CN113969322B - A set of SNP core sites, primers and high-throughput purity identification methods for identifying the purity of corn hybrids - Google Patents

Abstract

The present invention provides a set of SNP core sites, primers and high-throughput purity identification methods for identifying the purity of corn hybrids, and belongs to the field of genetic engineering technology. The SNP core sites include No. 8974336 and No. 1 of maize chromosome 1. 20 core sites including chromosome 289408285. The purity of corn hybrids can be identified using the SNP sites provided by the present invention.

Description

A set of SNP core sites, primers and high-throughput identification to identify the purity of corn hybrids Purity method

Technical field

The invention belongs to the technical field of genetic engineering, and in particular relates to a set of SNP core sites, primers and purity identification methods for identifying the purity of corn hybrids.

Background technique

The purity of corn hybrids is one of the key factors affecting field yield, product quality and farmers' income. Therefore, the purity identification of corn hybrids is an important means to control the quality of corn seeds, especially the detection of self-crossed seedlings in hybrids. It provides important basis for quality self-control of seed companies, government market monitoring and other aspects.

Currently, the methods used to identify the purity of corn hybrids mainly include field plot identification method, salt-soluble protein method and SSR molecular marker method. Field planting identification is currently a widely used purity identification method, and it is also marked in the inspection procedures as the most accurate identification method. However, this method has some problems, mainly including the following aspects. First, the identification cycle is long, and you need to wait for a planting cycle to get the results. Purity problems cannot be discovered in time and economic losses can be minimized. Second, the results are easily affected by environmental factors. Weak and diseased strains caused by uneven soil fertility or pests and diseases are easily confused with inbred strains, resulting in wrong or missed judgments, which ultimately affects the purity results. Since the suitable planting ecological zones of corn varieties are different, if the planting identification is not in the suitable ecological zone of the variety, it is likely to cause large changes in the phenotype of the variety, making the determination more difficult. Third, the requirements for inspectors are high and they are easily affected by personnel factors. Inspectors need to fully understand the characteristics of different varieties and their differences from parents and similar varieties. Inspectors are required to have rich field identification experience.

The salt-soluble protein method is currently widely used in the purity identification of corn varieties because of its speed and simplicity. However, it also has some problems. Protein electrophoresis cannot find parental differences in some varieties or cannot distinguish self-crossed seedlings, and cannot identify all varieties. Molecular marker identification methods such as SSR cannot meet the high-throughput detection needs of samples, especially the short-term needs for purity identification of a large number of varieties during the period from seed production to market sales.

For hybrid purity identification, there is a need for short-term purity identification of a large number of varieties from seed production to market sales. Therefore, it is of great significance to explore a set of high-throughput solutions that are efficient, accurate and suitable for the purity identification of most corn hybrids on the market. Significance.

Contents of the invention

In view of this, the purpose of the present invention is to provide a set of SNP core sites, primers and high-throughput purity identification methods for identifying the purity of corn hybrids. The sites provided by the present invention can be used to identify the purity of corn hybrids.

In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

The invention provides a set of SNP core sites for identifying the purity of corn hybrids, including corn chromosome 1 at position 8974336, chromosome 1 at position 289408285, chromosome 2 at position 109563976, chromosome 2 at position 186339948, and chromosome 3. No. 27775731 of chromosome 3, No. 118083714 of chromosome 3, No. 20077010 of chromosome 4, No. 128874466 of chromosome 4, No. 13402375 of chromosome 5, No. 204879476 of chromosome 5, No. 39822979 of chromosome 6, No. 141476300, chromosome 7, 126677146, chromosome 7, 15521714, chromosome 8, 20978845, chromosome 8, 118299376, chromosome 9, 104695670, chromosome 9, 127197714, chromosome 10, 39960289 and chromosome 10, position 109396730.

The present invention also provides a set of primers for amplifying the SNP core site described in the above technical solution, and the nucleotide sequences of the primers are shown in SEQ ID Nos. 1 to 60.

Preferably, the amplified nucleotide sequence at position 8974336 of maize chromosome 1 is shown in SEQ ID No. 1 to 3;

The amplified nucleotide sequence at position 289408285 of maize chromosome 1 is shown in SEQ ID No. 4 to 6;

The amplified nucleotide sequence at position 109563976 of maize chromosome 2 is shown in SEQ ID No. 7 to 9;

The amplified nucleotide sequence at position 186339948 of maize chromosome 2 is shown in SEQ ID No. 10-12;

The amplified nucleotide sequence at position 27775731 of maize chromosome 3 is shown in SEQ ID No. 13-15;

The amplified nucleotide sequence at position 118083714 of maize chromosome 3 is shown in SEQ ID No. 16-18;

The amplified nucleotide sequence at position 20077010 of maize chromosome 4 is shown in SEQ ID No. 19-21;

The amplified nucleotide sequence at position 128874466 of maize chromosome 4 is shown in SEQ ID No. 22 to 24;

The amplified nucleotide sequence at position 13402375 of maize chromosome 5 is shown in SEQ ID No. 25-27;

The amplified nucleotide sequence at position 204879476 of maize chromosome 5 is shown in SEQ ID No. 28-30;

The amplified nucleotide sequence at position 39822979 of maize chromosome 6 is shown in SEQ ID No. 31 to 33;

The amplified nucleotide sequence at position 141476300 of maize chromosome 6 is shown in SEQ ID No. 34-36;

The amplified nucleotide sequence at position 126677146 of maize chromosome 7 is shown in SEQ ID No. 37~39;

The amplified nucleotide sequence at position 15521714 of maize chromosome 7 is shown in SEQ ID No. 40-42;

The amplified nucleotide sequence at position 20978845 of maize chromosome 8 is shown in SEQ ID No. 43~45;

The amplified nucleotide sequence at position 118299376 of maize chromosome 8 is shown in SEQ ID No. 46~48;

The amplified nucleotide sequence at position 104695670 of maize chromosome 9 is shown in SEQ ID No. 49-51;

The amplified nucleotide sequence at position 127197714 of maize chromosome 9 is shown in SEQ ID No. 52~54;

The amplified nucleotide sequence at position 39960289 of maize chromosome 10 is shown in SEQ ID No. 55-57;

The amplified nucleotide sequence at position 109396730 of maize chromosome 10 is shown in SEQ ID No. 58-60.

The invention also provides a method for high-throughput identification of the purity of corn hybrids using the primers described in the above technical solution, which includes the following steps:

1) Extract the DNA of the corn material, and perform PCR using the primers described in the above technical solution;

2) Collect the original fluorescence signals and perform genotyping. Import the obtained typing results into the SNP database management system to remove non-complementary and genetically unstable sites in the parents, count the results of at least two sites, and calculate the purity of the corn.

Preferably, the corn in step 1) includes corn kernels, seedlings or leaves.

Preferably, each 1 μL of the PCR system in step 1) includes: 20 ng of dried DNA, 0.5 μL of 2×KASP PCR master mix, 0.486 μL of deionized water and 0.014 μL of primer working solution.

Preferably, each 3 μL of the PCR system in step 1) includes: 1.45 μL DNA, 1.5 μL 2×KASP PCR master mix and 0.05 μL primer working solution.

Preferably, each 10 μL of the PCR system in step 1) includes: 1.5 μL DNA, 5 μL 2×KASP PCR master mix, 3.36 μL deionized water and 0.14 μL primer working solution.

Preferably, the concentration of the upstream primer in the primer working solution is 12 μmol/L, and the concentration of the downstream primer is 30 μmol/L.

Preferably, the PCR program includes: 94°C for 15min; 94°C for 20s, 10 cycles of 61-55°C for 1min; and 94°C for 20s, 55°C for 60s, for 30 cycles.

The invention provides a set of SNP core sites for identifying the purity of corn hybrids, including corn chromosome 1 at position 8974336, chromosome 1 at position 289408285, chromosome 2 at position 109563976, chromosome 2 at position 186339948, and chromosome 3. No. 27775731 of chromosome 3, No. 118083714 of chromosome 3, No. 20077010 of chromosome 4, No. 128874466 of chromosome 4, No. 13402375 of chromosome 5, No. 204879476 of chromosome 5, No. 39822979 of chromosome 6, No. 141476300, chromosome 7, 126677146, chromosome 7, 15521714, chromosome 8, 20978845, chromosome 8, 118299376, chromosome 9, 104695670, chromosome 9, 127197714, chromosome 10, 39960289 and chromosome 10, position 109396730. The purity of corn hybrids can be determined by using the sites provided by the present invention.

Description of the drawings

Figure 1 shows the typing effect of the test site (MG279), a is the typing effect of CTAB method, and b is the typing effect of quick extraction method;

Figure 2 is a comparison chart of the complementary genotype ratios of the sample's parents. The abscissa is the order of the samples from low to high according to the 20-site parental complementation rate. The ordinate is the sample's parent complementary genotype ratio;

Figure 3 is a statistical diagram of the sample's parental complementary genotype ratio intervals. The bar graph represents the number of samples in the interval for each 10% increase in the heterozygosity rate.

Detailed ways

The invention provides a set of SNP core sites for identifying the purity of corn hybrids, including corn chromosome 1 at position 8974336, chromosome 1 at position 289408285, chromosome 2 at position 109563976, chromosome 2 at position 186339948, and chromosome 3. No. 27775731 of chromosome 3, No. 118083714 of chromosome 3, No. 20077010 of chromosome 4, No. 128874466 of chromosome 4, No. 13402375 of chromosome 5, No. 204879476 of chromosome 5, No. 39822979 of chromosome 6, No. 141476300, chromosome 7, 126677146, chromosome 7, 15521714, chromosome 8, 20978845, chromosome 8, 118299376, chromosome 9, 104695670, chromosome 9, 127197714, chromosome 10, 39960289 and chromosome 10, position 109396730.

The present invention also provides a set of primers for amplifying the SNP core site described in the above technical solution, and the nucleotide sequences of the primers are shown in SEQ ID Nos. 1 to 60.

In the present invention, the amplified nucleotide sequence at position 8974336 of maize chromosome 1 is shown in SEQ ID No. 1 to 3; the amplified nucleotide sequence at position 289408285 of maize chromosome 1 is shown in SEQ ID No. 4. ~6 is shown; the amplified nucleotide sequence at position 109563976 of maize chromosome 2 is shown in SEQ ID No. 7~9; the amplified nucleotide sequence at position 186339948 of maize chromosome 2 is shown in SEQ ID No. 10 ~12; the amplified nucleotide sequence at position 27775731 of maize chromosome 3 is shown in SEQ ID No. 13~15; the amplified nucleotide sequence at position 118083714 of maize chromosome 3 is shown in SEQ ID No. 16 ~18; the amplified nucleotide sequence at position 20077010 of maize chromosome 4 is shown in SEQ ID No. 19~21; the amplified nucleotide sequence at position 128874466 of maize chromosome 4 is shown in SEQ ID No. 22 ~24; the amplified nucleotide sequence at position 13402375 of maize chromosome 5 is shown in SEQ ID No. 25~27; the amplified nucleotide sequence at position 204879476 of maize chromosome 5 is shown in SEQ ID No. 28 ~30; the amplified nucleotide sequence at position 39822979 of maize chromosome 6 is shown in SEQ ID No. 31~33; the amplified nucleotide sequence at position 141476300 of maize chromosome 6 is shown in SEQ ID No. 34 ~36 is shown; the amplified nucleotide sequence at position 126677146 of maize chromosome 7 is shown in SEQ ID No. 37~39; the amplified nucleotide sequence at position 15521714 of maize chromosome 7 is shown in SEQ ID No. 40~ 42; the amplified nucleotide sequence at position 20978845 of maize chromosome 8 is shown in SEQ ID No. 43~45; the amplified nucleotide sequence at position 118299376 of maize chromosome 8 is shown in SEQ ID No. 46~ 48; the amplified nucleotide sequence at position 104695670 of maize chromosome 9 is shown in SEQ ID No. 49~51; the amplified nucleotide sequence at position 127197714 of maize chromosome 9 is shown in SEQ ID No. 52~ 54; the amplified nucleotide sequence at position 39960289 of maize chromosome 10 is shown in SEQ ID No. 55~57; the amplified nucleotide sequence at position 109396730 of maize chromosome 10 is shown in SEQ ID No. 58~60 shown.

In the present invention, the nucleotide sequence of the primer is specifically shown in Table 1.

Table 1 Maize purity identification SNP core site list and primer sequences

In the present invention, it is preferred to connect the FAM fluorescence corresponding linker sequence to the 5' end of the forward primer 1; to connect the HEX fluorescence corresponding linker sequence to the 5' end of the forward primer 2.

The invention also provides a method for high-throughput identification of the purity of corn hybrids using the primers described in the above technical solution, which includes the following steps:

1) Extract the DNA of the corn material, and perform PCR using the primers described in the above technical solution;

2) Collect the original fluorescence signals and perform genotyping. Import the obtained typing results into the SNP database management system to remove non-complementary and genetically unstable sites in the parents, count the results of at least two sites, and calculate the purity of the corn.

In this application, the corn preferably includes corn kernels, seedlings or leaves. The present invention has no special limitations on the method for extracting corn DNA. Conventional methods for extracting plant DNA can be used. In the specific embodiments of the present invention, it is particularly preferred to use an improved DNA rapid extraction method for extraction.

In the present invention, each 1 μL of the PCR system preferably includes: 20 ng of dried DNA, 0.5 μL of 2×KASP PCR master mix, 0.486 μL of deionized water, and 0.014 μL of primer working solution. In the present invention, each 3 μL of the PCR system preferably includes: 1.45 μL DNA, 1.5 μL 2×KASP PCR master mix and 0.05 μL primer working solution. In the present invention, each 10 μL of the PCR system preferably includes: 1.5 μL DNA, 5 μL 2×KASP PCR master mix, 3.36 μL deionized water and 0.14 μL primer working solution. In the present invention, the concentration of the upstream primer in the primer working solution is preferably 12 μmol/L, and the concentration of the downstream primer is preferably 30 μmol/L. In the present invention, the PCR program preferably includes: 94°C for 15 min; 94°C for 20 s, 10 cycles of 61-55°C for 1 min; and 30 cycles of 94°C for 20 s, 55°C for 60 s.

In the present invention, the Pherastar fluorescence scanner is preferably used to collect original fluorescence signals. The present invention preferably uses Kraken (v16.3.16.16288) software for genotyping. The present invention preferably imports the typing results into the SNP database management system (V1.0.0, software registration number: 2018SR043088) to analyze the corn purity.

The technical solutions provided by the present invention will be described in detail below with reference to the examples, but they should not be understood as limiting the protection scope of the present invention.

Example 1

Determination of core primers for purity identification of corn hybrids

1. Experimental samples: 12 groups of triplet samples of test materials (Table 2).

Table 2 Corn triplet sample information table

serial number hybrid maternal parent Paternal parent 1 Xianyu 335 PH6WC PH4CV 2 Zhengdan958 Zheng 58 Chang 7-2 3 Agricultural University 108 X178 Huang C 4 Ludan 981 Qi 319 Lx9801 5 Shen Dan 16 K12 Shen 137 6 Dongdan 60 A801 Dan 598 7 Danyu 39 C8605-2 Dan 598 8 Mid lane number 2 Mo17 Since 330 9 Tuck single 13 tuck478 Dan 340 10 SC704 B73 Mo17 11 Jingke Nuo 2000 Jingnuo 6 Bai Nuo 6 12 Nonghua 101 NH60 S121

2. Nucleic acid extraction: Triplet samples were extracted from mixed strains using the modified CTAB method. Anonymous hybrid samples were extracted from individual strains using an improved DNA rapid extraction method (K-Mate DNA extraction kit, LGC Genomic). Add 100 μL 1* extraction solution to the microplate, 95°C for 15 min, place at 4°C for 10 min, and add 100 μL 1*. Buffer, mix at 1000rpm for 1 minute, centrifuge at 2500rpm for 30s and let stand. Aspirate an appropriate amount of supernatant, add 5 times of deionized water to prepare a working solution for later use.

3. Purity candidate sites and primer design: Based on the SNP fingerprint data of 384 SNP sites in 335 nationally approved corn hybrid standard samples, the heterozygosity rate and minimum allele frequency (MAF, Minor Allele Frequency) of each site were calculated. , polymorphic information content (PIC, Polymorphic Information Content) and other parameters, 60 sites with even distribution on the chromosome and good polymorphism were selected as purity candidate sites (Table 3). Design and synthesize KASP primers from 60 candidate sites, add the linker sequence of FAM or HEX fluorophore to the 5' end of the two forward primer sequences, and mix and prepare the upstream primer at 12 μmol/L and the downstream primer at 30 μmol/L. Prepare primer working solution for later use.

Table 3 Corn Purity Identification SNP Candidate Site Information Table

4. PCR reaction system: 20ng dried DNA, 0.5μL 2×KASP PCR master mix (UK, LGC Genomic, 1536 format, standard content ROX), 0.486μL deionized water, 0.014μL primer working solution. Reaction program: 94°C for 15min; 94°C for 20s, 10 cycles of 61-55°C for 1min; 94°C for 20s, 55°C for 60s, 30 cycles.

5. Fluorescence, data collection and analysis: Use Pherastar fluorescence scanner to collect original fluorescence signals, Kraken (v16.3.16.16288) software for genotyping, and import the typing results into the SNP database management system (V1.0.0, software registration number : 2018SR043088) to analyze sample purity. SNP comparison statistical tool software (V1.0, software registration number: 2018SR026743) was used to calculate site heterozygosity rate, MAF, PIC and other parameters.

6. Test results: Based on the corn 384 SNP basic locus combination, a set of core locus combinations suitable for the purity identification of corn hybrids was screened and determined based on the complementary discrimination ability of the loci's parents, test typing effect, uniform distribution of staining and other conditions. The specific screening process is: (1) Determine candidate site combinations: Calculate site parent complementation rate, polymorphism and other parameters based on the fingerprint data of 335 national-approved variety basic sites. The screening condition is that the site parent complementation rate is higher than 40 %, MAF≥0.3, PIC≥0.3, thus 60 candidate sites were preferred. (2) KASP primer evaluation: KASP primers were designed and synthesized for candidate sites, and 12 groups of corn hybrids and their parental triplet materials were used for testing. Among them, 57 primers can be divided into three close groups. The typing results are consistent with the expected results, consistent with Mendelian inheritance laws, and the results of repeated experiments are consistent (a in Figure 1). (3) Evaluation of rapid DNA extraction method: In order to shorten the DNA preparation time and improve the efficiency of purity identification, the rapid extraction method was further used to test the sites that performed well in the CTAB method. A total of 48 sites were tested using the CTAB method and the rapid extraction method. Both methods can be clearly divided into three closely classified sites, and the sites are consistent with the expected classification results (b in Figure 1). (4) Determine the core sites for purity identification: Based on the site discrimination ability and uniform distribution of chromosomes, 20 sites were selected as the core sites for purity identification (Table 1).

Example 2

SNP core site discrimination ability verification

1. Experimental samples: The test materials are 335 fingerprint data of nationally approved corn varieties from 1984 to 2013 (list omitted).

2. Nucleic acid extraction: Use the modified CTAB method (the method is the same as Example 1) to extract mixed strains, and place at least one blank control for every 95 samples.

3. Primers, reaction system and reaction procedures: same as Example 1.

4. Fluorescence, data collection and analysis: same as Example 1.

5. Test results: 83.6% of the samples had a higher parent-complementary genotype ratio at the core locus than at the basic locus (Figure 2). Among the 335 hybrid samples, 99.7% of the samples had a parental complementary genotype ratio exceeding 10%, and multiple parental complementary sites can be screened for purity identification (Figure 3). Based on various parameter descriptions, the 20 purity identification core sites are significantly better than the basic sites and candidate sites, which also proves that these 20 core site combinations can be effectively used for purity identification of most corn hybrids currently in the domestic market. .

Example 3

Purity identification of test samples using corn purity core sites

1. Experimental samples: The test samples include several Jingke 968 seeds and Jingke 968 parent seeds.

2. Nucleic acid extraction: Use an improved DNA rapid extraction method (K-Mate DNA extraction kit, LGC Genomic) to extract a single strain and prepare a DNA working solution for later use. At least 2 copies of parental DNA and a blank control are placed for every 93 individual plants.

3. Primers, reaction system and reaction procedures: same as Example 1.

4. Fluorescence, data collection and analysis: same as Example 1.

5. Remove the non-complementary and genetically unstable sites between the parents, count the results of at least two sites, and calculate the purity of the sample.

6. Test results: The test sample showed parental complementation genotyping at 15 of the 20 core sites. Four sites, including MG072, MG135, MG175, and MG215, were selected for purity identification. Among the 110 individuals tested, 1 inbred strain and 2 heterotypic strains were detected, and the purity of the test sample was 97.3%. According to national standards, the purity of single-cross corn varieties is not less than 96.0%. The experimental results show that the purity of the test sample meets the standards. The above are only preferred embodiments of the present invention. It should be noted that those skilled in the art can make several improvements and modifications without departing from the principles of the present invention. These improvements and modifications can also be made. should be regarded as the protection scope of the present invention.

sequence list

<110> Beijing Academy of Agriculture and Forestry Sciences

<120> A set of SNP core sites, primers and high-throughput purity identification methods for identifying the purity of corn hybrids

<160> 180

<170> SIPOSequenceListing 1.0

<210> 1

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 1

ggaactgtgc gtagttcctg aga 23

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 2

gaactgtgcg tagttcctga gg 22

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 3

tgatcgagga ggacccctgc aa 22

<210> 4

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 4

ccgtatcatt tagtgcatca gaacc 25

<210> 5

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 5

ccgtatcatt tagtgcatca gaact 25

<210> 6

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 6

gagaaatgca atgcatcaga tccggat 27

<210> 7

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 7

gactaaacac actcactttc ctgc 24

<210> 8

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 8

ctgactaaacacactcactttcctga 26

<210> 9

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 9

aatcggtgat gagtgagtgt ctaactaaa 29

<210> 10

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 10

gagttgtgct ctgatccacc ct 22

<210> 11

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 11

agttgtgctc tgatccaccc g 21

<210> 12

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 12

tattgcggca ttaaacaagg gaaaggaaa 29

<210> 13

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 13

acgtctgact tgcacgaaac gg 22

<210> 14

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 14

gacgtctgac ttgcacgaaa cga 23

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 15

ctccggagatgatctcccgt aattt 25

<210> 16

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 16

caattcctcc cctgcaattt caacaa 26

<210> 17

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 17

aattcctccc ctgcaatttc aacac 25

<210> 18

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 18

cagcctggtc gttgcttctg taatt 25

<210> 19

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 19

cgcatcctaa taacataatt actcacg 27

<210> 20

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 20

acgcatccta ataacataat tactcact 28

<210> 21

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 21

gcgaaacggg gtgttagata gagtt 25

<210> 22

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 22

agcttagcag agctgcatct g 21

<210> 23

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 23

ctagcttagc agagctgcat ctt 23

<210> 24

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 24

cccacgtcac ctagataagc caaaa 25

<210> 25

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 25

gatatttctg caactaaaca tggcaag 27

<210> 26

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 26

ggatatttct gcaactaaac atggcaaa 28

<210> 27

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 27

atactggggt tgtggggata ggatt 25

<210> 28

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 28

acttctccat cctcttccaa catatta 27

<210> 29

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 29

cttctccatc ctcttccaac atattg 26

<210> 30

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 30

agctgtccac catcagtact ggaat 25

<210> 31

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 31

agatggcatt gtgatctgtg caca 24

<210> 32

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 32

gatggcattg tgatctgtgc acg 23

<210> 33

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 33

agccgaagga ttgatcctcc tcat 24

<210> 34

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 34

gaaacatgaa tgccctaaat ccttcg 26

<210> 35

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 35

agaaacatga atgccctaaa tccttct 27

<210> 36

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 36

attatgttca ccaagtatcc agatggcat 29

<210> 37

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 37

ggttccatgg ctacctgaca agt 23

<210> 38

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 38

gttccatggc tacctgacaa gg 22

<210> 39

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 39

taggagctag ccaagagcct acta 24

<210> 40

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 40

aacgtatgag atgaactcac cagaaa 26

<210> 41

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 41

acgtatgaga tgaactcacc agaag 25

<210> 42

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 42

ctccgccgct ggtggagcta 20

<210> 43

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 43

gacctgaaat gcttggcgag tca 23

<210> 44

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 44

acctgaaatg cttggcgagt cc 22

<210> 45

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 45

gcaggagcct tagcgtggct at 22

<210> 46

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 46

cctcagatct catctatgct gcc 23

<210> 47

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 47

cctcagatct catctatgct gct 23

<210> 48

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 48

cgtttccaca ttttctgaag gtttcacaa 29

<210> 49

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 49

aacacgagct ggttgatgga ttagt 25

<210> 50

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 50

cacgagctgg ttgatggatt agc 23

<210> 51

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 51

gcctctggta cgttagtttg cagtt 25

<210> 52

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 52

tactgaccga gcgatgctgc t 21

<210> 53

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 53

ctgaccgagcgatgctgcc 19

<210> 54

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 54

cgctgatggt cacagaaaca tcgtt 25

<210> 55

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 55

gaagcaatcc ttccggagga atg 23

<210> 56

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 56

gaagcaatcc ttccggagga ata 23

<210> 57

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 57

gaatgtgcag attggatttg agggataaa 29

<210> 58

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 58

ggttgacatg agacttgcag aga 23

<210> 59

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 59

ggttgacatg agacttgcag agg 23

<210> 60

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 60

tcgggaagcc atacttcaca tgcat 25

<210> 61

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 61

ccggagctgg cttctgaatc aa 22

<210> 62

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 62

cggagctggc ttctgaatca g 21

<210> 63

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 63

acatccccat cctggggagg aa 22

<210> 64

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 64

gagcgtcaac gacaaagcca agt 23

<210> 65

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 65

agcgtcaacg acaaagccaa gc 22

<210> 66

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 66

cctgttaggt tgtaagaatt gagccttat 29

<210> 67

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 67

ggagatgctc tacaagtttg tca 23

<210> 68

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 68

ggagatgctc tacaagtttg tcg 23

<210> 69

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 69

ccttcgagga ggccaaggac tt 22

<210> 70

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 70

ccatggtttt aaggaactat cgaaaga 27

<210> 71

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 71

catggtttta aggaactatc gaaagg 26

<210> 72

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 72

atcaatgtac tcccataagc agcaacttt 29

<210> 73

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 73

catcgaatgg ctgatcatgt tgcat 25

<210> 74

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 74

atcgaatggc tgatcatgtt gcac 24

<210> 75

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 75

ccattccctg tatgacagac acgat 25

<210> 76

<211> 20

<212> DNA

<213> Artificial Sequence

<400> 76

gcccctgcat tgtttgcagc 20

<210> 77

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 77

ctgcccctgc attgtttgca gt 22

<210> 78

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 78

gccactgcaa atccaaagaa tccgta 26

<210> 79

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 79

aggatcacaa tccatctgct gcaaa 25

<210> 80

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 80

gatcacaatc catctgctgc aac 23

<210> 81

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 81

cctgcagttg ctactgatag ttctcaa 27

<210> 82

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 82

atgtttctca ggacggtaat agtgat 26

<210> 83

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 83

gtttctcagg acggtaatag tgac 24

<210> 84

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 84

cccatccatt ccacatattc ggcaa 25

<210> 85

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 85

cggcctccat gcttgatgat g 21

<210> 86

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 86

ccggcctcca tgcttgatga ta 22

<210> 87

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 87

gtcggtcgag tcaaaattca ttttggat 28

<210> 88

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 88

attcgaactg ctgccttgac taatc 25

<210> 89

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 89

attcgaactg ctgccttgac taata 25

<210> 90

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 90

gcagcagtgactatccttctgaagaa 26

<210> 91

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 91

ccaatcaagg cggcaacata cc 22

<210> 92

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 92

accaatcaag gcggcaacat act 23

<210> 93

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 93

gcgttcatgt tcatggaagg ccaaa 25

<210> 94

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 94

attctgaatg taaaacttaa catgctgcta 30

<210> 95

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 95

ctgaatgtaa aacttaacat gctgctg 27

<210> 96

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 96

aagtccttcc aactttcagc ataagcaaa 29

<210> 97

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 97

ggttacacga ccaaatgagt accat 25

<210> 98

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 98

gttacacgac caaatgagtaccag 24

<210> 99

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 99

taggcagagc agccattgac aagta 25

<210> 100

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 100

tatcacttgt ggatctatat ctgtg 25

<210> 101

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 101

gctttatcact tgtggatcta tatctgtt 28

<210> 102

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 102

tgaacccaaa gcctcggtgt tcttt 25

<210> 103

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 103

atacagtgaa acagcttgca ctgga 25

<210> 104

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 104

cagtgaaaca gcttgcactg gg 22

<210> 105

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 105

ttaatttttg gaagagcttg cgttgggaa 29

<210> 106

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 106

agttacctgt catcgatctc tggat 25

<210> 107

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 107

acctgtcatc gatctctgga c 21

<210> 108

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 108

aaagccctct gacaatgctc cagta 25

<210> 109

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 109

cctctgtaag cgcagtactg gt 22

<210> 110

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 110

ctctgtaagc gcagtactgg c 21

<210> 111

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 111

aaattgctat gcaaacaggt tctggagta 29

<210> 112

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 112

gagctagtaa atattgttgt tgttcctc 28

<210> 113

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 113

agagctagta aatattgttg ttgttcctt 29

<210> 114

<211> 19

<212> DNA

<213> Artificial Sequence

<400> 114

cgccgacggg acgacggat 19

<210> 115

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 115

cataaacagt aggtttatcg ctgacataa 29

<210> 116

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 116

aaacagtagg tttatcgctg acatag 26

<210> 117

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 117

gtgataaccg atgcaaaatg ctgcttaat 29

<210> 118

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 118

ccaaaggata gcacatcttg gtg 23

<210> 119

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 119

gtccaaagga tagcacatct tggta 25

<210> 120

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 120

tgtcaaccgc atcctggcag ataat 25

<210> 121

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 121

gacgacgact ccatcgtgac c 21

<210> 122

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 122

gacgacgact ccatcgtgac a 21

<210> 123

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 123

tcaacccatg gctgctcaca tgtaa 25

<210> 124

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 124

ggcattctga tttgacagcc cac 23

<210> 125

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 125

ggcattctga tttgacagcc caa 23

<210> 126

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 126

tcctgattct gtacttgatt ggaccaaa 28

<210> 127

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 127

gcagctgaga aacaattgca aagtg 25

<210> 128

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 128

gcagctgaga aacaattgca aagta 25

<210> 129

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 129

gtactctcag atggttttgt gacatcaa 28

<210> 130

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 130

gtgctcgaac gaatcgacca g 21

<210> 131

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 131

cgtgctcgaa cgaatcgacc aa 22

<210> 132

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 132

catccatggc gaagctcatg aacaa 25

<210> 133

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 133

gtagcgtgtc tctacgctct g 21

<210> 134

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 134

atgtagcgtg tctctacgct ctt 23

<210> 135

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 135

cagcgcgtta cgacgaactc caa 23

<210> 136

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 136

cagcgacctc aagaagttga agtaa 25

<210> 137

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 137

agcgacctca agaagttgaa gtag 24

<210> 138

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 138

gtacgacatg cagtttgaca tcaagtat 28

<210> 139

<211> 30

<212> DNA

<213> Artificial Sequence

<400> 139

gaagctacta ttagcaatga tctatatgat 30

<210> 140

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 140

aagctactat tagcaatgat ctatatgac 29

<210> 141

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 141

acaggattga taaacattac ctgcaggaa 29

<210> 142

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 142

gatcgttgtc ttcacaaatg aagaatagt 29

<210> 143

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 143

cgttgtcttc acaaatgaag aatagc 26

<210> 144

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 144

gcgagatatt gaaagctagt ggtgcta 27

<210> 145

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 145

gaactaactg agtgttaaag gagctttat 28

<210> 146

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 146

aactaactga gtgttaaagg agcttag 27

<210> 147

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 147

ccttgacaca accgctctcc ttaaa 25

<210> 148

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 148

aaccattccc ttcatacttc ttctct 26

<210> 149

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 149

accattccct tcatacttct tctcc 25

<210> 150

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 150

gggagtatct tttaggaaga tgtacagat 29

<210> 151

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 151

caatccaaag cagaaagaag ttgttct 27

<210> 152

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 152

aatccaaagc agaaagaagt tgttcc 26

<210> 153

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 153

ccaaaacagt gaagtgaccg ccat 24

<210> 154

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 154

caaagtggtg taaatggatg gatcg 25

<210> 155

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 155

caaagtggtg taaatggatg gatca 25

<210> 156

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 156

ttggacactc caggggatcc tata 24

<210> 157

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 157

gcctcacaca tccatatacg tagaa 25

<210> 158

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 158

cctcacacat ccatatacgt agag 24

<210> 159

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 159

cttccatgca tcgccctatg gatat 25

<210> 160

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 160

aacactcatg tctgctccag gg 22

<210> 161

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 161

aaacactcat gtctgctcca gga 23

<210> 162

<211> 29

<212> DNA

<213> Artificial Sequence

<400> 162

tcgatgtttt cgatcccaag ttcaacatt 29

<210> 163

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 163

ccacttctgc tcgtatgatc ttc 23

<210> 164

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 164

gccacttctg ctcgtatgat ctta 24

<210> 165

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 165

tcccgtaatc atctgctcgt ctgta 25

<210> 166

<211> 24

<212> DNA

<213> Artificial Sequence

<400> 166

ataccctctc caccagttgt tgat 24

<210> 167

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 167

accctctcca ccagttgttg ac 22

<210> 168

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 168

tcgcagggag gcgtcgttca a 21

<210> 169

<211> 27

<212> DNA

<213> Artificial Sequence

<400> 169

aaaagtgcag ttccttgctg ttcattt 27

<210> 170

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 170

aagtgcagtt ccttgctgtt cattg 25

<210> 171

<211> 28

<212> DNA

<213> Artificial Sequence

<400> 171

cccaatgagc aaaaagaata gcaccaaa 28

<210> 172

<211> 26

<212> DNA

<213> Artificial Sequence

<400> 172

tgttccgaat agcaagtgat ctcttt 26

<210> 173

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 173

gttccgaata gcaagtgatc tcttc 25

<210> 174

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 174

gggaaacctg cagaatgctg ttgat 25

<210> 175

<211> 22

<212> DNA

<213> Artificial Sequence

<400> 175

caagtgcgca gcaagccaaa ag 22

<210> 176

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 176

aaacaagtgc gcagcaagcc aaaat 25

<210> 177

<211> 25

<212> DNA

<213> Artificial Sequence

<400> 177

ccgttcttaa gcgctccatc ctttt 25

<210> 178

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 178

cacgaagctc tcgcgctctt c 21

<210> 179

<211> 21

<212> DNA

<213> Artificial Sequence

<400> 179

cacgaagctc tcgcgctctt t 21

<210> 180

<211> 23

<212> DNA

<213> Artificial Sequence

<400> 180

ggcatggagc ccctatcctt gat 23

Claims (8)

1. A set of primers for amplifying the SNP core site of corn hybrid purity, characterized in that the primer set is composed of primers shown in SEQ ID No. 1 to 60, Among them, the amplified nucleotide sequence at position 8974336 of maize chromosome 1 is shown in SEQ ID No. 1~3; The amplified nucleotide sequence at position 289408285 of maize chromosome 1 is shown in SEQ ID No. 4~6; The amplified nucleotide sequence at position 109563976 of maize chromosome 2 is shown in SEQ ID No. 7~9; The amplified nucleotide sequence at position 186339948 of maize chromosome 2 is shown in SEQ ID No. 10~12; The amplified nucleotide sequence at position 27775731 of maize chromosome 3 is shown in SEQ ID No. 13~15; The amplified nucleotide sequence at position 118083714 of maize chromosome 3 is shown in SEQ ID No. 16~18; The amplified nucleotide sequence at position 20077010 of maize chromosome 4 is shown in SEQ ID No. 19~21; The amplified nucleotide sequence at position 128874466 of maize chromosome 4 is shown in SEQ ID No. 22~24; The amplified nucleotide sequence at position 13402375 of maize chromosome 5 is shown in SEQ ID No. 25~27; The amplified nucleotide sequence at position 204879476 of maize chromosome 5 is shown in SEQ ID No. 28~30; The amplified nucleotide sequence at position 39822979 of maize chromosome 6 is shown in SEQ ID No. 31~33; The amplified nucleotide sequence at position 141476300 of maize chromosome 6 is shown in SEQ ID No. 34~36; The amplified nucleotide sequence at position 126677146 of maize chromosome 7 is shown in SEQ ID No. 37~39; The amplified nucleotide sequence at position 15521714 of maize chromosome 7 is shown in SEQ ID No. 40~42; The amplified nucleotide sequence at position 20978845 of maize chromosome 8 is shown in SEQ ID No. 43~45; The amplified nucleotide sequence at position 118299376 of maize chromosome 8 is shown in SEQ ID No. 46~48; The amplified nucleotide sequence at position 104695670 of maize chromosome 9 is shown in SEQ ID No. 49~51; The amplified nucleotide sequence at position 127197714 of maize chromosome 9 is shown in SEQ ID No. 52~54; The amplified nucleotide sequence at position 39960289 of maize chromosome 10 is shown in SEQ ID No. 55~57; The amplified nucleotide sequence at position 109396730 of maize chromosome 10 is shown in SEQ ID No. 58~60. 2. A method for high-throughput identification of the purity of corn hybrids using the primer set of claim 1, characterized in that it includes the following steps: 1) Extract the DNA of the corn material, and perform PCR using the primer set of claim 1 on the DNA; 2) Collect the original fluorescence signals and perform genotyping. Import the obtained typing results into the SNP database management system to remove non-complementary and genetically unstable sites in the parents, count the results of at least two sites, and calculate the purity of the corn. 3. The method according to claim 2, characterized in that the corn material in step 1) includes corn kernels, seedlings or leaves. 4. The method according to claim 2, characterized in that each 1 μL of the PCR system in step 1) includes: 20 ng of dried DNA, 0.5 μL of 2×KASP PCR master mix, 0.486 μL of deionized water and 0.014 μL. Primer working solution. 5. The method according to claim 2, characterized in that each 3 μL of the PCR system in step 1) includes: 1.45 μL DNA, 1.5 μL 2×KASP PCR master mix and 0.05 μL primer working solution. 6. The method according to claim 2, characterized in that each 10 μL of the PCR system in step 1) includes: 1.5 μL DNA, 5 μL 2×KASP PCR master mix, 3.36 μL deionized water and 0.14 μL primer working solution. 7. The method according to any one of claims 4 to 6, characterized in that the concentration of the upstream primer in the primer working solution is 12 μmol/L, and the concentration of the downstream primer is 30 μmol/L. 8. The method according to any one of claims 2 and 4 to 6, characterized in that the PCR program includes: 94°C for 15min; 94°C for 20 s, 61-55°C for 1 min for 10 cycles; 94°C 20 s, 55 ℃ 60 s, 30 cycles.