CN108359720A - The detection method of mutant and its application - Google Patents
The detection method of mutant and its application Download PDFInfo
- Publication number
- CN108359720A CN108359720A CN201810340639.2A CN201810340639A CN108359720A CN 108359720 A CN108359720 A CN 108359720A CN 201810340639 A CN201810340639 A CN 201810340639A CN 108359720 A CN108359720 A CN 108359720A
- Authority
- CN
- China
- Prior art keywords
- gene
- probe
- seq
- sequence
- detection method
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Molecular Biology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Immunology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Microbiology (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Botany (AREA)
- Mycology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a kind of detection method of mutant and its applications, it is related to biotechnology, the detection method of the mutant includes expanding the mutation target gene and reference gene of sample to be tested, when the content of the content of the amplified production of mutation target gene and the amplified production of reference gene differs, sample to be tested is Positive mutants body.This method need to only expand reference gene and target gene, when target gene mutation causes target gene to be unable to Successful amplification, to which the amplified production of target gene cannot be obtained, therefore mutation target gene will change relative to the content of the amplified production of reference gene, this method rapid sensitive, at low cost and flux is big, and application of the above-mentioned detection method provided by the invention in screening-gene editor's positive plant can be widely applied to the transgenic positive T of various plants0For the screening of gene editing plant.
Description
Technical field
The present invention relates to biotechnology, the detection method more particularly, to a kind of mutant and its application.
Background technology
It is easy to operate in recent years, gene editing technology is because at low cost, efficient, the advantages that not introducing foreign gene
Become most popular one of the technology of current molecular biology field.Currently, scientist has cultivated a large amount of gene
Edit plant, animal.However, conventional method and means that gene editing individual is screened and identified are all time-consuming and laborious, it is anxious
It need to develop quickly, sensitive, high-throughput screening and identification method.
Up to the present, the detection method of gene editing technology mainly has：PCR combines limitation enzyme cutting method, T7 endonucleases
Enzyme I (T7E1) method, high-resolution solubility curve (HRM) analytic approach and PCR product direct Sequencing etc..However, mentioned above
These modes have certain limitation, for example expend time and labour, or need expensive equipment.PCR/RE is tested
The mutant mode for screening CRISPR-CAS9 inductions is simple and sensitivity is higher, but is constrained to target sequence and nearby limits
Enzyme site.The detection method of T7E1 mispairing enzymes is widely used, and suitable for any target and can be identified sequence and be disappeared
Change unmatched heteroduplex DNA, however its detection sensitivity be difficult compared with PCR/RE, both methods both elapsed time and
And it is complicated for operation.High-resolution solubility curve (HRM) analytic approach has been distinguished based on melting temperature difference pcr amplification product
Without mutation, such method can be successfully used in the screening of gene mutation, but be needed cost of equipment costliness, and this method
It is difficult to distinguish A-T, the mutation of G-C types.Therefore a kind of quick, sensitive, high-throughput screening and identification method is current people institute
It needs.
In view of this, special propose the present invention.
Invention content
The first object of the present invention is to provide a kind of screening technique of mutant, alleviates to exist in the prior art and lacks
The problem of one kind is quickly, sensitive, high-throughput screening and identification method；The second object of the present invention is the provision of a kind of above-mentioned
It is positive to alleviate screening-gene editor existing in the prior art for application of the detection method in screening-gene editor's positive plant
The technical problem that plant speed is slow and efficiency is low.
In order to solve the above technical problems, spy of the present invention adopts the following technical scheme that：
A kind of detection method of mutant, the mutant are obtained by gene editing, and the detection method includes amplification
The mutation target gene and reference gene of sample to be tested, when the expansion of the content and reference gene of the amplified production of mutation target gene
When the content of volume increase object differs, sample to be tested is Positive mutants body.
Further, the gene editing includes Zinc finger nuclease system, the nucleic acid enzyme system of activating transcription factor sample effect
System and CRISPR-cas system；
Preferably, the CRISPR-CAS systems are CRISPR-CAS9 systems.
Further, the detection method further include detect mutant type, the type include heterozygous mutation and
Homozygous mutation.
Further, it is that positive mutant is further sequenced that the detection method, which further includes by testing result, is determined prominent
Change mode.
Further, the amplification is fluorescent quantitative PCR.
Further, amplification is mutated target gene and reference gene respectively；
Preferably, a reference gene is at least expanded；
Preferably, a mutation target gene is at least expanded.
Further, in the PCR amplification region of pair of primers simultaneously two fluorescence probes of label, probe I with mutation target
Point gene combines, and probe II is combined with reference gene, and probe I uses different fluorescent markers respectively from probe II；
Preferably, probe I is marked using FAM；
Preferably, probe II is marked using HEX.
Further, mutation target gene uses 2 relative to the changes of contents of the amplified production of reference gene-△△CMethod point
Analysis.
A kind of application of above-mentioned detection method in screening-gene editor's positive plant.
Further, the gene editing positive plant includes rice, arabidopsis, corn and sorghum；
Preferably, the gene editing positive plant is rice TGW6 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.3；Probe II is marked using HEX,
With the sequence as shown in SEQ ID NO.4；
Preferably, test sample is waited for using the primer amplification rice with the sequence as shown in SEQ ID NO.1 and SEQ ID NO.2
Product；
Preferably, the gene editing positive plant is arabidopsis AT5G05570 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.7；Probe II is marked using HEX,
With the sequence as shown in SEQ ID NO.8；
Preferably, to be measured using the primer amplification arabidopsis with the sequence as shown in SEQ ID NO.5 and SEQ ID NO.6
Sample；
Preferably, the gene editing positive plant is sorghum SORBI_010G072000 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.11；Probe II is marked using HEX,
With the sequence as shown in SEQ ID NO.12；
Preferably, to be measured using the primer amplification sorghum with the sequence as shown in SEQ ID NO.9 and SEQ ID NO.10
Sample；
Preferably, the gene editing positive plant is corn Zm00001d038302 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.15；Probe II is marked using HEX,
With the sequence as shown in SEQ ID NO.16；
Preferably, to be measured using the primer amplification corn with the sequence as shown in SEQ ID NO.13 and SEQ ID NO.14
Sample.
A kind of application of above-mentioned detection method in screening-gene editor's positive plant；
Preferably, the gene editing positive plant includes rice, arabidopsis, corn and sorghum.
Compared with prior art, the present invention has the advantages that：
The detection method of mutant provided by the invention includes the mutation target gene and internal reference base of amplification sample to be tested
Cause, when the content of the content of the amplified production of mutation target gene and the amplified production of reference gene differs, sample to be tested
For mutant.This method need to only expand reference gene and target gene, since reference gene is not as whether target gene is mutated
And the mode of mutation changes, therefore reference gene has the function of demarcating mutant gene content.Target gene occurs
Mutation causes target gene to be unable to Successful amplification, to obtain the amplified production of target gene, therefore is mutated target gene
The content of amplified production relative to reference gene will change, you can to detect whether the target gene of sample occurs
Mutation.Application of the above-mentioned detection method provided by the invention in screening-gene editor's positive plant, can be widely applied to a variety of
The transgenic positive T of plant0For the screening of gene editing plant.
Description of the drawings
It, below will be to specific in order to illustrate more clearly of the specific embodiment of the invention or technical solution in the prior art
Embodiment or attached drawing needed to be used in the description of the prior art are briefly described, it should be apparent that, in being described below
Attached drawing is some embodiments of the present invention, for those of ordinary skill in the art, before not making the creative labor
It puts, other drawings may also be obtained based on these drawings.
Fig. 1 is the probe face principle schematic of the detection method for the mutant that the embodiment of the present invention 1 provides；
Fig. 2 is the probe face principle schematic of the detection method for the mutant that the embodiment of the present invention 1 provides；
Fig. 3 is the probe face principle schematic of the detection method for the mutant that the embodiment of the present invention 1 provides；
Homozygous mutant qPCR amplification fluorescent curves in the detection method for the mutant that Fig. 4 provides for the embodiment of the present invention 1；
The 2 of homozygous mutant amplified production in the detection method for the mutant that Fig. 5 provides for the embodiment of the present invention 1-△△CSide
The analysis result of method；
Heterozygous mutant qPCR amplification fluorescent curves in the detection method for the mutant that Fig. 6 provides for the embodiment of the present invention 1；
The 2 of heterozygous mutant amplified production in the detection method for the mutant that Fig. 7 provides for the embodiment of the present invention 1-△△CSide
The analysis result of method；
Unmutated sample qPCR amplification fluorescent curves in the detection method for the mutant that Fig. 8 provides for the embodiment of the present invention 1；
The 2 of unmutated sample amplification product in the detection method for the mutant that Fig. 9 provides for the embodiment of the present invention 1-△△CSide
The analysis result of method；
Figure 10 is the amplification curve of the control sample that the embodiment of the present invention 2 provides and 9 kinds of different mutation type FAM probes；
Figure 11 is the amplification curve of the control sample that the embodiment of the present invention 2 provides and 9 kinds of different mutation type HEX probes,
Each sample is repeated 3 times；
Figure 12 is the 2 of 2 amplified production of the embodiment of the present invention-△△CTThe numerical value that method calculates；
Figure 13 is the result for detecting rice mutant in the embodiment of the present invention 2 using T7E1 methods；
Figure 14 is the rice heterozygous mutation testing result that the embodiment of the present invention 3 provides；
Figure 15 is the testing result of the callus and wild type for the mutation that the embodiment of the present invention 4 provides；
Figure 16 is the detection knot that the various concentration that the embodiment of the present invention 4 provides mixes saltant type template and wild-type template
Fruit；
Figure 17 is the Arabidopsis Mutants the selection result that the embodiment of the present invention 5 provides；
Figure 18 is the sorghum mutant the selection result that the embodiment of the present invention 5 provides；
Figure 19 is the Maize mutant the selection result that the embodiment of the present invention 5 provides；
Figure 20 is screening-gene editor's plant flow chart that the embodiment of the present invention 6 provides.
Specific implementation mode
Technical scheme of the present invention is clearly and completely described below in conjunction with drawings and examples, it is clear that retouched
The embodiment stated is a part of the embodiment of the present invention, instead of all the embodiments.Based on the embodiments of the present invention, this field
The every other embodiment that those of ordinary skill is obtained without making creative work, belongs to protection of the present invention
Range.
The present invention provides a kind of detection method of mutant, the mutant is obtained by gene editing, the detection
Method include expand sample to be tested mutation target gene and reference gene, when mutation target gene amplified production content with
When the content of the amplified production of reference gene differs, sample to be tested is Positive mutants body.This method need to only expand reference gene
And target gene, since reference gene is as whether target gene be mutated and mutational formats change, internal reference
Gene has the function of demarcating mutant gene content.Target gene is caused to be unable to Successful amplification when target gene mutates,
To obtain the amplified production of target gene, therefore mutant, compared to wild type, mutation target gene is relative to internal reference
The content of the amplified production of gene will change, you can to detect whether the target gene of sample mutates.This hair
The bright mutant can be transfer-gen plant, cell or plasmid etc., since the detection method of the present invention directly expands base
Cause, therefore there is no limit the mutant form of the target gene of mutant of the present invention can be in target position to the form of mutant
The insertion for setting whole section of gene either lacks or the missing of number of base, the forms such as mutation.
In some optional embodiments of the invention, the gene editing includes Zinc finger nuclease system, transcriptional activation
Because of the nucleic acid enzyme system and CRISPR-cas system of increment effect.Its cardinal principle is all by sequence specific nuclease
(Sequence-specific nucleases, SSNs) special cutting DNA target site, generates DNA double chain fracture, induces DNA's
Damage repair mechanism, to realize the orientation editor to genome.Wherein most widely used is third generation gene editing technology
CRISPR-CAS9, the technology have at low cost, easy to operate, efficient, the low advantage of efficiency of missing the target, and become current
Most popular one of the technology of molecular biology field.
In one preferred embodiment, the CRISPR-CAS systems are CRISPR-CAS9 systems.CRISPR-
CAS9 systems are made of CRISPR sequences and Cas gene families, wherein CRISPR by a series of highly conserved repetitive sequences with
The spaced composition of intervening sequence, there are highly conserved CRISPR related genes, these genes to compile near CRISPR sequences
The albumen of code has the function of nuclease, and specific cutting can be carried out to DNA sequence dna.According to Cas gene core element sequences
Difference, CRISPR-CAS immune systems are divided into 3 type of I type, II type and III type, I type and III type CRISPR-CAS siberian crabapples
System needs the complex cutting DNA double-strand that multiple Cas albumen are formed, and II types system only needs 1 Cas9 albumen.CRISPR-
CAS9 gene editings technology can target editor's any type gene, and editor's target gene needs sgRNA guiding Cas9DNA fixed
Point shearing.The base pairing of sgRNA and target sequence DNA, Cas9 albumen are combined to form RNA- protein complexes with sgRNA, altogether
With the function of completing identification and cutting DNA target sequence.
In some optional embodiments of the invention, the detection method further includes detecting the type of mutant, described
Type includes heterozygous mutation and homozygous mutation.Since this method is mutated target gene relative to reference gene by detection
The changes of contents of amplified production detects mutant, therefore can quantify variation of the detection target gene relative to reference gene, when
When target gene is reduced relative to reference gene expression quantity, then the mutant is heterozygous mutation；When target gene is relative to interior
When ginseng gene is not expressed, then the mutant is homozygous mutation.For example, if sample to be tested is diploid, then the fluorescence of probe I
Intensity is the half of probe II.
In some optional embodiments of the invention, it is positive mutation that the detection method, which further includes by testing result,
Body is further sequenced, and determines mutational formats.Such as target location is insertion or missing or the number of base of whole section of gene
Missing, the forms such as mutation.
In some optional embodiments of the invention, the amplification is fluorescent quantitative PCR.Quantitative fluorescent PCR exists
In amplification procedure use fluorescent dye or fluorescence probe, can amplification while dynamic monitoring amplified production content change
Change, and amplified production can be quantified, avoids electric the step of using after amplification, significantly improve detection efficiency.
In some optional embodiments of the invention, amplification respectively is mutated target gene and reference gene；Preferably, until
A reference gene is expanded less；Preferably, a mutation target gene is at least expanded.In this embodiment, amplification needs respectively
Then target gene is compared by the target gene to be screened with the content of the amplified production of reference gene.Since fluorescence is fixed
It measures PCR and is the changes of contents of comparable amplified production without electrophoresis, therefore there is high-throughput advantage.It, can be simultaneously when amplification
Different mutation target spots is expanded to be compared with one or more reference gene.Preferably in, quantitative fluorescent PCR
Fluorescent dye or fluorescence probe can be selected as fluorescent light source.Fluorescent dye is easy to operate, without designing probe, but it is special
The opposite sex is not so good as fluorescence probe.Fluorescence probe specificity is good, will not be combined with primer dimer, but design is complex, can
According to specifically being selected.
In some optional embodiments of the invention, label two is glimmering simultaneously in the PCR amplification region of pair of primers
Light probe, probe I are combined with mutation target gene, and probe II is combined with reference gene, and probe I uses different respectively from probe II
Fluorescent marker.In the present embodiment, quantitative fluorescent PCR use fluorescence probe method, in PCR amplification region simultaneously label two
Fluorescence probe, probe I are in whether mutation target position detection target site mutates, and probe II is not used as interior in mutation target spot
Join gene to assess the allele quantity in whole sample, the frequency of mutation to distinguish mutated individual and is detected with this.In this reality
It applies reference gene and target gene in mode to be located in the PCR amplification region of pair of primers, therefore reference gene and target gene
Amplification efficiency it is identical, by such as G/C content and primer of target gene reference gene difference and other influences expand effect
The influence of the factor of rate, therefore the amplified production due to reference gene and target gene caused by PCR amplification step can be excluded
Content is different, and testing result is more accurate.Preferably, probe I is marked using FAM, it is preferable that probe II is marked using HEX.
In some of the invention optional embodiments, changes of contents use 2-△△CMethod is analyzed；Wherein △ △ CT=
△CT(sample to be tested)–△CT(control group)；△ CT=CT(probe I)-CT(probe II).Optionally, control group can select wild type sample or its
His standard sample, such as the standard items such as standard DNA sample or the plasmid containing target gene and reference gene.
In some optional embodiments of the invention, fluorescent quantitative PCR is carried out using 384 hole PCR plates, even if often
A sample do three repetitions can also primary first-order equation up to detect 128 samples simultaneously, high-throughput detect may be implemented and wait for
The technique effect of test sample sheet.
The present invention also provides application of the above-mentioned detection method in screening-gene editor's positive plant, which is current
Screening transgenic positive T0For an ideal method for gene editing plant.Preferably, the gene editing positive plant packet
Include rice, arabidopsis, corn and sorghum.
In a preferred embodiment party of the invention, the gene editing positive plant is that rice TGW6 gene editings are positive
Plant；Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.3；Probe II is marked using HEX, is had
The sequence as shown in SEQ ID NO.4；Preferably, using the primer with the sequence as shown in SEQ ID NO.1 and SEQ ID NO.2
Amplifying rice sample to be tested；
In a preferred embodiment party of the invention, the gene editing positive plant is arabidopsis AT5G05570 genes
Edit positive plant；Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.7；Probe II uses HEX
Label has the sequence as shown in SEQ ID NO.8；Preferably, using with as shown in SEQ ID NO.5 and SEQ ID NO.6
The primer amplification arabidopsis sample to be tested of sequence；
In a preferred embodiment party of the invention, the gene editing positive plant is sorghum SORBI_010G072000
Gene editing positive plant；Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.11；Probe II makes
It is marked with HEX, there is the sequence as shown in SEQ IDNO.12；Preferably, using with such as SEQ ID NO.9 and SEQ ID
The primer amplification sorghum sample to be tested of sequence shown in NO.10；
In a preferred embodiment party of the invention, the gene editing positive plant is corn Zm00001d038302 bases
Because editing positive plant；Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.15；Probe II uses
HEX is marked, and has the sequence as shown in SEQ ID NO.16；Preferably, using with such as SEQ ID NO.13 and SEQ ID
The primer amplification corn sample to be tested of sequence shown in NO.14.
The advantageous effect further illustrated the present invention with reference to preferred embodiment.
Embodiment 1
A kind of detection method for detecting mutant is present embodiments provided, the present embodiment is same in PCR amplification region
When two fluorescence probes of label, probe I marked using FAM, can be combined with target gene to detect whether target site dashes forward
Become, probe II marked using HEX, is mutated the gene as conserved region near target spot as reference gene, and probe II can be with
Reference gene combines, and to assess the allele quantity in whole sample, to distinguish mutated individual and the frequency of mutation is detected with this.
The present embodiment further includes pair for amplification primer, and probe I and the calmodulin binding domain CaM of probe II is made to be entirely located in the primer
It expands in range.As shown in Figure 1-Figure 3, the mutation newly introduced will destroy the combination of probe I and amplified fragments without influence
The combination of probe I I, therefore can easily distinguish mutated individual, if target gene does not mutate, probe I when amplification
It can be combined with amplified production with probe II, then HEX and FAM can shine, and fluorescence intensity is identical；If target gene
It mutates, then only probe II can be combined with amplified production, i.e., only HEX can shine, the fluorescence intensity of HEX and FAM
It differs.
And the embodiment by fluorescence intensity or can also will be mutated amplification of the target gene relative to reference gene
The changes of contents of product uses 2-△△CMethod carries out analysis and may determine that mutant is homozygous mutant or heterozygous mutant,
Wherein △ △ CT=△ CT(sample to be tested)–△CT(control group)；△ CT=CT(probe I)-CT(probe II).Control group can select wild type sample
Either other standards sample standard items such as standard DNA sample or plasmid containing target gene and reference gene.
When sample to be tested is homozygous mutant, sample to be tested point of impact on target gene is all mutated, then probe I cannot be tied with DNA
It closes, FAM does not shine (as shown in Figure 4 and Figure 5)；When sample to be tested is heterozygous mutant, the mutation target spot of a part of amplified production
It can be combined with probe I, then FAM is weaker relative to the fluorescence intensity of HEX, for example, if sample to be tested is diploid, then FAM
Fluorescence intensity is the half (as shown in Figure 6 and Figure 7) of HEX；When sample to be tested does not mutate, probe I and probe II with
Amplified production combines, therefore the fluorescence intensity of FAM and HEX is identical (as shown in Figure 8 and Figure 9).
The test material and test method of embodiment 2- embodiments 5 are as follows：
Experiment material：The rice of gene editing makees core institute doctor Wang Hua from academy of agricultural sciences of Zhejiang Province；The quasi- south of gene editing
Mustard comes from Agricultural University Of Nanjing doctor Liu Feng；The sorghum of gene editing comes from Anhui University of Science and Technology Li Jie duty doctor；Gene editing
Corn come from China Agricultural University doctor Zhao Haiming.
Test method：
DNA is extracted：Weigh 100mg pulverized specimens according to kit (DNeasy Plant Mini Kit, Qiagen,
Hilden, Germany) illustrate to extract DNA.Obtained DNA mass and purity are measured at spectrophotometer 260-280nm, are used in combination
Agarose gel electrophoresis determines its integrality.It is that sensitivity technique is spare with PicoGreen by DNA accurate quantifications.
Primer and probe designs：Fluorescence PCR primer and probe utilize 3.0 software (Applied of Primer Express
Biosystems, Foster City, CA, USA) exploitation, all primers are by Invitrogen trade Co., Ltd (Shanghai) conjunction
At.The sequence for the primer and probe that embodiment 2- embodiments 5 use is as shown in table 1：
The sequence for the primer and probe that 1 embodiment 2- embodiments 5 of table use
Real-time fluorescence PCR reaction condition：Real-time fluorescence PCR uses Roche kits (the FastStart
Universal Probe Master, Roche, Switzerland) reaction total volume is 25 μ L, including 2 × qPCR Master Mix I
12.5 μ L, upstream and downstream primer (10 μm of ol/L) each 1 μ L to final concentration 400nmol, each probe (10 μm of ol/L) 0.5 μ L are dense to end
200nmol, 5 μ L of DNA profiling are spent, ultra-pure water (ddH is finally used2O it) mends to 25 μ L.
Real-time fluorescent PCR amplification condition：50 DEG C of thermal starting 2min；95 DEG C of pre-degeneration 10min；95 DEG C of denaturation 15s, 60 DEG C are moved back
Fire and extension 1min, amplified reaction carry out 40 cycles.PCR amplification fluorescence signal is collected at 60 DEG C.
Data analysis uses 2- △ △ CT methods, △ △ CT=△ CT(sample to be tested)–△CT(control group)；△ CT=CT(probe I)-
CT(probe II)。
Embodiment 2 detects the rice homozygous mutation body of CRISPR-CAS9 inductions
The transgenosis water of the homozygous mutation body in rice TGW6 gene editings site is detected using the method that embodiment 1 provides
Rice strain (as shown in Figure 10).
9 familys had previously determined 9 independent rice familys of mutational formats, their mutation side with the method for sequencing
Formula includes replacing, be inserted into and lacking.As shown in table 2：
The mutational formats of table 2 rice wild type and TGW6 gene mutation strains
Underscore part indicates that the binding site with TGW6-HEX probes, thickened portion indicate in wild-type sequence in upper table
The binding site of TGW6-FAM probes；For mutational formats by taking sample 10-7 as an example, -3 indicate that the mutant after mutation is opposite in upper table
3 bases are lacked in wild type, are indicated in bracket after mutant lacks 5 bases with wild type compared with by newly-increased 2 bases, because
This mutant strain 10-7 is mutated 2 bases compared with wild type, lacks 3 bases, other mutant samples and herein in upper table
The statement of other tables is done with explanation, is repeated no more.
To detect these mutant, two kinds of probes are devised：TGW6-HEX probes are to assess whole sample as reference gene
Allele quantity in this, probe of the TGW6-FAM probes as detection target site.As a result as shown in Figure 10 and Figure 11, make
With TGW6-FAM probes other than wild type DNA, the DNA of 9 kinds of different mutational formats not or has and is seldom expanded.And
TGW6-HEX probes have similar amplification in wild type and mutant DNA.Pass through 2-△△CTMethod carries out data analysis, such as
Shown in Figure 12, show mutant DNA as calibration sample using TGW6-HEX probes as reference gene and wild-type template DNA
In all correlated expressions without numerical value.In addition, as shown in figure 13, identical result is also demonstrated using traditional T7E1 methods.
Therefore, these results indicate that our experiment can be easy to detect and filter out the various types of of CRISPR-CAS9 induction generations
The mutant of type.
Embodiment 3 detects the rice heterozygous mutation of CRISPR-CAS9 inductions
The transgenic paddy rice product of the heterozygous mutation body in TGW6 gene editings site are detected using the method that embodiment 1 provides
System.3 kinds of rice heterozygous individuals with different mutation types of selection include 19-6, and (del1 lacks 5 bases G CCGC) has
The sequence as shown in SEQ ID NO.20；28-4 (del2 lacks 4 bases Gs CCG, A and C and replaces, and T and G is replaced), has such as SEQ
Sequence shown in ID NO.22；31-8 (missing of single base) has the sequence as shown in SEQ ID NO.27；Real-time quantitative PCR into
One step passes through 2-△△CTMethod analysis assesses the allele quantity in whole sample using TGW6-HEX probes as reference gene
It is used in combination wild-type template as calibration sample.Since Heterozygous mutants have the mutation of the wild-type template and half amount of half amount
Pattern plate, therefore its relative value should be 0.5 or so.As a result also as expected, the DNA sample value range of 3 kinds of heterozygous
From 0.47-0.53 (result is as shown in figure 14).The result shows that the detection method can efficiently differentiate the wild type, miscellaneous of rice
Mould assembly is mutated and homozygous mutation.
Embodiment 4 detects the mutation efficiency of CRISPR-CAS9 evoked callus
When carrying out cell transfecting and callus converts, the accurately quantitative analysis frequency of mutation is needed, to evaluate gene editing
Efficiency etc..Callus is handled using CRISPR-CAS9 and prepares corresponding callus genomic DNA, is provided using embodiment 1
Detection method is analyzed.As shown in figure 15, WT is the callus DNA without converting Cas9；Cas9-treated is conversion Cas9
Callus DNA, the callus of CRISPR-CAS9 processing reduces 32.5% compared with untreated callus, shows to be cured
TGW6 target genes are successfully mutated by CRISPR-CAS9 in injured tissue, and its editorial efficiency is about 32.5%.
In addition, we analyze the maximum detection limit (LOD) of the technology using external frequency of mutation mutation model.With not
With concentration mixing saltant type template (homozygous mutation strain 19-6DNA) and wild-type template, (no mutation 100% from 0% to 100%
Mutant).With the increase of mutant template ratio, the value of blend sample continuously decreases, as a result as shown in figure 16.As a result table
Bright, our method can detect that at least 10% is mutated caused by Cas9.Due to the gene editing efficiency of most plants
Above 25%, therefore, our method is suitable for measuring in plant induces the generated frequency of mutation by Cas9.
Embodiment 5 detects different plant species gene editing plant
It is that material therefrom screens sun that use 15 kinds of genetically modified plants, which include arabidopsis, sorghum and corn (5 samples/kind),
Property gene editing sample, wherein At indicates that arabidopsis, Zm indicate that sorghum, Sb indicate corn, and wild type gene is as shown in table 2.
It is found as shown in figure 17 in the sample detection of arabidopsis.The relative expression quantity of L2 (At) to L4 (At) DNA is about 100%, and L1
(At) DNA void values, therefore L1 is mutant.Equally, as shown in Figure 18 and Figure 19, in sorghum target gene sorbi_
010g072000, corn target gene zm00001d038302 are it has also been found that these samples.It is thus determined that L1 (At), L5 (Zm),
L2 (Sb) and L5 (Sb) is positive gene individual young editors.In order to further verify reliability and confirm mutation type, L1 (At), L5
(Zm), the qPCR products of L2 (Sb) and L5 (Sb) are directly used in follow-up sequencing, and the results are shown in Table 2：
2 arabidopsis of table, the wild-type sequence of sorghum and corn and sample L1 (At), L5 (Zm), L2 (Sb) and L5 (Sb)
Sequencing result
| Sample to be tested | Sequence | Number | Mutational formats |
| WT(At) | ACTCTTCATCTATGGTGGTGATATCATTGGATCTGACGAA | SEQ ID NO.28 | WT |
| l1(At) | ACTCTTCATCTATGGTGGTGA--TCATTGGATCTGACGAA | SEQ ID NO.29 | -2 |
| WT(Zm) | AGTCCAAGAGAGGAAAGACCTCCAG-AAACCATGGAAAAT | SEQ ID NO.30 | WT |
| L5(Zm) | AGTCCAAGAGAGGAAAGACCTCCAGAAAACCATGGAAAAT | SEQ ID NO.31 | +1 |
| WT(Sb) | AGTTCAAATGGCTGCTGAATCAGA-GCACGGCAACT | SEQ ID NO.32 | WT |
| L12(Sb) | AGTTCAAATGGCTGCTGAATCAGAAGCACGGCAACT | SEQ ID NO.33 | +1 |
| L15(Sb) | GTTCAGCCCAAA------------------CACGGCAACT | SEQ ID NO.34 | -17 |
Show that these strains have mutation in target location by sequence data in table 2, these are statistics indicate that our method
It is that can effectively be applied in the gene editing plant of different plant species.
6 screening-gene editor's plant flow of embodiment
In order to make qPCR methods be preferably applied for screening-gene editor plant, the work of screening test is present embodiments provided
Make flow, as shown in figure 20.In the first step, it needs to assess the callus or original that gene editing induces by qPCR methods
Mutation efficiency in raw plastid cell.Genetic transformation efficiency is too low, it will causes to be difficult to obtain enough positive gene editor's lists
Strain.Only compared with wild type, the CT values of probe I increase, and when Relative Expression values reduce, just there is positive target position in sample
Point mutation.Next, needing to distinguish Mutants homozygous, heterozygous mutation body and a large amount of regeneration are without mutant plant.In this step,
384 orifice plates can be further used to realize high throughput, it can be with the more samples of one-time detection.Finally, if necessary
Words, the qPCR products of plant that can be directly to being confirmed as positive gene editor are sequenced to determine mutation type.This
The method of screening and identification gene editing plant of the embodiment based on qPCR is current screening transgenic positive T0It is compiled for gene
An ideal method for plant is collected, this method will play great function for gene editing in plant breeding.
Certain methods have been developed at present to screen and identify the mutant of gene editing technology generation.PCR combines limit
Property enzyme cutting method (PCR/RE) processed is nearby limited restriction enzyme site by target sequence and is limited.T7E1 methods can widely identify any mesh
Mark sequence simultaneously digests unmatched heteroduplex DNA, however its detection sensitivity is less than PCR/RE, and both methods is all time-consuming
Arduously.The method of HRM analyses is although time saving and energy saving, but detection sensitivity is less than the detection of based on PCR, and needs expensive set
It is standby.Traditional PCR method needs to rely on gel electrophoresis to detect PCR product, and this considerably increases dirty between laboratory and sample
The risk of dye, and it is inconvenient.It is used for detecting gene the present invention provides a simple Real-Time Fluorescent Quantitative PCR Technique to compile
Collect plant.This method directly from CT value analysis results, need not handle PCR product, and this method is more convenient, sensitive, high-throughput.
In addition, determining that positive gene editing sample can be further directly sequenced by corresponding qPCR products determines mutation type.Cause
This, this is an advantage of a large amount of unknown sample high throughput detections.Detection method provided by the invention can be used for widely
Variety classes genome, such as arabidopsis, sorghum, corn.Sequencing result further demonstrates our method suitable for plant
Different plant species.
Finally it should be noted that：The above embodiments are only used to illustrate the technical solution of the present invention., rather than its limitations；To the greatest extent
Present invention has been described in detail with reference to the aforementioned embodiments for pipe, it will be understood by those of ordinary skill in the art that：Its according to
So can with technical scheme described in the above embodiments is modified, either to which part or all technical features into
Row equivalent replacement；And these modifications or replacements, various embodiments of the present invention technology that it does not separate the essence of the corresponding technical solution
The range of scheme.
SEQUENCE LISTING
<110>Zhejiang Academy of Agricultural Science
<120>The detection method of mutant and its application
<160> 34
<170> PatentIn version 3.5
<210> 1
<211> 19
<212> DNA
<213>Artificial sequence
<400> 1
tcgcgctcat tgtcttcct 19
<210> 2
<211> 23
<212> DNA
<213>Artificial sequence
<400> 2
tggtcttgaa cattctcgtt gtg 23
<210> 3
<211> 14
<212> DNA
<213>Artificial sequence
<400> 3
ctactgccgc cgcc 14
<210> 4
<211> 15
<212> DNA
<213>Artificial sequence
<400> 4
ctgctctcgc cgtcc 15
<210> 5
<211> 21
<212> DNA
<213>Artificial sequence
<400> 5
ccgcaagagt agtggtggaa a 21
<210> 6
<211> 25
<212> DNA
<213>Artificial sequence
<400> 6
cgtttttatt tgggctgagt tctta 25
<210> 7
<211> 18
<212> DNA
<213>Artificial sequence
<400> 7
tggtgatatc attggatc 18
<210> 8
<211> 16
<212> DNA
<213>Artificial sequence
<400> 8
tggtggaaaa ctcttc 16
<210> 9
<211> 24
<212> DNA
<213>Artificial sequence
<400> 9
tggtacgaat tcattctgca gttc 24
<210> 10
<211> 19
<212> DNA
<213>Artificial sequence
<400> 10
ctgcccaagc attgcagtt 19
<210> 11
<211> 15
<212> DNA
<213>Artificial sequence
<400> 11
ctgaatcaga gcacg 15
<210> 12
<211> 16
<212> DNA
<213>Artificial sequence
<400> 12
agttcaaatg gctgct 16
<210> 13
<211> 20
<212> DNA
<213>Artificial sequence
<400> 13
ggagcctgca agtccaagag 20
<210> 14
<211> 24
<212> DNA
<213>Artificial sequence
<400> 14
tgggatttca ccatcttcat aaaa 24
<210> 15
<211> 28
<212> DNA
<213>Artificial sequence
<400> 15
aaagacctcc agaaaccatg gaaaatga 28
<210> 16
<211> 18
<212> DNA
<213>Artificial sequence
<400> 16
ggaaaatgat attgaaga 18
<210> 17
<211> 60
<212> DNA
<213>Rice（Oryza sativa）
<400> 17
cctcgtgctg ctctcgccgt cccctactgc cgccgccaca gccacaacga gaatgttcaa 60
<210> 18
<211> 57
<212> DNA
<213>Artificial sequence
<400> 18
cctcgtgctg ctctcgccgt cccctgccgc cgccacagcc acaacgagaa tgttcaa 57
<210> 19
<211> 57
<212> DNA
<213>Artificial sequence
<400> 19
cctcgtgctg ctctcgccgt cccctgctgc cgccacagcc acaacgagaa tgttcaa 57
<210> 20
<211> 55
<212> DNA
<213>Artificial sequence
<400> 20
cctcgtgctg ctctcgccgt cccctactcg ccacagccac aacgagaatg ttcaa 55
<210> 21
<211> 57
<212> DNA
<213>Artificial sequence
<400> 21
cctcgtgctg ctctcgccgt cccctactgc cgccacagcc acaacgagaa tgttcaa 57
<210> 22
<211> 56
<212> DNA
<213>Artificial sequence
<400> 22
cctcgtgctg ctctcgccgt cccctccgcc gccacagcca caacgagaat gttcaa 56
<210> 23
<211> 58
<212> DNA
<213>Artificial sequence
<400> 23
cctcgtgctg ctctcgccgt cccctactcg ccgccacagc cacaacgaga atgttcaa 58
<210> 24
<211> 60
<212> DNA
<213>Artificial sequence
<400> 24
cctcgtgctg ctctcgccgt ccccaagacc attgaccaca gccacaacga gaatgttcaa 60
<210> 25
<211> 57
<212> DNA
<213>Rice（Oryza sativa）
<400> 25
cctcgtgctg ctctcgccgt cccctactgc cgccgccaca gccacaacga gaatgtt 57
<210> 26
<211> 60
<212> DNA
<213>Artificial sequence
<400> 26
cctcgtgctg ctctcgccgt cccctactat ctagaatgtt cattgtctat ctagaatgtt 60
<210> 27
<211> 58
<212> DNA
<213>Artificial sequence
<400> 27
cctcgtgctg ctctcgccgt cccctactag ccgccgccac agccacaacg agaatgtt 58
<210> 28
<211> 40
<212> DNA
<213>Arabidopsis（Arabidopsis thaliana）
<400> 28
actcttcatc tatggtggtg atatcattgg atctgacgaa 40
<210> 29
<211> 38
<212> DNA
<213>Artificial sequence
<400> 29
actcttcatc tatggtggtg atcattggat ctgacgaa 38
<210> 30
<211> 39
<212> DNA
<213>Sorghum（Sorghum bicolor (L.) Moench）
<400> 30
agtccaagag aggaaagacc tccagaaacc atggaaaat 39
<210> 31
<211> 40
<212> DNA
<213>Artificial sequence
<400> 31
agtccaagag aggaaagacc tccagaaaac catggaaaat 40
<210> 32
<211> 35
<212> DNA
<213>Corn（Zea mays Linn）
<400> 32
agttcaaatg gctgctgaat cagagcacgg caact 35
<210> 33
<211> 36
<212> DNA
<213>Artificial sequence
<400> 33
agttcaaatg gctgctgaat cagaagcacg gcaact 36
<210> 34
<211> 22
<212> DNA
<213>Artificial sequence
<400> 34
gttcagccca aacacggcaa ct 22
Claims (10)
1. a kind of detection method of mutant, which is characterized in that the mutant is obtained by gene editing, the detection method
Mutation target gene and reference gene including expanding sample to be tested, when the content and internal reference of the amplified production of mutation target gene
When the content of the amplified production of gene differs, sample to be tested is Positive mutants body.
2. detection method according to claim 1, which is characterized in that the gene editing include Zinc finger nuclease system,
The nucleic acid enzyme system and CRISPR-cas system of activating transcription factor sample effect；
Preferably, the CRISPR-CAS systems are CRISPR-CAS9 systems.
3. detection method according to claim 1, which is characterized in that the detection method further includes detecting the class of mutant
Type, the type include heterozygous mutation and homozygous mutation.
4. detection method according to claim 1, which is characterized in that it is sun that the detection method, which further includes by testing result,
The mutant of property is further sequenced, and determines mutational formats.
5. detection method according to claim 1, which is characterized in that the amplification is fluorescent quantitative PCR.
6. detection method according to claim 5, which is characterized in that amplification mutation target gene and reference gene respectively；
Preferably, a reference gene is at least expanded；
Preferably, a mutation target gene is at least expanded.
7. detection method according to claim 5, which is characterized in that the same markers in the PCR amplification region of pair of primers
Remember that two fluorescence probes, probe I are combined with mutation target gene, probe II is combined with reference gene, and probe I is distinguished with probe II
Use different fluorescent markers；
Preferably, probe I is marked using FAM；
Preferably, probe II is marked using HEX.
8. the detection method described according to claim 6 or 7, which is characterized in that mutation target gene is relative to reference gene
The changes of contents of amplified production uses 2-△△CMethod is analyzed.
9. application of the detection method in screening-gene editor's positive plant described in a kind of any one of claim 1-8.
10. application according to claim 9, which is characterized in that the gene editing positive plant includes rice, quasi- south
Mustard, corn and sorghum；
Preferably, the gene editing positive plant is rice TGW6 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.3；Probe II is marked using HEX, is had
The sequence as shown in SEQ ID NO.4；
Preferably, using the primer amplification rice sample to be tested with the sequence as shown in SEQ ID NO.1 and SEQ ID NO.2；
Preferably, the gene editing positive plant is arabidopsis AT5G05570 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.7；Probe II is marked using HEX, is had
The sequence as shown in SEQ ID NO.8；
Preferably, test sample is waited for using the primer amplification arabidopsis with the sequence as shown in SEQ ID NO.5 and SEQ ID NO.6
Product；
Preferably, the gene editing positive plant is sorghum SORBI_010G072000 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.11；Probe II is marked using HEX, is had
The sequence as shown in SEQ ID NO.12；
Preferably, using the primer amplification sorghum sample to be tested with the sequence as shown in SEQ ID NO.9 and SEQ ID NO.10；
Preferably, the gene editing positive plant is corn Zm00001d038302 gene editing positive plants；
Preferably, probe I is marked using FAM, has the sequence as shown in SEQ ID NO.15；Probe II is marked using HEX, is had
The sequence as shown in SEQ ID NO.16；
Preferably, test sample is waited for using the primer amplification corn with the sequence as shown in SEQ ID NO.13 and SEQ ID NO.14
Product.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810340639.2A CN108359720A (en) | 2018-04-16 | 2018-04-16 | The detection method of mutant and its application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201810340639.2A CN108359720A (en) | 2018-04-16 | 2018-04-16 | The detection method of mutant and its application |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN108359720A true CN108359720A (en) | 2018-08-03 |
Family
ID=63008432
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201810340639.2A Pending CN108359720A (en) | 2018-04-16 | 2018-04-16 | The detection method of mutant and its application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN108359720A (en) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109727643A (en) * | 2018-12-05 | 2019-05-07 | 云南中烟工业有限责任公司 | A kind of list target gene editor T1 is for cigarette strain screening technique |
| CN111304211A (en) * | 2020-03-10 | 2020-06-19 | 无锡市第五人民医院 | RHD-T268A mutant and detection thereof |
| CN111793707A (en) * | 2020-06-23 | 2020-10-20 | 中国农业科学院油料作物研究所 | Gene editing transgenic crop editing site specificity PCR method and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150353927A1 (en) * | 2013-01-10 | 2015-12-10 | Ge Healthcare Dharmacon, Inc. | Templates, Libraries, Kits and Methods for Generating Molecules |
| CN105154531A (en) * | 2015-07-28 | 2015-12-16 | 华南农业大学 | Molecular marker for identifying wild type and mutant of 1000-grain weight gene TGW6 of rice |
| CN105624309A (en) * | 2016-02-23 | 2016-06-01 | 深圳华大基因研究院 | Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation |
| CN106319045A (en) * | 2016-08-19 | 2017-01-11 | 中国水稻研究所 | Method for screening gene editing products |
| CN107435069A (en) * | 2017-07-28 | 2017-12-05 | 新乡医学院 | A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts |
-
2018
- 2018-04-16 CN CN201810340639.2A patent/CN108359720A/en active Pending
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20150353927A1 (en) * | 2013-01-10 | 2015-12-10 | Ge Healthcare Dharmacon, Inc. | Templates, Libraries, Kits and Methods for Generating Molecules |
| CN105154531A (en) * | 2015-07-28 | 2015-12-16 | 华南农业大学 | Molecular marker for identifying wild type and mutant of 1000-grain weight gene TGW6 of rice |
| CN105624309A (en) * | 2016-02-23 | 2016-06-01 | 深圳华大基因研究院 | Primer, probe and kit for detecting EGFR and/or K-ras genetic mutation |
| CN106319045A (en) * | 2016-08-19 | 2017-01-11 | 中国水稻研究所 | Method for screening gene editing products |
| CN107435069A (en) * | 2017-07-28 | 2017-12-05 | 新乡医学院 | A kind of quick determination method of cell line CRISPR/Cas9 gene knockouts |
Non-Patent Citations (4)
| Title |
|---|
| BIO-RAD: ""ddPCR Genome Edit Detection Assays"", 《BIO-RAD LABORATORIES》 * |
| BIO-RAD: ""Ultra-sensitive quantification of genome editing events by Droplet Digital PCR"", 《BIO-RAD LABORATORIES》 * |
| CHENG PENG ET AL.: ""High-throughput detection and screening of plants modified by gene editing using quantitative real-time polymerase chain reaction"", 《THE PLANT JOURNAL 》 * |
| ULRIKE MOCK ET AL.: ""Digital PCR to assess gene-editing frequencies (GEF-dPCR) mediated by designer nucleases"", 《NATURE PROTOCOLS》 * |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109727643A (en) * | 2018-12-05 | 2019-05-07 | 云南中烟工业有限责任公司 | A kind of list target gene editor T1 is for cigarette strain screening technique |
| CN111304211A (en) * | 2020-03-10 | 2020-06-19 | 无锡市第五人民医院 | RHD-T268A mutant and detection thereof |
| CN111304211B (en) * | 2020-03-10 | 2020-12-01 | 无锡市第五人民医院 | RHD-T268A mutant and detection thereof |
| CN111793707A (en) * | 2020-06-23 | 2020-10-20 | 中国农业科学院油料作物研究所 | Gene editing transgenic crop editing site specificity PCR method and application thereof |
| CN111793707B (en) * | 2020-06-23 | 2022-04-22 | 中国农业科学院油料作物研究所 | Gene editing transgenic crop editing site specificity PCR method and application thereof |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Singh et al. | CAAT box-derived polymorphism (CBDP): a novel promoter-targeted molecular marker for plants | |
| Hussain et al. | Identification of induced mutations in hexaploid wheat genome using exome capture assay | |
| Bajaj et al. | EcoTILLING-based association mapping efficiently delineates functionally relevant natural allelic variants of candidate genes governing agronomic traits in chickpea | |
| CN107109497A (en) | HBV cccDNA high flux new method is quantified from cell lysate by real-time PCR | |
| CN109628627B (en) | Development and application of SNP (single nucleotide polymorphism) marker of broad-spectrum rice blast resistance gene Pigm of rice | |
| Guevara et al. | Analysis of DNA cytosine methylation patterns using methylation-sensitive amplification polymorphism (MSAP) | |
| CN108359720A (en) | The detection method of mutant and its application | |
| Huang et al. | Development and application of a quantitative loop‐mediated isothermal amplification method for detecting genetically modified maize MON863 | |
| Elias et al. | Optimizing TILLING and Ecotilling techniques for potato (Solanum tuberosum L) | |
| CN104450872A (en) | High-throughput multi-sample multi-target sing-base resolution methylation level detection method | |
| CN109735648B (en) | Method for screening wheat with different thousand grain weights and special kit thereof | |
| Szurman-Zubrzycka et al. | Mutation detection by analysis of DNA heteroduplexes in TILLING populations of diploid species | |
| JP4937106B2 (en) | Gene detection method | |
| CN106755465B (en) | Molecular marker closely linked with wheat flag leaf length QTL QFLL | |
| CN104031912B (en) | Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof | |
| CN110283929B (en) | SNP (single nucleotide polymorphism) marker 5-160 related to pepper phytophthora blight resistance gene as well as specific primer and application thereof | |
| CN1932037B (en) | Method of screening transgenic wheat | |
| Xiujie et al. | Comparison of five endogenous reference genes for specific PCR detection and quantification of rice | |
| CN105238857A (en) | ARMS-Tm-shift-qPCR detection reagent and method for paddy rice Wax-mq genotype | |
| CN105112534B (en) | Primer pair and method for identifying copy numbers of internal and external genes of chrysanthemum through fluorescent quantitative PCR | |
| CN112626258B (en) | SNP (Single nucleotide polymorphism) site related to rice cadmium low-absorption gene OsNramp5 and application thereof | |
| CN108384841A (en) | A kind of high-throughput method for distinguishing genetically modified plants homozygote and heterozygote | |
| CN103589797A (en) | SNP (single nucleotide polymorphism) genotyping method and application thereof | |
| CN106636406A (en) | Molecular marker R207 coseparated with wheat few-tillering gene Ltn3 and application of molecular marker R207 | |
| Neumann et al. | Assessment of the genetic stability of GMOs with a detailed examination of MON810 using Scorpion probes |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |