of the present disclosure as long as it has the same or corresponding activity as the polynucleotide.

Homology or identity refers to the degree of match between two given nucleotide sequences and can be expressed as a percentage.

The terms "homology" and "identity" are often used interchangeably.

Sequence homology or identity for conserved polynucleotides can be determined using standard alignment algorithms and can be used with default gap penalties established by the program used. Substantially homologous or identical sequences may hybridize along the full length of the sequence or at least about 50%, about 60%, about 70%, about 80%, or about 90% of the full length under moderate or high stringency. Also contemplated are polynucleotides that comprise degenerate codons rather than codons in a hybrid polynucleotide.

Whether any two polynucleotide sequences have homology, similarity or identity can be determined using known computer algorithms, for example the "FASTA" program using default parameters, for example as described by Pearson et al, (1988) proc.natl.acad.sci.usa 85: 2444. Alternatively, homology, similarity or identity may be determined using The Needleman-Wunsch algorithm (Needleman and Wunsch,1970, J.Mol.biol.48:443-453), including The GCG package (Devereux, J.et al, Nucleic Acids Research 12:387(1984)), BLASTP, BLASTN, FASTA (Atul, SF, et al, J.MOLEC BIOL 215:403(1990), Guide to Computers, Huning J.Shustic, edition, Cluster, Sanego, et al, see (German) company, Inc., USA, SALEW, USA, SALAM, SAL.S.S.S..

The homology, similarity or identity of polynucleotides can be determined by comparing sequence information using the GAP computer program, for example, Needleman et al, (1970), J Mol biol.48:443, as disclosed by Smith and Waterman, adv.Appl.Math (1981)2: 482. In summary, the GAP program is defined as the value obtained by dividing the number of similarly aligned symbols (i.e., nucleotides or amino acids) by the total number of symbols in the shorter of the two sequences. Default parameters for the GAP program may include: (1) binary comparison matrices (including 1 for identity And 0 for non-identity) And Gribskov et al, (1986) weighted comparison matrices Of Nucl. acids Res.14:6745, as edited by Schwartz And Dayhoff, Atlas Of Protein Sequence And Structure, national biomedical research Foundation, p. 353-358 (1979) (or, substitution matrices for EDNAFULL (EMBOSS version Of NCBI NUC 4.4)); (2) a 3.0 penalty per gap, with 0.10 penalty per symbol in each gap (alternatively, a gap open penalty of 10, a gap extension penalty of 0.5); and (3) no penalty is imposed on terminal gaps. Thus, the terms "homology" or "identity" as used in this disclosure denote the correlation between sequences.

In addition, probes that can be prepared from known gene sequences, such as polynucleotide sequences having the same activity and hybridizing to all or part of the above-described polynucleotide sequences under stringent conditions, may be included without limitation. "stringent conditions" refers to conditions that allow specific hybridization between polynucleotides. These conditions are specifically disclosed in the literature (e.g., J.Sambrook et al, Molecular Cloning, A Laboratory Manual, second edition, Cold Spring Harbor Laboratory press, Cold Spring Harbor, New York, 1989; F.M.Ausubel et al, Current Protocols in Molecular Biology, John Wiley & Sons, Inc., New York). For example, stringent conditions may include the following conditions: genes having high homology or identity, genes having homology or identity of 40% or more, particularly 70% or more, 80% or more, 85% or more, or 90% or more, more particularly 95% or more, more particularly 97% or more, and particularly 99% or more, hybridize with each other, while genes having homology or identity lower than the above hybridize with each other; or may include the usual washing conditions for Southern hybridization, i.e., washing 1 time, particularly 2-3 times, with salt concentrations and temperatures corresponding to 60 ℃,1 XSSC, 0.1% SDS, particularly 60 ℃, 0.1 XSSC and 0.1% SDS, and more particularly 68 ℃, 0.1 XSSC and 0.1% SDS.

Hybridization requires that the two nucleic acids have complementary sequences, although depending on the stringency of the hybridization, mismatches between nucleotides are possible. The term "complementary" is used to describe the relationship between nucleotides that can hybridize to each other. For example, for DNA, adenine is complementary to thymine and cytosine is complementary to guanine. Thus, the disclosure may also include isolated nucleic acid fragments that are complementary to the entire sequence as well as nucleic acid sequences substantially similar thereto.

Specifically, polynucleotides having homology or identity can be detected using hybridization conditions including a hybridization step under the above conditions at a Tm value of 55 ℃. Further, the Tm value may be 60 ℃, 63 ℃ or 65 ℃, but is not limited thereto, and can be appropriately controlled by those skilled in the art according to the purpose thereof.

The stringency suitable for hybridization of polynucleotides depends on the length and complementarity of the polynucleotides, and the variables are well known in the art (see Sambrook et al, supra, 9.50-9.51, 11.7-11.8).

Polynucleotides having promoter activity of the present disclosure can be isolated or prepared using standard molecular biology techniques. For example, polynucleotides can be prepared using standard synthetic techniques using an automated DNA synthesizer, but the preparation method is not limited thereto.

The polynucleotides having promoter activity of the present disclosure may be used as a promoter.

The promoter may be located in the 5' -region of the mRNA transcription start site.

The promoter may have increased or decreased promoter activity compared to existing promoters. In other words, the promoter may increase or decrease the expression and/or activity of the protein encoded by the target gene and the expression of the target gene in the host cell. For the purpose of the present invention, the target gene whose expression is enhanced or attenuated may vary depending on the product produced, and the promoter may be used as a general promoter for enhancing or attenuating the target gene.

Another aspect of the disclosure provides a gene expression cassette comprising a polynucleotide and a target gene.

The polynucleotides of the present disclosure are the same as described above.

As used herein, the term "gene expression cassette" refers to a unit cassette that comprises a promoter and a target gene and is capable of expressing the target gene operably linked downstream of the promoter. Various factors capable of facilitating efficient expression of the target gene may be included inside or outside the gene expression cassette. Generally, a gene expression cassette may include, but is not limited to, a transcription termination signal, a ribosome binding domain, and a translation termination signal in addition to a promoter operably linked to a target gene.

For the purposes of this disclosure, a "target gene" refers to a gene whose expression is regulated by a promoter sequence of the present disclosure. The protein encoded by the target gene may be expressed as a "target protein", and the gene encoding the "target protein" may be expressed as a "target gene".

In addition, polynucleotides encoding target proteins have various modifications in the coding region insofar as they do not alter the polypeptide sequence, due to codon degeneracy or in view of codons preferred by the organism for expression of the polynucleotide. The description of the polynucleotide sequences is the same as above.

In particular, the expression "consists of SEQ ID NO: 2 "means that, when a restriction enzyme is used, addition, deletion and/or alteration of a nucleotide is/are not excluded, which may occur in a process of linking to a target gene when the corresponding polynucleotide acts as a promoter by linking to the target gene.

Furthermore, the polypeptide represented by SEQ ID NO: the polynucleotide having promoter activity consisting of the nucleotide sequence represented by 2 may include any nucleotide sequence without limitation so long as it is a nucleotide sequence that hybridizes to the complement of all or part of the sequence. SEQ ID NO: 2 has the promoter activity of the present disclosure under stringent conditions.

Yet another aspect of the present disclosure provides a recombinant vector comprising a polynucleotide, or a gene expression cassette comprising a polynucleotide and a target gene.

The polynucleotides, target genes and gene expression cassettes of the present disclosure are the same as described above.

As used herein, the term "vector" refers to an artificial DNA molecule having genetic material capable of expressing a target gene in a suitable host, and particularly to a DNA construct comprising a nucleotide sequence of a gene encoding a target protein operably linked thereto.

As used herein, the term "operably linked" refers to a functional linkage of a polynucleotide having promoter activity of the present disclosure to a gene sequence to initiate and mediate transcription of a target gene. Operable linkage can be achieved using genetic recombination techniques known in the art, and site-specific DNA cleavage and linkage can be performed using restriction enzymes and ligases known in the art, but is not limited thereto.

The vector used in the present disclosure is not particularly limited as long as it can be expressed in a host cell, and the host cell can be transformed with any vector known in the art. Examples of commonly used vectors may include natural or recombinant plasmids, cosmids, viruses, and phages.

For example, as phage vectors or cosmid vectors, pWE15, M13, MBL3, MBL4, xii, ASHII, APII, t10, t11, Charon4A, Charon21A, and the like; as the plasmid vector, those based on pDZ, pBR, pUC, pBluescriptII, pGEM, pTZ, pCL, pET, etc. can be used, but are not limited thereto. Specifically, pDZ, pDC, pDCM2, pACYC177, pACYC184, pCL, pECCG117, pUC19, pBR322, pMW118, pCC1BAC vectors and the like can be used, but the vectors are not limited thereto. Furthermore, insertion of the polynucleotide into the chromosome may be achieved by any method known in the art, such as homologous recombination.

Since the vector of the present disclosure can be inserted into a chromosome by inducing homologous recombination, a selection marker may be additionally included to confirm successful insertion of the gene into the chromosome. The selectable marker is used to screen the vector-transformed cells, i.e., to determine whether the polynucleotide is inserted. Markers providing a selectable phenotype, such as drug resistance, auxotrophy, resistance to toxic agents or expression of surface proteins, may be used. In the environment treated with the selection agent, only cells expressing the selection marker are able to survive or exhibit a different phenotype, and thus transformed cells can be selected.

As used herein, the term "transformation" refers to the introduction of a vector comprising a polynucleotide encoding a target protein into a host cell to allow expression of the protein encoded by the polynucleotide in the host cell. In addition, it does not matter whether the transformed polynucleotide is located on the chromosome of the host cell or extrachromosomally, so long as the transformed polynucleotide can be expressed in the host cell, and both cases are included. In addition, polynucleotides include DNA and RNA encoding proteins of interest. The polynucleotide may be introduced in any form as long as it can be introduced into and expressed in a host cell. For example, the polynucleotide may be introduced into the host cell in the form of an expression cassette, which is a genetic construct including all elements necessary for self-expression, or in the form of a vector containing the same.

Transformation methods include any method of introducing a gene encoding a protein of interest into a cell, and may be performed according to appropriate standard techniques known in the art for host cell selection. For example, transformation methods may include electroporation, calcium phosphate (CaPO)₄) Precipitate, calcium chloride (CaCl)₂) Precipitation, microinjection, polyethylene glycol (PEG) technology, DEAE-dextran technology, cationic liposome technology, lithium acetate-DMSO technology, etc., but the method is not limited thereto.

Yet another aspect of the disclosure provides a host cell comprising a polynucleotide or gene expression cassette.

Specifically, the host cell may be a microorganism of the genus Corynebacterium, but is not limited thereto.

The polynucleotide and gene expression cassette are the same as described above.

As used herein, the term "microorganism" includes all wild-type microorganisms and naturally or artificially genetically modified microorganisms, and it is a concept including microorganisms having a specific attenuation or enhancement mechanism due to insertion of an exogenous gene or enhancement or attenuation of activity of an endogenous gene. In the present disclosure, the microorganism may include any microorganism without limitation so long as it is introduced with or includes the polynucleotide of the present disclosure.

In the present disclosure, a microorganism may include a polynucleotide, particularly a polynucleotide and/or a vector including a polynucleotide, more particularly a vector including a gene encoding a target protein, but is not limited thereto. In addition, the polynucleotide and the vector may be introduced into the microorganism by transformation, but are not limited thereto.

The microorganism is a cell or microorganism transformed with a vector comprising a polynucleotide of the present invention and a gene encoding a target protein to express the target protein, and for the purpose of the present invention, the host cell or microorganism may be any microorganism as long as it can produce a target product including the target protein.

As used herein, the term "microorganism producing a target protein or a target product" includes all wild-type microorganisms and naturally or artificially genetically modified microorganisms, and it refers to microorganisms having a specific attenuation or enhancement mechanism due to insertion of an exogenous gene or activity enhancement or inactivation of an endogenous gene. The microorganism may be a microorganism comprising a genetic modification for producing a protein or product of interest.

For the purpose of the present disclosure, a microorganism producing a target protein or a target product may be a microorganism in which the productivity of the target protein or the target product is increased by containing a polynucleotide of the present disclosure. Specifically, in the present disclosure, a microorganism producing a target protein or a target product, or a microorganism having productivity of a target protein or a target product may be a microorganism in which some genes in a biosynthetic pathway of a target protein or a target product are enhanced or attenuated, or some genes in a degradation pathway of a target protein or a target product are enhanced or attenuated.

For the purpose of the present disclosure, a microorganism comprising a polynucleotide may have an increased production of L-amino acids, particularly L-lysine.

In the present invention, the microorganism may include any microorganism as long as it is a microorganism into which a polynucleotide having the promoter activity of the present invention is introduced and which can function as a promoter.

The microorganism may specifically be a microorganism of the genus Corynebacterium, more specifically Corynebacterium glutamicum or Corynebacterium flavum, and most specifically Corynebacterium glutamicum, but is not limited thereto.

Another aspect of the present disclosure provides a method of producing a target material, the method comprising culturing a host cell in a culture medium; and recovering the target material from the medium.

The host cell is the same as described above.

In the present disclosure, the target material may be an amino acid. Specifically, unless otherwise specified, the amino acid may be an L-type amino acid, and may be selected from the group consisting of glycine, alanine, valine, leucine, isoleucine, threonine, serine, cysteine, glutamine, methionine, aspartic acid, asparagine, glutamic acid, lysine, arginine, histidine, phenylalanine, tyrosine, tryptophan, proline, and combinations thereof, but is not limited thereto.

More specifically, the amino acid may be L-lysine, but is not limited thereto.

As used herein, the term "culturing" refers to culturing a microorganism under suitable and artificially controlled environmental conditions. In the present disclosure, a method for producing a target material using a polynucleotide-containing microorganism can be performed by using a method well known in the art. Specifically, the culture may be continuously performed in a batch, fed-batch or repeated fed-batch process, but is not limited thereto. The medium used in the culture must properly meet the requirements of the particular strain. A culture medium for microorganisms of the genus Corynebacterium is disclosed (e.g., Manual of Methods for General Bacteriology by the American Society for Bacteriology, Washington D.C., USA, 1981).

As the carbon source to be used in the medium, sugars and carbohydrates such as glucose, sucrose, lactose, fructose, maltose, starch and cellulose; oils and fats such as soybean oil, sunflower oil, castor oil, coconut oil, etc.; fatty acids such as palmitic acid, stearic acid and linoleic acid; alcohols such as glycerol and ethanol; and organic acids such as acetic acid. These materials may be used alone or in combination, but are not limited thereto.

As the nitrogen source to be used, peptone, yeast extract, beef extract, malt extract, corn steep liquor, soybean meal and urea, or inorganic compounds such as ammonium sulfate, ammonium chloride, ammonium phosphate, ammonium carbonate and ammonium nitrate may be included. The nitrogen sources may also be used alone or in admixture, but are not limited thereto.

As phosphorus source to be used, potassium dihydrogen phosphate or dipotassium hydrogen phosphate or the corresponding sodium-containing salts can be used. In addition, the culture medium may contain metal salts necessary for growth, such as magnesium sulfate or iron sulfate. Finally, materials essential for growth, such as amino acids and vitamins, may be used in addition to the above materials. In addition, suitable precursors can be used in the culture medium. The above-mentioned raw materials may be sufficiently added to the culture in a batch or continuous manner during the culture.

During the culture of the microorganism, the pH of the culture may be appropriately adjusted using a basic compound such as sodium hydroxide, potassium hydroxide or ammonia, or an acidic compound such as phosphoric acid or sulfuric acid. In addition, an antifoaming agent such as fatty acid polyglycol ester may be used to prevent the generation of foam. To maintain aerobic conditions, oxygen or oxygen-containing gas (e.g., air) may be introduced into the culture.

The temperature of the culture (medium) may be usually 20 ℃ to 45 ℃, particularly 25 ℃ to 40 ℃. The cultivation may be continued until a desired amount of the target material is obtained, but may be specifically carried out for 10 hours to 160 hours.

With respect to the recovery of the target material from the culture (culture medium), the target material can be separated and recovered by a common method known in the art. The separation method can adopt centrifugation, filtration, chromatography, crystallization and the like. For example, the supernatant obtained by low-speed centrifugation of the medium and removal of biomass may be separated by ion exchange chromatography, but is not limited thereto.

The recovery step may also include a purification process.

Another aspect of the disclosure provides the use of a polynucleotide as a promoter, wherein SEQ ID NO:1 by another nucleotide at position 268.

The polynucleotide is the same as described above.

Hereinafter, the present disclosure will be described in more detail with reference to examples. However, the following examples are only for illustrating preferred embodiments of the present invention and are not intended to limit the scope of the present invention. On the other hand, technical matters not described in the specification may be sufficiently understood and easily implemented by those skilled in the art or the like of the present disclosure.

Example 1 preparation of recombinant vectors comprising novel promoter sequences

First, a nucleotide sequence including the NCgl1416 promoter region of wild-type Corynebacterium glutamicum ATCC13032 (SEQ ID NO: 1) was obtained based on the national institutes of health Gene bank (NIH GenBank). In order to examine the effect of a promoter variant (PNCgl1416(a 268G); SEQ ID NO: 2), in which the nucleotide at position 268 of the polynucleotide corresponding to SEQ ID NO:1 was substituted with A by G, on L-lysine production, a vector for preparing a strain expressing the same was prepared using plasmid pDCM2 (Korean patent publication No. 10-2020-0136813) for inserting and replacing genes in the chromosome of Corynebacterium.

Specifically, using gDNA (genomic DNA) of wild-type corynebacterium glutamicum ATCC13032 as a template, the nucleotide sequence of SEQ ID NO: 3 and 4 and SEQ ID NO: a pair of primers with 5 and 6 sequences was used for PCR. Taking the mixture of the two fragments obtained above as a template, and taking the sequence shown in SEQ ID NO: 3 and SEQ ID NO: a pair of primers of 6 sequences was subjected to overlap PCR to obtain fragments. PCR was performed under the following conditions: denaturation at 94 ℃ for 5 min; 30 cycles of 94 ℃ for 30 seconds, 55 ℃ for 30 seconds, 72 ℃ for 1 min for 30 seconds; and 72 ℃ for 5 minutes. The pDCM2 plasmid was treated with SmaI and the resulting PCR product fusion cloned into it. In fusion cloning, use

HD cloning kit (Clontech). The resulting vector was named pDCM2-PNCgl1416(a268 g). The sequence information of the primers used to prepare the vectors is shown in Table 1 below.

[ Table 1]

SEQ ID NO	Primer name	5 'sequence 3'
			3	PNCgl1416_1F	TGAATTCGAGCTCGGTACCCCCAGTTGCCAAGGTTGGC
4	PNCgl1416_2R	CACCTTGTCCGCCGCTcGAGAATTTTCCTCCGG
			5	PNCgl1416_3F	CCGGAGGAAAATTCTCgAGCGGCGGACAAGGTG
6	PNCgl1416_4R	GTCGACTCTAGAGGATCCCCGTTGAGAGCCCAGCCGG

Example 2 evaluation of L-lysine Productivity of microorganisms comprising novel promoter sequences

Preparation of PNCgl1416 variant expression strains

The gene-substituted vector prepared in example 1 was introduced into Corynebacterium glutamicum CJ3P (US 9556463B 2) strain to prepare a variant-introduced L-lysine-producing strain "CJ 3P _ PNCgl1416(a268 g)".

Specifically, transformation was performed by electroporation (appl. Microbiol. Biotechnol.,1999,52:541-545), and then selection was made on an agar medium containing 25mg/L kanamycin for a strain in which the vector was inserted into the chromosome by means of homologous sequence recombination. The primary selected strains were subjected to secondary crossover to select strains introduced with the target variants. Using SEQ ID NO: 7 and 8 were checked for variation (substitution) in the final transformed strain by PCR and then sequenced. The primer sequence information for the preparation of PNCgl1416 variant expression strains is shown in table 2 below.

[ Table 2]

SEQ ID NO	Primer name	5 'sequence 3'
			7	PNCgl1416_5F	CAGGATGGGGAAGTTGTC
8	PNCgl1416_6R	GACCACTGTACGCGAGG

Comparison of L-lysine Productivity of PNCgl1416 variant expression strains

L-lysine productivity was analyzed by flask fermentation titers of the strain prepared in example 2-1 and the control parent strain.

First, each strain was inoculated in a 250mL corner baffle flask containing 25mL of seed medium and cultured at 30 ℃ for 20 hours with shaking at 200 rpm. 1mL of the seed culture was inoculated into a 250mL corner baffle flask containing 24mL of production medium and cultured at 30 ℃ for 72 hours with shaking at 200 rpm. In this regard, the compositions of the seed medium and the production medium are as follows.

Seed culture medium (pH 7.0)

20g glucose, 10g peptone, 5g yeast extract, 1.5g urea, 4g KH₂PO₄、8g K₂HPO₄、0.5g MgSO₄·7H₂O, 0.1mg biotin, 1mg thiamine hydrochloride, 2mg calcium pantothenate and 2mg nicotinamide (based on 1L of distilled water)

Production medium (pH 7.0)

100g glucose, 40g (NH)₄)₂SO₄2.5g of soybean protein, 5g of corn steep liquor, 3g of urea and 1g of KH₂PO₄、0.5g MgSO₄·7H₂O, 100. mu.g biotin, 1000. mu.g thiamine hydrochloride, 2000. mu.g calcium pantothenate, 3000. mu.g nicotinamide and 30g CaCO₃(based on 1L distilled water)

After the termination of the culture, L-lysine productivity was measured by HPLC, and the concentration of lysine in the medium and the rate of increase in the concentration of each strain are shown in Table 3 below.

[ Table 3]

Strain name	L-lysine concentration	Lysine concentration increase rate (%)
			CJ3P	7.87	-
CJ3P_PNCgl1416(a268g)	9.43	19.8

As shown in Table 3, it was confirmed that the concentration of L-lysine was increased by 19.8% in the Corynebacterium glutamicum CJ3P _ PNCgl1416(a268g) strain, in which the variation was introduced, compared with the Corynebacterium glutamicum CJ3P strain, in which the variation was not introduced.

In other words, it was confirmed that the mutation significantly improved L-lysine productivity of the microorganism.

Based on the above description, those skilled in the art will appreciate that the present disclosure may be embodied in different specific forms without changing the technical spirit or essential features of the present disclosure. In this regard, it should be understood that the above-described embodiments are not limiting, but illustrative in all aspects. The scope of the present disclosure is defined by the appended claims rather than by the foregoing description, and all changes and modifications that fall within the metes and bounds of the claims, or equivalence of such metes and bounds are therefore intended to be embraced by the claims.

<110> CJ first sugar manufacturing Co., Ltd

<120> novel promoter and use thereof

<130> OPA21219

<150> KR 10-2021-0059093

<151> 2021-05-07

<160> 8

<170> KoPatentIn 3.0

<210> 1

<211> 400

<212> DNA

<213> unknown

<220>

<223> promoter

<400> 1

ggtttcacca aggtttcgtc acattcgcac attcgtcaca agggcggtta cgtcacggag 60

gtcaatttgt cataggactc gattcgtcac agccgtcttt acgtcactgg agccattacg 120

tcacaccggg acctcaaatt cgctcaaacg atattccgca cccggcaact gtcggtcggg 180

tggcgccaca agagttgcct cgcgaagaat ctaaaaagct ctgccacaaa atttggaagc 240

aacgattcct gccggaggaa aattctcaag cggcggacaa ggtgcagagc gcaatgatgc 300

gtagaaattt tccatgcaga ggaaagccga taatggggca gaaccccttc ccgccaaaat 360

gacataatgt acattatcgg acaattatcc atatctggcc 400

<210> 2

<211> 400

<212> DNA

<213> unknown

<220>

<223> promoter variants

<400> 2

ggtttcacca aggtttcgtc acattcgcac attcgtcaca agggcggtta cgtcacggag 60

gtcaatttgt cataggactc gattcgtcac agccgtcttt acgtcactgg agccattacg 120

tcacaccggg acctcaaatt cgctcaaacg atattccgca cccggcaact gtcggtcggg 180

tggcgccaca agagttgcct cgcgaagaat ctaaaaagct ctgccacaaa atttggaagc 240

aacgattcct gccggaggaa aattctcgag cggcggacaa ggtgcagagc gcaatgatgc 300

gtagaaattt tccatgcaga ggaaagccga taatggggca gaaccccttc ccgccaaaat 360

gacataatgt acattatcgg acaattatcc atatctggcc 400

<210> 3

<211> 38

<212> DNA

<213> Artificial sequence

<220>

<223> primer 1F

<400> 3

tgaattcgag ctcggtaccc ccagttgcca aggttggc 38

<210> 4

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> primer 2R

<400> 4

caccttgtcc gccgctcgag aattttcctc cgg 33

<210> 5

<211> 33

<212> DNA

<213> Artificial sequence

<220>

<223> primer 3F

<400> 5

ccggaggaaa attctcgagc ggcggacaag gtg 33

<210> 6

<211> 37

<212> DNA

<213> Artificial sequence

<220>

<223> primer 4R

<400> 6

gtcgactcta gaggatcccc gttgagagcc cagccgg 37

<210> 7

<211> 18

<212> DNA

<213> Artificial sequence

<220>

<223> primer 5F

<400> 7

caggatgggg aagttgtc 18

<210> 8

<211> 17

<212> DNA

<213> Artificial sequence

<220>

<223> primer 6R

<400> 8

gaccactgta cgcgagg 17

Claims (9)

1. A polynucleotide having promoter activity, wherein SEQ ID NO:1 by a G substitution at position 268 of the nucleotide sequence set forth in fig.

2. The polynucleotide of claim 1, wherein the polynucleotide consists of the sequence of SEQ ID NO: 2.

3. A gene expression cassette comprising the polynucleotide of claim 1 and a target gene.

4. A host cell comprising the polynucleotide of claim 1 or the gene expression cassette of claim 3.

5. The host cell according to claim 4, wherein the host cell is a microorganism of the genus Corynebacterium.

6. The host cell according to claim 5, wherein the microorganism of the genus Corynebacterium is Corynebacterium glutamicum.

7. A method of producing a target material, the method comprising: culturing the host cell of claim 4 in a culture medium; and recovering the target material from the culture medium.

8. The method of claim 7, wherein the target material is an amino acid.

9. The method of claim 7, wherein the target material is L-lysine.