CN113980975B - Application of CsCS gene in inhibition of cucumber lateral shoot germination - Google Patents

Application of CsCS gene in inhibition of cucumber lateral shoot germination Download PDF

Info

Publication number
CN113980975B
CN113980975B CN202111314840.1A CN202111314840A CN113980975B CN 113980975 B CN113980975 B CN 113980975B CN 202111314840 A CN202111314840 A CN 202111314840A CN 113980975 B CN113980975 B CN 113980975B
Authority
CN
China
Prior art keywords
cucumber
gene
cscs
gly
val
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202111314840.1A
Other languages
Chinese (zh)
Other versions
CN113980975A (en
Inventor
武涛
郝宁
杜亚琳
夏雨桐
曹嘉健
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Hunan Agricultural University
Original Assignee
Hunan Agricultural University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Hunan Agricultural University filed Critical Hunan Agricultural University
Priority to CN202111314840.1A priority Critical patent/CN113980975B/en
Publication of CN113980975A publication Critical patent/CN113980975A/en
Application granted granted Critical
Publication of CN113980975B publication Critical patent/CN113980975B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
    • C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
    • C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
    • C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
    • C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Cell Biology (AREA)
  • Botany (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Virology (AREA)
  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention discloses application of a CsCS gene in inhibition of germination of cucumber lateral branches. The nucleotide sequence of the cucumber CsCS gene is shown in SEQ ID NO. 1. The screening discovers that the CsCS gene of the cucumber is related to the development of lateral branches of the cucumber, the lateral branch germination quantity of mutant Cslb after the CsCS gene of the cucumber is mutated is reduced compared with that of a wild type '649', and the gene can be used for screening cucumber varieties with few branches and improving cucumber plant types. The research result is beneficial to disclosing the molecular action mechanism of the development of the lateral branches of the cucumbers, lays a foundation for creating new varieties of the few-branch cucumbers and cultivating new varieties, improves the cultivation efficiency of the cucumbers, simplifies the cultivation efficiency and reduces the production cost.

Description

Application of CsCS gene in inhibition of cucumber lateral shoot germination
Technical Field
The invention relates to the technical field of agricultural biology, in particular to application of a CsCS gene in inhibition of germination of cucumber lateral branches.
Background
The branch is one of the important agronomic traits for plant type morphogenesis. Branching can affect crop yield, and branching conditions can also affect crop cultivation density and nutrient distribution. More branches can cause poor ventilation, and the crop is easy to be damaged to cause yield reduction.
MOC1 and CUC are key regulatory genes that regulate lateral bud initiation. Research has demonstrated that MOC1 controls rice tillering by controlling the initiation of axillary meristems to control the formation of tillering buds in rice. CUC2 and CUC3 are directly combined with DA1 (the peptidase substrate UBP15 can inhibit the initiation of axillary meristems) promoter and activate the expression of the DA1 promoter, and a CUC2/CUC3-DA1-UBP15 regulation module is formed to control the initiation of axillary meristems so as to regulate the branching of arabidopsis thaliana. The cucumber branch suppression gene CsBRC1 can coordinate with the auxin polar transport gene CsPIN3 to regulate and control cucumber branches (Shen J, zhang Y Q, ge D F, et al. CsBRC1 inhibition assay bed with low side direction predicting the auxin efflux carrier CsPIN3 in cumumber [ J ]. Proceedings of the National Academy of science of the technology of the United States of America,2019,116 (34): 17105-17114.). Although the research on the regulation and control of the cucumber collateral has been advanced to a certain extent, the mechanism of the regulation and control of the cucumber collateral still needs to be deeply researched, and the result provides an important reference for people to deeply research the regulation and control mechanism of the development of the cucumber collateral.
The identified plant branch regulation gene is used for developing a molecular marker, and an ideal plant type new vegetable variety can be bred through molecular marker-assisted breeding. Yan Li Ying et al bred through molecular marker assisted selection technology and other breeding means a green island No. 7 variety suitable for multi-branch seedling-dropping-free labor-saving cultivation of drought-resistant cucumber in sheds (Yan Li Ying, song Xiaofei, li Xiao Li, etc.. Breeding of high-quality and high-yield drought-resistant cucumber variety 'green island No. 7' through multi-branch seedling-dropping-free labor-saving cultivation in sheds [ P ]: hebei. Hebei science and technology institute, 2015-12-06.). By using the cloned plant branch regulation genes, new germplasm with different branch types can be obtained by a gene editing technology: tomato germplasm material with branches and proper flower and fruit size is obtained by editing the tomato CLAVATA gene (Heidi L. Fixing the tomato gene: CRISPR edges correct plant-weaving snafu [ J ]. Nature,2017,545 (7655): 394-395.). In the aspect of cucumber, as the Chinese cucumber is planted in a way that varieties with small number of lateral branches, short length and late germination time tend to be selected, molecular markers can be developed by utilizing the CsCS gene information of the cucumber, or the germplasm resources of the cucumbers with different branch types can be identified and created by the gene editing technology.
Disclosure of Invention
Aiming at the defects in the prior art, the invention provides the application of the CsCS gene in inhibiting germination of cucumber lateral branches.
A cucumber collateral sprouting regulation gene is a cucumber CsCS gene, and the nucleotide sequence is shown as SEQ ID NO. 1.
The invention also provides a protein coded by the cucumber collateral sprouting regulation gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.
The invention also provides application of the cucumber collateral branch germination regulation gene in inhibition of cucumber collateral branch germination.
The invention also provides application of the cucumber lateral shoot germination regulation and control gene in screening cucumber varieties with less lateral shoot germination.
The invention also provides a cucumber plant type improvement method with less lateral branch germination, which silences or knocks out the CsCS gene of cucumber, and the nucleotide sequence of the CsCS gene of cucumber is shown in SEQ ID NO. 1. When the function of the CsCS gene in the cucumber is reduced or deleted through gene silencing or knockout, the quantity of lateral branches of the cucumber can be reduced.
Preferably, a recombinant CRISPR vector for knocking out a cucumber CsCS gene is constructed, and the constructed recombinant CRISPR vector is transferred into the cucumber by adopting an agrobacterium-mediated method, so that the transgenic cucumber with improved plant type is obtained.
More preferably, in the knockout, the target points for the cucumber CsCS gene include two sequences:
(1)CCAGAACCGAAGGCTTTTCTGGA；
(2)CCAAGCTTTCCTTTTCCGCCGTT。
further preferably, sequences aiming at two targets are transferred into a vector PU6gRNAcas9 to obtain the recombinant CRISPR vector.
The screening discovers that the CsCS gene of the cucumber is related to the development of lateral branches of the cucumber, the lateral branch germination quantity of mutant Cslb after the CsCS gene of the cucumber is mutated is reduced compared with that of a wild type '649', and the gene can be used for screening cucumber varieties with few branches and improving cucumber plant types.
The research result is favorable for disclosing the molecular action mechanism of the development of the lateral branches of the cucumbers, lays a foundation for creating new varieties of the less-branched cucumbers and cultivating new varieties, improves the cultivation efficiency of the cucumbers, and reduces the production cost.
Drawings
FIG. 1 shows the plant map of cucumber short lateral shoot mutant Cslb and its wild type '649'.
FIG. 2 is a statistical chart of the number of lateral branches of the cucumber short lateral branch mutant Cslb and the wild type '649'.
FIG. 3 is a distribution diagram of lateral branches of each node of a cucumber few lateral branch mutant Cslb and a wild type '649'.
FIG. 4 shows the results of CsCS knockout plant detection.
FIG. 5 shows the distribution of lateral branches at each node of CsCS knockout plant and control Kate.
Detailed Description
Example 1: discovery of SNP (single nucleotide polymorphism) sites related to cucumber brachiony
Mutating wild cucumber '649' with 2% EMS mutagen to obtain cucumber EMS mutant library, and mixing with M 1 Obtaining M by selfing generation individual plant 2 Family generation, in M 2 Identifying stably inherited cucumber lateral shoot mutant Cslb (figure 1) in ancestral line
The wild-type 649 'branch number was found to be significantly greater than that of the mutant Cslb by performing a trait survey on 15 loci of the wild-type 649' and mutant Cslb 17 days after colonization (fig. 2). Meanwhile, the distribution of 15-node wild type '649' and mutant Cslb lateral branches is observed, and the whole wild type '649' lateral branch is randomly distributed, while the mutant Cslb lateral branches are mainly concentrated at 6-9 nodes (figure 3).
Hybridizing the Cslb mutant with the wild parent thereof to obtain F 1 Chao, tai Jing F 1 Selfing to obtain F 2 And (4) generation. F 1 The plant phenotypes are all wild-type phenotypes, and are F 2 158 individuals in the generation group were identified for branching phenotype, and the results showed that there were 116 wild-type phenotypic individuals and 42 mutant phenotypic individuals (Chi square test: chi test) 2 ＝0.135，P>0.05 The segregation ratio of 3.
According to the genetic characteristics of the cucumber few lateral branch mutant Cslb, a MutMap method is adopted to carry out whole genome re-sequencing screening on candidate genes, and 1 wild type parent strain '649' single strain and F are selected 2 Separating young leaves of 17 mutant phenotype single plants in the population, extracting DNA according to the single plants, mixing the DNA in equal quantity, constructing a wild type and mutant mixing pool, and performing whole genome re-sequencing and analysis.
The data statistics of the sequencing result of the whole genome of the wild type and cucumber few lateral branch mutant Cslb are shown in Table 1.
TABLE 1 statistics of data from the sequencing results of the whole genome of the wild type '649' and the lateral shoot mutant Cslb of cucumber
Wild type pool Cslb mutant pool
Reference genome size (bp) 197,271,687 197,271,687
Number of Reads aligned to reference genome 61,864,739 54,636,003
Comparison ratio (%) 90.4100 91.4700
Coverage (%) 97.1100 97.0000
Through screening, 2 SNP variation sites on chromosome 6 are obtained, wherein 1 SNP is located in an exon region and causes non-synonymous amino acid change, the mutation mode is C to T, and the other 1 SNP site is located in an alternative splicing site of an intron.
In order to identify candidate genes for regulating Cslb mutant, 2 SNPs were detected at F using KASP technique 2 Genotyping in generation populations. The results showed that SNP1 (Chr 6, 18277305) was genotypic and F 2 The phenotype of the population individuals co-segregates, with the SNP having a genotype of C: T or C: C in wild type phenotypic individuals and T: T in mutant phenotypic individuals and the genotype of the other SNP being F 2 The individual phenotypes in the population could not be co-segregating (table 2). Therefore, the gene Csa6G405290 (CsCS) comprising SNP18277305 was preliminarily determined to be a Cslb mutant candidate gene. The overall length of the CsCS genome sequence is 5392 bp, 12 introns and 13 exons are included, the overall length of the coding region of the gene is 1320bp (the sequence is shown as SEQ ID No. 1), and 439 amino acids are coded (the sequence is shown as SEQ ID No. 2).
TABLE 2 KASP genotyping assay results
Figure BDA0003343314760000041
Figure BDA0003343314760000051
Example 2: application of CsCS gene in inhibition of cucumber lateral shoot germination
The CsCS gene of the cucumber is knocked out by utilizing CRISPR/Cas9 technology by entrusting Mimi Biotechnology (Jiangsu) limited company, and the germplasm resource of the cucumber with few lateral branches can be obtained. Carrying out single-gene double-target mutation of CsCS gene on a cucumber Kate variety (Kate species Co., ltd., shouguang), wherein two targets are positioned on a second exon, the target 1 is ACCATGTGAATCTCATGGAGG, the target 2 is CCACGCCGCCCAATTTCGGAAGC, transferring sequences aiming at the two targets into a vector PU6 NACAs9 to obtain a recombinant CRISPR vector, selecting the successfully constructed vector, carrying out genetic transformation on the cucumber Kate variety, carrying out mutation on the successfully transformed plant at the CsCS gene target to obtain a positive plant (cscS 1), and identifying the phenotype of the positive plant (figure 4 and figure 5), wherein the result shows that the germination of lateral branches of the cucumber after the CsgRCS gene is knocked out is reduced. The identified plant branch regulation gene CsCS is used for developing a molecular marker, and an ideal plant type new cucumber variety can be cultivated through molecular marker-assisted breeding.
Sequence listing
<110> Hunan agriculture university
Application of <120> CsCS gene in inhibition of germination of cucumber lateral branches
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1320
<212> DNA
<213> cucumber (Cucumis sativus L.)
<400> 1
atggcttcct ctctctcttc taaaccgttt ctgggttctt ccagaaccga aggcttttct 60
ggattgacct ctctctctac agatctttcc aagctttcct tttccgccgt taaaatctca 120
gttgggtctc gaaacgcgaa gaagctgcag ataaaagctg ctggtagtac atttggaaat 180
tactttcgtg ttacaaccta tggagaatct catggaggtg gagttggctg tgtgattgat 240
ggatgtcctc cacgccgccc aatttcggaa gctgatttgc aagtggagct tgacagaagg 300
agaccaggtc agagtagaat taccactcca agaaaagaga ctgatacatg tcggatactt 360
tcaggagtca ctaatggagt tactactgga acaccaattc acgtatttgt accaaatacc 420
gatcagagag gacatgatta cagtgaaatg tcaatagcct acaggccttc tcatgccgat 480
gccacatatg acatgaaata tggaattcga gctgttgagg gtggcggcag atcttcagcc 540
agggaaacca ttgggagggt tgctgctgga gctgttgcta agaaaatttt gaaggaacta 600
gcaggaactg aggtacttgc ttatgtatct caagtctaca aggttgtact gcccgagggt 660
gtggttgatc atgaaacttt gtcaatggag cagattgaga gcaacatagt caggtgccca 720
gatcctgaat atgctgagaa aatgattgct gccattgacg ctgttcgtgt gaggggggaa 780
tcaattggtg gtgttgtcac atgcattgtg aagaactgtc cacctgggct tggttcacca 840
gtttttgaca aacttgaagc tgagtttgct aaagctgttt tgtcattacc agcatcgaag 900
ggctttgaaa ttggcagtgg attcggaggt acatttttaa ctggcagtga acacaacgat 960
ccattctatt tagatgagaa tggaagaatt agaacggtta caaaccgctc tggtggaata 1020
cagggaggta tatctaatgg agaagtcata agcatgaggg tagctttcaa gccaacagct 1080
accattggga aaaagcagaa tacagttacc agagataaga aagaggttga gctgattgct 1140
cgtggccgtc acgacccttg tgtcgtccca agagctgtgc ctatggttga agccatggta 1200
gctctagttc ttatggacca gttgatggca caacatggac aatgcaatct gttcccaatc 1260
aatccagact tgcagtcacc tatcgaacca aaagttgggg tttcgaaaac gactgtttga 1320
<210> 2
<211> 439
<212> PRT
<213> cucumber (Cucumis sativus L.)
<400> 2
Met Ala Ser Ser Leu Ser Ser Lys Pro Phe Leu Gly Ser Ser Arg Thr
1 5 10 15
Glu Gly Phe Ser Gly Leu Thr Ser Leu Ser Thr Asp Leu Ser Lys Leu
20 25 30
Ser Phe Ser Ala Val Lys Ile Ser Val Gly Ser Arg Asn Ala Lys Lys
35 40 45
Leu Gln Ile Lys Ala Ala Gly Ser Thr Phe Gly Asn Tyr Phe Arg Val
50 55 60
Thr Thr Tyr Gly Glu Ser His Gly Gly Gly Val Gly Cys Val Ile Asp
65 70 75 80
Gly Cys Pro Pro Arg Arg Pro Ile Ser Glu Ala Asp Leu Gln Val Glu
85 90 95
Leu Asp Arg Arg Arg Pro Gly Gln Ser Arg Ile Thr Thr Pro Arg Lys
100 105 110
Glu Thr Asp Thr Cys Arg Ile Leu Ser Gly Val Thr Asn Gly Val Thr
115 120 125
Thr Gly Thr Pro Ile His Val Phe Val Pro Asn Thr Asp Gln Arg Gly
130 135 140
His Asp Tyr Ser Glu Met Ser Ile Ala Tyr Arg Pro Ser His Ala Asp
145 150 155 160
Ala Thr Tyr Asp Met Lys Tyr Gly Ile Arg Ala Val Glu Gly Gly Gly
165 170 175
Arg Ser Ser Ala Arg Glu Thr Ile Gly Arg Val Ala Ala Gly Ala Val
180 185 190
Ala Lys Lys Ile Leu Lys Glu Leu Ala Gly Thr Glu Val Leu Ala Tyr
195 200 205
Val Ser Gln Val Tyr Lys Val Val Leu Pro Glu Gly Val Val Asp His
210 215 220
Glu Thr Leu Ser Met Glu Gln Ile Glu Ser Asn Ile Val Arg Cys Pro
225 230 235 240
Asp Pro Glu Tyr Ala Glu Lys Met Ile Ala Ala Ile Asp Ala Val Arg
245 250 255
Val Arg Gly Glu Ser Ile Gly Gly Val Val Thr Cys Ile Val Lys Asn
260 265 270
Cys Pro Pro Gly Leu Gly Ser Pro Val Phe Asp Lys Leu Glu Ala Glu
275 280 285
Phe Ala Lys Ala Val Leu Ser Leu Pro Ala Ser Lys Gly Phe Glu Ile
290 295 300
Gly Ser Gly Phe Gly Gly Thr Phe Leu Thr Gly Ser Glu His Asn Asp
305 310 315 320
Pro Phe Tyr Leu Asp Glu Asn Gly Arg Ile Arg Thr Val Thr Asn Arg
325 330 335
Ser Gly Gly Ile Gln Gly Gly Ile Ser Asn Gly Glu Val Ile Ser Met
340 345 350
Arg Val Ala Phe Lys Pro Thr Ala Thr Ile Gly Lys Lys Gln Asn Thr
355 360 365
Val Thr Arg Asp Lys Lys Glu Val Glu Leu Ile Ala Arg Gly Arg His
370 375 380
Asp Pro Cys Val Val Pro Arg Ala Val Pro Met Val Glu Ala Met Val
385 390 395 400
Ala Leu Val Leu Met Asp Gln Leu Met Ala Gln His Gly Gln Cys Asn
405 410 415
Leu Phe Pro Ile Asn Pro Asp Leu Gln Ser Pro Ile Glu Pro Lys Val
420 425 430
Gly Val Ser Lys Thr Thr Val
435
<210> 3
<211> 23
<212> DNA
<213> cucumber (Cucumis sativus L.)
<400> 3
ccagaaccga aggcttttct gga 23
<210> 4
<211> 23
<212> DNA
<213> cucumber (Cucumis sativus L.)
<400> 4
ccaagctttc cttttccgcc gtt 23

Claims (4)

1. A method for improving the shape of cucumber plant with less germination of lateral branches is characterized by thatCsCSGene silencing or knockout, cucumberCsCSThe gene nucleotide sequence is shown in SEQ ID NO. 1.
2. The method for improving cucumber plant type according to claim 1, wherein the method is constructed for knocking out cucumberCsCSThe gene recombination CRISPR vector and an agrobacterium-mediated method are adopted to transfer the constructed recombination CRISPR vector into cucumber to obtain the transgenic cucumber with improved plant type.
3. The method for improving cucumber plant type according to claim 2, wherein the knockout is performed on cucumberCsCSThe target points of the gene comprise two sequences:
（1）CCAGAACCGAAGGCTTTTCTGGA；
（2）CCAAGCTTTCCTTTTCCGCCGTT。
4. the cucumber plant type improvement method as claimed in claim 3, wherein sequences aiming at two targets are transferred into a vector PU6gRNAcas9 to obtain the recombinant CRISPR vector.
CN202111314840.1A 2021-11-08 2021-11-08 Application of CsCS gene in inhibition of cucumber lateral shoot germination Active CN113980975B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111314840.1A CN113980975B (en) 2021-11-08 2021-11-08 Application of CsCS gene in inhibition of cucumber lateral shoot germination

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111314840.1A CN113980975B (en) 2021-11-08 2021-11-08 Application of CsCS gene in inhibition of cucumber lateral shoot germination

Publications (2)

Publication Number Publication Date
CN113980975A CN113980975A (en) 2022-01-28
CN113980975B true CN113980975B (en) 2022-10-28

Family

ID=79747120

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111314840.1A Active CN113980975B (en) 2021-11-08 2021-11-08 Application of CsCS gene in inhibition of cucumber lateral shoot germination

Country Status (1)

Country Link
CN (1) CN113980975B (en)

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109022449A (en) * 2018-07-25 2018-12-18 沈阳农业大学 Cucumber CsMLO1 gene and its silencing expression vector establishment method, application
CN110467658A (en) * 2019-07-23 2019-11-19 中国农业大学 Application in cucumber CsGL2-LIKE gene and its participation regulation male flower part abortion

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109022449A (en) * 2018-07-25 2018-12-18 沈阳农业大学 Cucumber CsMLO1 gene and its silencing expression vector establishment method, application
CN110467658A (en) * 2019-07-23 2019-11-19 中国农业大学 Application in cucumber CsGL2-LIKE gene and its participation regulation male flower part abortion

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
Accession NO.: XM_004149864.3，PREDICTED: Cucumis sativus chorismate synthase，chloroplastic (LOC101205929),mRNA;None;《Genbank Database》;20191217;DEFINITION、SOURCE、FEATURES及ORIGIN部分 *

Also Published As

Publication number Publication date
CN113980975A (en) 2022-01-28

Similar Documents

Publication Publication Date Title
Xie et al. Fine mapping of a yield-enhancing QTL cluster associated with transgressive variation in an Oryza sativa× O. rufipogon cross
CN108239647B (en) Gene and molecular marker for controlling rape plant type and application
CN111153974A (en) Corn disease-resistant gene and molecular marker and application thereof
Richardson et al. The power of classic maize mutants: driving forward our fundamental understanding of plants
CN113430221B (en) Application of tomato WRKY37 protein in regulation of leaf senescence resistance of tomatoes and improvement of tomato yield
Takeuchi Developing isogenic lines of Japanese rice cultivar ‘Koshihikari’with early and late heading
CN108085320B (en) Dominant early maturing gene Ef-cd of rice and application thereof
Chen et al. Genome-wide identification and characterization of the ALOG gene family in Petunia
Brar et al. Biotechnological approaches for increasing productivity and sustainability of rice production
CN114990139B (en) Application of CsHLS1 gene or protein encoded by same in regulation and control of organ size of cucumber plant
CN109111511A (en) The breeding method of super long granule rice
CN113980975B (en) Application of CsCS gene in inhibition of cucumber lateral shoot germination
Guo et al. Clustered spikelets 4, encoding a putative cytochrome P450 protein CYP724B1, is essential for rice panicle development
CN109735549A (en) Application of the corn gene in control corn tassel row number
US20230292687A1 (en) Methods and Compositions for Improving Cold-Tolerance of Plants
CN111304219B (en) GL1 gene separated from rice WZ1 and application thereof in increasing rice grain length
CN112625099A (en) Rape dwarf gene BND2 and application thereof in rape crossbreeding
CN109112137B (en) Gene SNG1 for controlling size and weight of rice grains and application thereof
Tsuda et al. Isolation and mapping of three rice mutants that showed ectopic expression of KNOX genes in leaves
Ying et al. Functional characterization of genes/QTLs for increasing rice yield potential
CN110903370B (en) TCP transcription factor, gene for encoding TCP transcription factor and application
US20190136245A1 (en) Restorer Plants
CN114507680B (en) Bean alpha-pyrone reductase PvTKPR2 gene and encoding protein and application thereof
CN114786475B (en) 9-LOX5 gene variants providing powdery mildew resistance
WO2024037338A1 (en) Plant grain size regulation gene and use thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant