CN113980975A

CN113980975A - Application of CsCS gene in inhibition of cucumber lateral shoot germination

Info

Publication number: CN113980975A
Application number: CN202111314840.1A
Authority: CN
Inventors: 武涛; 郝宁; 杜亚琳; 夏雨桐; 曹嘉健
Original assignee: Hunan Agricultural University
Current assignee: Hunan Agricultural University
Priority date: 2021-11-08
Filing date: 2021-11-08
Publication date: 2022-01-28
Anticipated expiration: 2041-11-08
Also published as: CN113980975B

Abstract

The invention discloses application of a CsCS gene in inhibition of cucumber lateral shoot germination. The nucleotide sequence of the cucumber CsCS gene is shown in SEQ ID NO. 1. The screening discovers that the CsCS gene of the cucumber is related to the development of lateral branches of the cucumber, the lateral branch germination quantity of mutant Cslb after the CsCS gene of the cucumber is mutated is reduced compared with that of a wild type '649', and the gene can be used for screening cucumber varieties with few branches and improving cucumber plant types. The research result is beneficial to disclosing the molecular action mechanism of the development of the lateral branches of the cucumbers, lays a foundation for creating new varieties of the few-branch cucumbers and cultivating new varieties, improves the cultivation efficiency of the cucumbers, simplifies the cultivation efficiency and reduces the production cost.

Description

Application of CsCS gene in inhibition of cucumber lateral shoot germination

Technical Field

The invention relates to the technical field of agricultural biology, in particular to application of a CsCS gene in inhibition of germination of cucumber lateral branches.

Background

The branch is one of the important agronomic traits for plant type morphogenesis. Branching can affect crop yield, and branching conditions can also affect crop cultivation density and nutrient distribution. More branches can cause poor ventilation, and the crop is easy to be damaged to cause yield reduction.

MOC1 and CUC are key regulatory genes that regulate lateral bud initiation. Research has demonstrated that MOC1 controls rice tillering by controlling the initiation of axillary meristems to control the formation of tillering buds in rice. CUC2 and CUC3 directly combine with DA1 (its peptidase substrate UBP15 can inhibit the initiation of axillary meristem) promoter and activate its expression, and CUC2/CUC3-DA1-UBP15 control module is formed to control the initiation of axillary meristem so as to control Arabidopsis branching. The cucumber branch suppression gene CsBRC1 can regulate and control cucumber branches in cooperation with the auxin polar transport gene CsPIN3 (Shen J, Zhang Y Q, Ge D F, et al. CsBRC1 inhibition activity assay and export ability by direct prediction the aux efflux carrier CsPIN3 in cut [ J ] Proceedings of the National Academy of Sciences of the United States of America,2019,116(34):17105 and 17114.). Although the research on the regulation and control of the cucumber lateral branches has been advanced to a certain extent, the mechanism of the regulation and control of the cucumber lateral branches still needs to be deeply researched, and the results provide important references for people to deeply research the regulation and control mechanism of the cucumber lateral branch development.

The identified plant branch regulation gene is used for developing a molecular marker, and an ideal plant type new vegetable variety can be bred through molecular marker-assisted breeding. Yan standing English et al bred dry cucumber variety 'Green island No. 7' suitable for the labor-saving cultivation of multiple-branch seedling-falling-free in greenhouse by breeding means such as molecular marker assisted selection technology (Yan standing English, Song Xiaofei, Li Xiao Li, etc.. greenhouse breeding of high-quality and high-yield dry cucumber variety 'Green island No. 7' with multiple-branch seedling-falling-free in labor-saving manner [ P ]: Hebei. Hebei science and technology institute, 2015-12-06.). By using the cloned plant branch regulation genes, new germplasm with different branch types can be obtained by a gene editing technology: tomato germplasm material with branches and proper flower and fruit size is obtained by editing the tomato CLAVATA gene (Heidi L. Fixing the tomato gene: CRISPR edges correct plant-cutting snafu [ J ] Nature,2017,545(7655): 394-395.). In the aspect of cucumber, most of Chinese cucumbers tend to select varieties with small number of lateral branches, short length and late germination time, so that molecular markers can be developed by utilizing CsCS gene information of the cucumbers or different branch type cucumber germplasm resources can be identified and created by a gene editing technology.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides the application of the CsCS gene in inhibiting germination of cucumber lateral branches.

A cucumber collateral sprouting regulation gene is a cucumber CsCS gene, and the nucleotide sequence is shown as SEQ ID NO. 1.

The invention also provides a protein coded by the cucumber collateral sprouting regulation gene, and the amino acid sequence of the protein is shown as SEQ ID NO. 2.

The invention also provides application of the cucumber collateral branch germination regulation gene in inhibition of cucumber collateral branch germination.

The invention also provides application of the cucumber collateral sprouting regulation and control gene in screening cucumber varieties with less collateral sprouting.

The invention also provides a cucumber plant type improvement method with less lateral branch germination, which is characterized in that the cucumber CsCS gene is silenced or knocked out, and the nucleotide sequence of the cucumber CsCS gene is shown as SEQ ID No. 1. When the function of the CsCS gene in the cucumber is reduced or deleted through gene silencing or knockout, the quantity of lateral branches of the cucumber can be reduced.

Preferably, a recombinant CRISPR vector for knocking out a cucumber CsCS gene is constructed, and the constructed recombinant CRISPR vector is transferred into the cucumber by adopting an agrobacterium-mediated method, so that the transgenic cucumber with improved plant type is obtained.

More preferably, in the knockout, the target points for the cucumber CsCS gene include two sequences:

(1)CCAGAACCGAAGGCTTTTCTGGA；

(2)CCAAGCTTTCCTTTTCCGCCGTT。

further preferably, sequences aiming at two targets are transferred into a vector PU6gRNAcas9 to obtain the recombinant CRISPR vector.

The screening discovers that the CsCS gene of the cucumber is related to the development of lateral branches of the cucumber, the lateral branch germination quantity of mutant Cslb after the CsCS gene of the cucumber is mutated is reduced compared with that of a wild type '649', and the gene can be used for screening cucumber varieties with few branches and improving cucumber plant types.

The research result is beneficial to disclosing the molecular action mechanism of the development of the lateral branches of the cucumbers, lays a foundation for creating new varieties of the few-branch cucumbers and cultivating new varieties, improves the cultivation efficiency of the cucumbers, simplifies the cultivation efficiency and reduces the production cost.

Drawings

FIG. 1 shows the plant map of cucumber short lateral shoot mutant Cslb and its wild type '649'.

FIG. 2 is a statistical chart of the number of lateral branches of the cucumber short lateral branch mutant Cslb and the wild type '649'.

FIG. 3 is a distribution diagram of lateral branches of each node of a cucumber few lateral branch mutant Cslb and a wild type '649'.

FIG. 4 shows the results of CsCS knockout plant detection.

FIG. 5 shows the distribution of lateral branches at each node of CsCS knockout plant and control Kate.

Detailed Description

Example 1: discovery of SNP (single nucleotide polymorphism) sites related to cucumber brachiony

Mutating wild cucumber '649' with 2% EMS mutagen to obtain cucumber EMS mutant library, and mixing with M₁Obtaining M by selfing generation individual plant₂Family generation, in M₂Identifying stably inherited lateral shoot mutant Cslb of cucumber in ancestry line (figure 1)

By performing a trait survey on 15 loci of wild type '649' and mutant Cslb 17 days after colonization, it was found that wild type '649' had a significantly greater number of branches than mutant Cslb (fig. 2). Meanwhile, the distribution of 15-node wild type '649' and mutant Cslb lateral branches is observed, and the whole wild type '649' lateral branch is randomly distributed, while the mutant Cslb lateral branches are mainly concentrated at 6-9 nodes (figure 3).

Cslb mutants were compared withHybridizing wild parents to obtain F₁Chao, Tai Jing F₁Selfing to obtain F₂And (4) generation. F₁The plant phenotypes are all wild-type phenotypes, and are F₂158 individuals in the generation group were identified for branching phenotype, and the results showed that there were 116 wild-type phenotypic individuals and 42 mutant phenotypic individuals (Chi square test: Chi test)²＝0.135，P>0.05) according with the segregation ratio of 3:1, and the result shows that the cucumber few-lateral-branch character is monogenic recessive inheritance.

Performing whole genome re-sequencing by a MutMap method according to the genetic characteristics of the cucumber lateral shoot mutant Cslb to screen candidate genes, and selecting 1 wild parent strain '649' single strain and F₂Separating young leaves of 17 mutant phenotype single plants in the population, extracting DNA according to the single plants, mixing the DNA in equal quantity, constructing a wild type and mutant mixing pool, and performing whole genome re-sequencing and analysis.

Data statistics of the wild type and cucumber few lateral shoot mutant Cslb whole genome sequencing results are shown in Table 1.

TABLE 1 statistics of data from the sequencing results of the whole genome of the wild type '649' and the lateral shoot mutant Cslb of cucumber

	Wild type pond	Cslb mutant pool
			Reference genome size (bp)	197,271,687	197,271,687
Number of Reads aligned to reference genome	61,864,739	54,636,003
			Comparison ratio (%)	90.4100	91.4700
Coverage (%)	97.1100	97.0000

Through screening, 2 SNP variation sites on chromosome 6 are obtained, wherein 1 SNP is located in an exon region and causes non-synonymous amino acid change, the mutation mode is C to T, and the other 1 SNP site is located in an alternative splicing site of an intron.

In order to identify candidate genes for regulating Cslb mutant, 2 SNPs were detected in F by using KASP technique₂Genotyping situation in generation population. The results show that the genotype of SNP1(Chr6, 18277305) is related to F₂The phenotype of the population individuals co-segregates, with the SNP having a genotype of C: T or C: C in wild type phenotypic individuals and T: T in mutant phenotypic individuals and the genotype of the other SNP being F₂Individual phenotypes in the population failed to co-segregate (Table 2). Therefore, the gene Csa6G405290(CsCS) comprising SNP18277305 was preliminarily determined to be a Cslb mutant candidate gene. The full length of the CsCS genome sequence is 5392 bp, and comprises 12 introns and 13 exons, the full length of the coding region of the gene is 1320bp (the sequence is shown as SEQ ID No. 1), and 439 amino acids are coded (the sequence is shown as SEQ ID No. 2).

TABLE 2 KASP genotyping assay results

Example 2: application of CsCS gene in inhibition of cucumber lateral shoot germination

The CsCS gene of the cucumber is knocked out by utilizing the CRISPR/Cas9 technology by entrusting Mimi Biotechnology (Jiangsu) Co., Ltd, and the germplasm resource of the cucumber with few lateral branches can be obtained. The single-gene double-target mutation of the CsCS gene is carried out on a cucumber Kate variety (Kate specialty Co., Shouguang), two targets are positioned on a second exon, target 1 is ACCTATGGAGAATCTCATGGAGG, target 2 is CCACGCCGCCCAATTTCGGAAGC, sequences aiming at the two targets are transferred into a vector PU6gRNAcas9 to obtain a recombinant CRISPR vector, the successfully constructed vector is selected and genetically transformed, the successfully transformed plant is mutated at the CsCS gene target to obtain a positive plant (CsCS1), the phenotype of the positive plant is identified (figure 4 and figure 5), and the result shows that the germination of lateral branches of cucumbers subjected to CsCS gene knockout is reduced. The identified plant branch regulation gene CsCS is used for developing a molecular marker, and an ideal plant type new cucumber variety can be cultivated through molecular marker-assisted breeding.

Sequence listing

<110> Hunan agriculture university

Application of <120> CsCS gene in inhibition of germination of cucumber lateral branches

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1320

<212> DNA

<213> cucumber (Cucumis sativus L.)

<400> 1

atggcttcct ctctctcttc taaaccgttt ctgggttctt ccagaaccga aggcttttct 60

ggattgacct ctctctctac agatctttcc aagctttcct tttccgccgt taaaatctca 120

gttgggtctc gaaacgcgaa gaagctgcag ataaaagctg ctggtagtac atttggaaat 180

tactttcgtg ttacaaccta tggagaatct catggaggtg gagttggctg tgtgattgat 240

ggatgtcctc cacgccgccc aatttcggaa gctgatttgc aagtggagct tgacagaagg 300

agaccaggtc agagtagaat taccactcca agaaaagaga ctgatacatg tcggatactt 360

tcaggagtca ctaatggagt tactactgga acaccaattc acgtatttgt accaaatacc 420

gatcagagag gacatgatta cagtgaaatg tcaatagcct acaggccttc tcatgccgat 480

gccacatatg acatgaaata tggaattcga gctgttgagg gtggcggcag atcttcagcc 540

agggaaacca ttgggagggt tgctgctgga gctgttgcta agaaaatttt gaaggaacta 600

gcaggaactg aggtacttgc ttatgtatct caagtctaca aggttgtact gcccgagggt 660

gtggttgatc atgaaacttt gtcaatggag cagattgaga gcaacatagt caggtgccca 720

gatcctgaat atgctgagaa aatgattgct gccattgacg ctgttcgtgt gaggggggaa 780

tcaattggtg gtgttgtcac atgcattgtg aagaactgtc cacctgggct tggttcacca 840

gtttttgaca aacttgaagc tgagtttgct aaagctgttt tgtcattacc agcatcgaag 900

ggctttgaaa ttggcagtgg attcggaggt acatttttaa ctggcagtga acacaacgat 960

ccattctatt tagatgagaa tggaagaatt agaacggtta caaaccgctc tggtggaata 1020

cagggaggta tatctaatgg agaagtcata agcatgaggg tagctttcaa gccaacagct 1080

accattggga aaaagcagaa tacagttacc agagataaga aagaggttga gctgattgct 1140

cgtggccgtc acgacccttg tgtcgtccca agagctgtgc ctatggttga agccatggta 1200

gctctagttc ttatggacca gttgatggca caacatggac aatgcaatct gttcccaatc 1260

aatccagact tgcagtcacc tatcgaacca aaagttgggg tttcgaaaac gactgtttga 1320

<210> 2

<211> 439

<212> PRT

<213> cucumber (Cucumis sativus L.)

<400> 2

Met Ala Ser Ser Leu Ser Ser Lys Pro Phe Leu Gly Ser Ser Arg Thr

1 5 10 15

Glu Gly Phe Ser Gly Leu Thr Ser Leu Ser Thr Asp Leu Ser Lys Leu

20 25 30

Ser Phe Ser Ala Val Lys Ile Ser Val Gly Ser Arg Asn Ala Lys Lys

35 40 45

Leu Gln Ile Lys Ala Ala Gly Ser Thr Phe Gly Asn Tyr Phe Arg Val

50 55 60

Thr Thr Tyr Gly Glu Ser His Gly Gly Gly Val Gly Cys Val Ile Asp

65 70 75 80

Gly Cys Pro Pro Arg Arg Pro Ile Ser Glu Ala Asp Leu Gln Val Glu

85 90 95

Leu Asp Arg Arg Arg Pro Gly Gln Ser Arg Ile Thr Thr Pro Arg Lys

100 105 110

Glu Thr Asp Thr Cys Arg Ile Leu Ser Gly Val Thr Asn Gly Val Thr

115 120 125

Thr Gly Thr Pro Ile His Val Phe Val Pro Asn Thr Asp Gln Arg Gly

130 135 140

His Asp Tyr Ser Glu Met Ser Ile Ala Tyr Arg Pro Ser His Ala Asp

145 150 155 160

Ala Thr Tyr Asp Met Lys Tyr Gly Ile Arg Ala Val Glu Gly Gly Gly

165 170 175

Arg Ser Ser Ala Arg Glu Thr Ile Gly Arg Val Ala Ala Gly Ala Val

180 185 190

Ala Lys Lys Ile Leu Lys Glu Leu Ala Gly Thr Glu Val Leu Ala Tyr

195 200 205

Val Ser Gln Val Tyr Lys Val Val Leu Pro Glu Gly Val Val Asp His

210 215 220

Glu Thr Leu Ser Met Glu Gln Ile Glu Ser Asn Ile Val Arg Cys Pro

225 230 235 240

Asp Pro Glu Tyr Ala Glu Lys Met Ile Ala Ala Ile Asp Ala Val Arg

245 250 255

Val Arg Gly Glu Ser Ile Gly Gly Val Val Thr Cys Ile Val Lys Asn

260 265 270

Cys Pro Pro Gly Leu Gly Ser Pro Val Phe Asp Lys Leu Glu Ala Glu

275 280 285

Phe Ala Lys Ala Val Leu Ser Leu Pro Ala Ser Lys Gly Phe Glu Ile

290 295 300

Gly Ser Gly Phe Gly Gly Thr Phe Leu Thr Gly Ser Glu His Asn Asp

305 310 315 320

Pro Phe Tyr Leu Asp Glu Asn Gly Arg Ile Arg Thr Val Thr Asn Arg

325 330 335

Ser Gly Gly Ile Gln Gly Gly Ile Ser Asn Gly Glu Val Ile Ser Met

340 345 350

Arg Val Ala Phe Lys Pro Thr Ala Thr Ile Gly Lys Lys Gln Asn Thr

355 360 365

Val Thr Arg Asp Lys Lys Glu Val Glu Leu Ile Ala Arg Gly Arg His

370 375 380

Asp Pro Cys Val Val Pro Arg Ala Val Pro Met Val Glu Ala Met Val

385 390 395 400

Ala Leu Val Leu Met Asp Gln Leu Met Ala Gln His Gly Gln Cys Asn

405 410 415

Leu Phe Pro Ile Asn Pro Asp Leu Gln Ser Pro Ile Glu Pro Lys Val

420 425 430

Gly Val Ser Lys Thr Thr Val

435

<210> 3

<211> 23

<212> DNA

<213> cucumber (Cucumis sativus L.)

<400> 3

ccagaaccga aggcttttct gga 23

<210> 4

<211> 23

<212> DNA

<213> cucumber (Cucumis sativus L.)

<400> 4

ccaagctttc cttttccgcc gtt 23

Claims

1. A cucumber collateral sprouting regulation gene is characterized in that the regulation gene is a cucumber CsCS gene, and the nucleotide sequence is shown as SEQ ID NO. 1.

2. The cucumber collateral germination regulator gene of claim 1, wherein the amino acid sequence of the protein is as shown in SEQ ID No. 2.

3. Use of the cucumber collateral germination regulator gene as claimed in claim 1 for inhibiting germination of cucumber collateral.

4. Use of the cucumber collateral germination regulator gene as defined in claim 1 for screening cucumber varieties with low collateral germination.

5. A cucumber plant type improvement method with less lateral branch germination is characterized in that cucumber CsCS genes are silenced or knocked out, and the nucleotide sequence of the cucumber CsCS genes is shown as SEQ ID No. 1.

6. The cucumber plant type improving method according to claim 5, wherein a recombinant CRISPR vector for knocking out a cucumber CsCS gene is constructed, and the constructed recombinant CRISPR vector is transferred into cucumber by adopting an agrobacterium-mediated method to obtain a transgenic cucumber with improved plant type.

7. The method for improving the plant type of cucumber as claimed in claim 6, wherein, in the knockout, the target for the CsCS gene of cucumber comprises two sequences:

(1)CCAGAACCGAAGGCTTTTCTGGA；

(2)CCAAGCTTTCCTTTTCCGCCGTT。

8. the cucumber plant type improvement method as claimed in claim 7, wherein the sequences aiming at two targets are transferred into a vector PU6gRNAcas9 to obtain the recombinant CRISPR vector.