CN104031912B - Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof - Google Patents
Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof Download PDFInfo
- Publication number
- CN104031912B CN104031912B CN201310068126.8A CN201310068126A CN104031912B CN 104031912 B CN104031912 B CN 104031912B CN 201310068126 A CN201310068126 A CN 201310068126A CN 104031912 B CN104031912 B CN 104031912B
- Authority
- CN
- China
- Prior art keywords
- seq
- nucleic acid
- sequence
- paddy rice
- fragment
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 235000007164 Oryza sativa Nutrition 0.000 title claims abstract description 138
- 235000009566 rice Nutrition 0.000 title claims abstract description 112
- 230000009261 transgenic effect Effects 0.000 title claims abstract description 108
- 150000007523 nucleic acids Chemical class 0.000 title claims abstract description 78
- 108020004707 nucleic acids Proteins 0.000 title claims abstract description 75
- 102000039446 nucleic acids Human genes 0.000 title claims abstract description 75
- 238000000034 method Methods 0.000 title claims abstract description 41
- 240000007594 Oryza sativa Species 0.000 title claims description 27
- 241000209094 Oryza Species 0.000 claims abstract description 111
- 239000012634 fragment Substances 0.000 claims abstract description 41
- 238000012408 PCR amplification Methods 0.000 claims abstract description 36
- 238000001514 detection method Methods 0.000 claims abstract description 29
- 238000012360 testing method Methods 0.000 claims description 19
- 238000000137 annealing Methods 0.000 claims description 7
- 102000016928 DNA-directed DNA polymerase Human genes 0.000 claims description 5
- 108010014303 DNA-directed DNA polymerase Proteins 0.000 claims description 5
- 238000009396 hybridization Methods 0.000 claims description 4
- 239000013641 positive control Substances 0.000 claims description 4
- 238000003149 assay kit Methods 0.000 claims 3
- 108090000623 proteins and genes Proteins 0.000 description 24
- 238000013461 design Methods 0.000 description 18
- 108020004414 DNA Proteins 0.000 description 17
- 230000003321 amplification Effects 0.000 description 11
- 238000003780 insertion Methods 0.000 description 11
- 230000037431 insertion Effects 0.000 description 11
- 210000000349 chromosome Anatomy 0.000 description 10
- 230000009466 transformation Effects 0.000 description 10
- 238000003199 nucleic acid amplification method Methods 0.000 description 9
- 241000196324 Embryophyta Species 0.000 description 8
- 238000012772 sequence design Methods 0.000 description 8
- 235000003869 genetically modified organism Nutrition 0.000 description 7
- 238000004519 manufacturing process Methods 0.000 description 7
- 239000003550 marker Substances 0.000 description 6
- 238000004458 analytical method Methods 0.000 description 5
- 238000006243 chemical reaction Methods 0.000 description 5
- 238000007726 management method Methods 0.000 description 5
- 238000011144 upstream manufacturing Methods 0.000 description 5
- 239000011543 agarose gel Substances 0.000 description 4
- 101150103518 bar gene Proteins 0.000 description 4
- 238000001962 electrophoresis Methods 0.000 description 4
- 238000007859 qualitative PCR Methods 0.000 description 4
- 238000012163 sequencing technique Methods 0.000 description 4
- 239000013598 vector Substances 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 108020004705 Codon Proteins 0.000 description 3
- 230000004087 circulation Effects 0.000 description 3
- 238000005516 engineering process Methods 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 238000007689 inspection Methods 0.000 description 3
- 238000005457 optimization Methods 0.000 description 3
- 102200017867 rs121434558 Human genes 0.000 description 3
- 238000011895 specific detection Methods 0.000 description 3
- 208000030514 Leukocyte adhesion deficiency type II Diseases 0.000 description 2
- 239000000969 carrier Substances 0.000 description 2
- 230000008034 disappearance Effects 0.000 description 2
- 238000011156 evaluation Methods 0.000 description 2
- 239000013604 expression vector Substances 0.000 description 2
- 239000000284 extract Substances 0.000 description 2
- 230000014509 gene expression Effects 0.000 description 2
- 208000003643 Callosities Diseases 0.000 description 1
- LZZYPRNAOMGNLH-UHFFFAOYSA-M Cetrimonium bromide Chemical compound [Br-].CCCCCCCCCCCCCCCC[N+](C)(C)C LZZYPRNAOMGNLH-UHFFFAOYSA-M 0.000 description 1
- 108091026890 Coding region Proteins 0.000 description 1
- 206010020649 Hyperkeratosis Diseases 0.000 description 1
- 206010054949 Metaplasia Diseases 0.000 description 1
- 108700019146 Transgenes Proteins 0.000 description 1
- 240000008042 Zea mays Species 0.000 description 1
- 235000005824 Zea mays ssp. parviglumis Nutrition 0.000 description 1
- 235000002017 Zea mays subsp mays Nutrition 0.000 description 1
- 239000002253 acid Substances 0.000 description 1
- 238000009395 breeding Methods 0.000 description 1
- 230000001488 breeding effect Effects 0.000 description 1
- 235000013339 cereals Nutrition 0.000 description 1
- 238000012512 characterization method Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 238000007796 conventional method Methods 0.000 description 1
- 235000005822 corn Nutrition 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000011161 development Methods 0.000 description 1
- 238000010586 diagram Methods 0.000 description 1
- 238000009826 distribution Methods 0.000 description 1
- 238000004043 dyeing Methods 0.000 description 1
- 230000004927 fusion Effects 0.000 description 1
- 239000000499 gel Substances 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- 238000010353 genetic engineering Methods 0.000 description 1
- 230000008676 import Effects 0.000 description 1
- 101150066555 lacZ gene Proteins 0.000 description 1
- 230000015689 metaplastic ossification Effects 0.000 description 1
- 239000000203 mixture Substances 0.000 description 1
- 238000010369 molecular cloning Methods 0.000 description 1
- 239000002773 nucleotide Substances 0.000 description 1
- 125000003729 nucleotide group Chemical group 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 230000035945 sensitivity Effects 0.000 description 1
- 239000000126 substance Substances 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a nucleic acid which is represented by the flanking sequence of transgenic rice B2A68. The invention also provides a method for detecting transgenic rice. The method comprises the following steps: (1) carrying out PCR amplification on a nucleic acid sample taken from to-be-detected paddy rice by using a specific primer directed at the nucleic acid so as to obtain a PCR amplification product; and (2) examining whether the PCR amplification product contains a specific target fragment generated by the specific primer, wherein if the PCR amplification product contains the specific target fragment generated by the specific primer, it is indicated that the to-be-detected paddy rice is the transgenic rice B2A68 or a derived line containing the nucleic acid. The invention further provides a kit and application of the kit. Thus, detection of the transgenic rice B2A68 or the derived line containing the nucleic acid is successfully realized.
Description
Technical field
The present invention relates to agricultural biological technical field, in particular it relates to a kind of nucleic acid, a kind of side of detection transgenic paddy rice
A kind of application of method, test kit and the test kit in detection transgenic paddy rice.
Background technology
Oryza sativa L.（Oryza sativa L.）Used as one of most important cereal crops in the world, people are to its genetic transformation
Have conducted intensive studies with the aspect such as breeding utilization.China achieves a series of great in Transgenic Rice research field
Achievement, many Transgenic Rices are permitted carries out Environment release and industrial experimentation, the anti-snout moths larva of trans Bt gene in 2009
Oryza sativa L. " China is extensive No. 1 " and " Bt Shanyou 63s " obtain production application safety certificate, indicate that China's transgenic paddy rice possesses business
The primary condition that metaplasia is produced.It is in order to balance trading interest, meet the public deeply concerned, control potential risk, strengthen industrial and commercial supervision, many
Country establishes safety evaluation and the mark system of genetically modified organism and products thereof in succession.China is existing for agriculture transgenic is given birth to
The administration base of thing is to promulgate on State Council's May calendar year 2001 23《Agriculture GMO bio-safety management rules》, Yi Jinong
What industry portion on January 5th, 2002 was issued《Agriculture GMO bio-safety evaluation management method》、《Agriculture genetically modified organism import peace
Full management method》With《Agriculture genetically modified organism identifies management method》3 are matched somebody with somebody set of rules.In order to realize to genetically modified organism and its
The mark management of product, ensures effective supervision of transgenic product and the sound development of transgenic industry, to detection GMOs skill
The accuracy of art and sensitivity propose strict demand.
In transgenic plant, the flanking sequence of exogenous gene on position on chromosome is that Transgenic Plant Lines are most heavy
One of characterization of molecules wanted, is the unique identification of the different transformation events of difference, is to set up the inspection of Transgenic Plant Lines specificity
The important technology data of survey method.The patent and document report detection method of multiple crop transgenic transformants is had at present,
Such as：Magnify soldier etc.（2006）Establish the event-specific detection method of transgenic corns MOM863；Lu Changming etc.（2007）Expand
Increase and transgenic rape Rf 1 exogenous insertion vector flanking sequence and established the transformation event method for detecting specificity；Xie Jia
Build（2007）Transgenic paddy rice Kemingdao, Bt are obtained using methods such as Tail-PCR, Genome walking and LD-PCR
The flanking sequence of the external source Insert Fragment of Shanyou 63 and Ke Feng 6, and establish the detection method of strain specificity.
Using the Cry2Aa of codon optimization#Gene and Bar gene transformation Oryza sativa L., it is possible to obtain anti-snout moths larva, antiweed
Oryza sativa L.（Referenced patent application " the Cry2Aa genes of codon optimization and recombinant vector and the method for changing crop resistance ", specially
Sharp application number 201210280832.4）.Not only the transgenic paddy rice of antiweed but also anti-snout moths larva will play important work in production
With.Cry2Aa of the present inventor by codon optimization#Gene and Bar gene transformation Oryza sativa L., obtain one and turn base
Because of rice new strain B2A68.However, as transformation event has randomness, so the external source base of transgenic rice lines B2A68
Because in genome, on position is not known, is determined.Accordingly, it is difficult to realize the specificity to transgenic rice lines B2A68
Detection.
The content of the invention
It is an object of the invention to provide a kind of method of the transgenic rice lines of nucleic acid and detection containing the nucleic acid.
Transgenic paddy rice new lines B2A68 are in document（Hybrid rice, 2013,28 (1):63-67）Disclosed in, can be with
Obtained by way of asking for the Institute of Subtropical Agriculture, The Chinese Academy of Sciences's letter, Chinese Academy of Sciences's subtropical zones agricultural is raw
State institute ensures to provide transgenic paddy rice new lines B2A68 to the public in 20 years from the applying date of the present invention.
Due to the radom insertion of exogenous gene, exogenous gene is caused to be inserted in the chance of rice genome same position almost
No, so exogenous gene sequence has uniqueness with the flanking sequence that Rice Genome Sequence is spliced.Therefore, side sequence
The nucleic acid of row is a kind of brand-new nucleic acid molecules, and the present inventor has obtained the side sequence of transgenic rice lines B2A68
The particular sequence information of row, the detection method thus set up are detection transgenic rice lines B2A68 and its spread out containing the nucleic acid
The specificity method of raw system.
To achieve these goals, on the one hand, the invention provides a kind of nucleic acid, the nucleic acid is transgenic paddy rice B2A68
Flanking sequence shown in nucleic acid, the flanking sequence of the transgenic paddy rice B2A68 is SEQ ID NO.1 or SEQ ID NO.1
Fragment, the fragment of SEQ ID NO.6 or SEQ ID NO.6；Wherein, the fragment of SEQ ID NO.1 at least includes SEQ ID
The sequence of the 100-141 positions of NO.1, preferably at least including SEQ ID NO.1 90-151 positions sequence, more preferably at least
Including the sequence of the 80-161 positions of SEQ ID NO.1；The fragment of SEQ ID NO.6 at least including SEQ ID NO.6 the
The sequence of 1520-1561 positions, preferably at least including SEQ ID NO.6 1510-1571 positions sequence, more preferably at least include
The sequence of the 1500-1581 positions of SEQ ID NO.6.
On the other hand, present invention also offers a kind of method of detection transgenic paddy rice, the transgenic paddy rice is transgenic
The Derivative line of Oryza sativa L. B2A68 or the transgenic paddy rice B2A68 containing nucleic acid as above, the method include：
（1）Using the specific primer for nucleic acid as above, the nucleic acid samples to taking from Oryza sativa L. to be measured enter performing PCR
Amplification, obtains the product after PCR amplifications；
（2）Whether the specificity mesh that the primer amplified is produced is contained in checking the product after the PCR amplifications
Fragment；If containing the specificity purpose fragment in the product after the PCR amplifications, it indicates that the Oryza sativa L. to be measured is institute
State transgenic paddy rice B2A68 or hybridized the Derivative line containing the nucleic acid fragment of generation by B2A68.
On the other hand, present invention also offers a kind of test kit, the test kit includes right side specific primer and/or left side
Specific primer, it is preferred that the right side specific primer includes the nucleic acid shown in SEQ ID NO.16 and SEQ ID NO.17
Shown nucleic acid；The left side specific primer includes the nucleic acid shown in SEQ ID NO.18 and the core shown in SEQ ID NO.19
Acid.
On the other hand, present invention also offers test kit as above is in detection transgenic paddy rice B2A68 or contains
Purposes in the Derivative line of the transgenic paddy rice B2A68 of nucleic acid as above.
By above-mentioned technical proposal, the present invention successfully realizes transgenic paddy rice B2A68 or is produced by B2A68 hybridization
The Derivative line containing the nucleic acid fragment detection.
Other features and advantages of the present invention will be described in detail in subsequent specific embodiment part.
Description of the drawings
Accompanying drawing is, for providing a further understanding of the present invention, and to constitute the part of description, with following tool
Body embodiment is used for explaining the present invention together, but is not construed as limiting the invention.In the accompanying drawings：
T-DNA regional structure and primer location schematic diagram of the Fig. 1 for transgenic paddy rice B2A68 used carriers.
Fig. 2 is the flanking sequence piece of the T-DNA right margins side that transgenic paddy rice B2A68 is obtained by hiTail-PCR amplifications
Section electrophoretogram.M：1Kb plus DNA marker；1、3、5：B2A68 secondary amplification products；2、4、6：The amplification of B2A68 three-levels is produced
Thing；7：Non-transgenic reference D68 secondary amplification products；8：Non-transgenic reference D68 three-level amplified productions.
Fig. 3 is the flanking sequence fragment of T-DNA left margins side in the transgenic paddy rice B2A68 obtained by LD-PCR methods
Electrophoretogram.M：1Kb plus DNA marker；Ck：Non-transgenic reference D68；1-11：Transgenic paddy rice B2A68.
Fig. 4 is exogenous sequences insertion point and its upstream and downstream gene distribution figure on rice chromosome.
Fig. 5 is the flanking sequence specific primer RB-2F/RB-2R inspections of T-DNA right margins side in transgenic paddy rice B2A68
Survey electrophoretogram.M：1Kb plus DNA marker；B：Blank；1、3、5、7、9：Transgenic paddy rice B2A68, CD083,
B2A4008S、BE7001S、B88S；2、4、6、8、10：Non-transgenic reference D68, lucky stalk 88,4008S, 7001S, P88S.
Fig. 6 is the flanking sequence specific primer LB-2F/LB-2R inspections of T-DNA right margins side in transgenic paddy rice B2A68
Survey electrophoretogram.M：1Kb plus DNA marker；B：Blank；1、3、5、7、9：Transgenic paddy rice B2A68, CD083,
B2A4008S、EB7001S、B88S；2、4、6、8、10：Non-transgenic reference D68, lucky stalk 88,4008S, 7001S, P88S.
Fig. 7 is right margin specific primer annealing temperature optimum results.M：1Kb plus DNA marker；1：52.0℃；
2：52.2℃；3：52.8℃；4：53.6℃；5：54.5℃；6：55.5℃；7：56.5℃；8：57.5℃；9：58.4℃；10：
59.2℃；11：59.8℃；12：60.0℃.
Fig. 8 is left margin specific primer annealing temperature optimum results.M：1Kb plus DNA marker；1：52.0℃；
2：52.2℃；3：52.8℃；4：53.6℃；5：54.5℃；6：55.5℃；7：56.5℃；8：57.5℃；9：58.4℃；10：
59.2℃；11：59.8℃；12：60.0℃.
Specific embodiment
Hereinafter the specific embodiment of the present invention is described in detail.It should be appreciated that described herein concrete
Embodiment is merely to illustrate and explains the present invention, is not limited to the present invention.
The invention provides a kind of nucleic acid, the nucleic acid is the nucleic acid shown in the flanking sequence of transgenic paddy rice B2A68, described
Fragment of the flanking sequence of transgenic paddy rice B2A68 for SEQ ID NO.1 or SEQ ID NO.1, SEQ ID NO.6 or SEQ ID
The fragment of NO.6；Wherein, the fragment of SEQ ID NO.1 at least includes the sequence of the 100-141 positions of SEQ ID NO.1, preferably
At least including SEQ ID NO.1 90-151 positions sequence, more preferably at least including the 80-161 positions of SEQ ID NO.1
Sequence；The fragment of SEQ ID NO.6 at least includes the sequence of the 1520-1561 positions of SEQ ID NO.6, preferably at least includes
The sequence of the 1510-1571 positions of SEQ ID NO.6, more preferably at least including SEQ ID NO.6 1500-1581 positions sequence
Row.
Present invention also offers a kind of method of detection transgenic paddy rice, the transgenic paddy rice is transgenic paddy rice B2A68
Or the Derivative line of the transgenic paddy rice B2A68 containing nucleic acid as above produced by transgenic paddy rice B2A68 hybridization, should
Method includes：
（1）Using the specific primer for nucleic acid as above, the nucleic acid samples to taking from Oryza sativa L. to be measured enter performing PCR
Amplification, obtains the product after PCR amplifications；
（2）Whether the specificity primer amplified produced by is contained in checking the product after the PCR amplifications
Purpose fragment；If containing the specificity purpose fragment in the product after PCR amplification, it indicates that the Oryza sativa L. to be measured is
The transgenic paddy rice B2A68 is hybridized the Derivative line containing the nucleic acid fragment for producing by B2A68.
According to power the method for the present invention, wherein, the fragment for SEQ ID NO.1 or SEQ ID NO.1 it is special
Property primer be refer to only expand SEQ ID NO.1 or SEQ ID NO.1 fragment shown in nucleic acid primer, it is described to be directed to
The specific primer of the fragment of SEQ ID NO.1 or SEQ ID NO.1 can not expand SEQ ID NO.1 or SEQ ID NO.1
Fragment shown in nucleic acid beyond nucleic acid, it is preferable that the spy of the fragment for SEQ ID NO.1 or SEQ ID NO.1
Specific primer includes the nucleic acid shown in SEQ ID NO.16 and the nucleic acid shown in SEQ ID NO.17；The primer amplified
The length of the purpose fragment of generation is 307bp.
The method according to the invention, wherein, the specific primer includes nucleic acid and SEQ shown in SEQ ID NO.16
During nucleic acid shown in ID NO.17, under preferable case, the condition of PCR amplifications can include that annealing temperature is 55-60 DEG C.
The method according to the invention, wherein, the specificity of the fragment for SEQ ID NO.6 or SEQ ID NO.6
Primer is the primer for referring to only expand the nucleic acid shown in the fragment of SEQ ID NO.6 or SEQ ID NO.6, described for SEQ
The specific primer of the fragment of ID NO.6 or SEQ ID NO.6 can not expand the piece of SEQ ID NO.6 or SEQ ID NO.6
The nucleic acid beyond nucleic acid shown in section, it is preferable that the specific primer includes nucleic acid and SEQ shown in SEQ ID NO.18
Nucleic acid shown in ID NO.19；The length of the purpose fragment of the specific primer is 521bp.
The method according to the invention, wherein, the specific primer includes nucleic acid and SEQ shown in SEQ ID NO.18
During nucleic acid shown in ID NO.19, under preferable case, the condition of PCR amplifications includes that annealing temperature is 52-58 DEG C（Fig. 8）.
Present invention also offers a kind of test kit, the test kit includes that right side specific primer and/or left side specificity draw
Thing, wherein, the right side specific primer includes the nucleic acid shown in SEQ ID NO.16 and the nucleic acid shown in SEQ ID NO.17；
The left side specific primer includes the nucleic acid shown in SEQ ID NO.18 and the nucleic acid shown in SEQ ID NO.19.
Test kit of the invention, wherein it is preferred to, the test kit also includes positive control nucleic acid, the positive
Control nucleic acid includes the nucleic acid shown in SEQ ID NO.1 and/or the nucleic acid shown in SEQ ID NO.6.
Test kit of the invention, wherein it is preferred to, the test kit also includes dNTPs, PCR buffer and Nai Gao
Warm archaeal dna polymerase.
Present invention also offers test kit as above is in detection transgenic paddy rice B2A68 and by transgenic paddy rice
B2A68 hybridization produces the purposes in the Derivative line of the transgenic paddy rice B2A68 containing nucleic acid as above.
The T-DNA regional structures and primer location of transgenic paddy rice B2A68 used carriers is shown in Fig. 1, and the carrier is by Cry2Aa#
Gene expression frame and Bar gene expression frames composition.The present invention extracts plant genome DNA using conventional method.Using hiTail-
PCR and LD-PCR methods, separate and extend the flanking sequence for obtaining T-DNA right margins side, as shown in SEQ ID NO.1, length
1975bp.Using the flanking sequence of the isolated T-DNA left margins side of LD-PCR methods, as shown in SEQ ID NO.6, length
2856bp。
Found by analyzing SEQ ID NO.1, wherein the 1st to the 120th bit sequence and used carrier right margin upstream sequence
Completely the same, explanation is exogenous gene sequence, the 121st to the 1975th bit sequence and No. 3 dyeing of rice genome delivered
Sequence on body（NCBI accession number AC133450.6）Unanimously, explanation is the genome sequence of transgenic paddy rice B2A68.By analysis
SEQ ID NO.6 have found, deliver sequence on its 1st to the 1541st bit sequence and No. 3 chromosomes of Oryza sativa L.（AC133450.6）It is high
Degree matching, explanation is the genome sequence of transgenic paddy rice B2A68, the 1542nd to the 2856th with carrier left margin and
CaMV35S terminators, Bar gene orders and 35S promoter partial sequence are identical, and explanation is exogenous gene sequence.
According to the right flanking sequences of T-DNA（SEQ ID NO.1）Design specific primer a, wherein primer is according to SEQ ID
1st to the 120th bit sequence design in NO.1, is that according to T-DNA right border area sequential designs, another article of primer is according to the
121 to the 1975th bit sequences are designed, i.e., design according to the Rice Genome Sequence beside insertion point.Preferably, the present invention is adopted
Forward primer is RB-2F, sequence as shown in SEQ ID NO.16 (5 '-CCAACTTAATCGCCTTGC-3 '), reverse primer
For RB-2R, sequence enters performing PCR using the primer pair as shown in SEQ ID NO.17 (5 '-GGGTTCCAATCTTGTGCC-3 ')
Detection, only transgenic paddy rice B2A68 can obtain the specific band that length is 307bp.
According to the left flanking sequences of T-DNA（SEQ ID NO.6）Design specific primer a, wherein primer is according to SEQ ID
1st to the 1541st bit sequence design in NO.6, is to design according to T-DNA left margins regional sequence, and another article of primer is according to the
1542 to the 2856th bit sequences are designed, i.e., with reference to the Rice Genome Sequence design beside insertion point.Preferably, the present invention is adopted
Forward primer is LB-2F, and sequence is reversely drawn as shown in SEQ ID NO.18 (5 '-ACATTTCATCCAGCAGCAGA-3 ')
Thing is LB-2R, and sequence is carried out using the primer pair as shown in SEQ ID NO.19 (5 '-CCAGATAAGGGAATTAGGGT-3 ')
PCR detects that only transgenic paddy rice B2A68 can obtain the specific band that length is 521bp.
The present invention obtains the left and right flanking sequence of the insertion exogenous gene of transgenic rice lines B2A68 first, and
The strain specificity qualitative PCR detection side of the transgenic paddy rice B2A68 of sensitive, specificity is established using the two flanking sequences
Method.The transgenic paddy rice B2A68 PCR method for detecting specificity set up by the present invention can further apply specific detection examination
The exploitation of agent box, with to transgenic live body（Plant, seed）, product, extract carry out the qualitative detection of transgene component, pass through
The setting of standard content sample, is also capable of achieving the exploitation of detection by quantitative and immue quantitative detection reagent box.
The present invention can be adopted the following technical scheme that：
1）Obtain right flanking sequence
Right flanking sequence of the exogenous gene of transgenic paddy rice B2A68 in rice chromosome on position, the T-DNA are right
The flanking sequence of border side, it is characterised in that：The right flanking sequence is as shown in SEQ ID NO.1.
First, the partial sequence of right flanking sequence is obtained by hiTail-PCR amplifications, as shown in SEQ ID NO.2, entirely
Long 591bp.T-DNA sequence of the specificity nested primerss used by hiTail-PCR according to plant expression vector pC3300-Cry2Aa#
Right margin（RB）Upstream lacZ gene sequential design.The data referenced patent of plant expression vector pC3300-Cry2Aa#
（201210280832.4）.HiTail-PCR method lists of references（Liu et al.,2007,BioTechniques,43(5):
649-456）, wherein：Rb-0b sequences be 5 '-CGTGACTGGGAAAACCCTGGCGTT-3 ', Rb-1b sequences be 5 '-
ACGATGGACTCCAGAGCGGCCGCCGACCCAACTTAATCGCCTTGCAGCACATC-3 ', Rb-2b sequence be 5 '-
GAAGAGGCCCGCACCGATCGCCCTT-3’.HiTail-PCR amplifications obtain the segment of 591bp length.
Find that the wherein the 1st to the 120th nucleotide sequence is completely the same with used carrier right border sequence by analysis；The
121 to the 591st bit sequences and NCBI on No. 3 chromosome of rice genome（http://www.ncbi.nlm.nih.gov）Step on
Record number is the 36171st to the 36641st of the sequence of AC133450.6 and matches completely.
Secondly, using the primers RBGF shown in SEQ ID NO.2, sequence is as shown in SEQ ID NO.3（5'-
TCGGCACAAGATTGGAAC-3'）, with reference to Rice Genome Sequence（NCBI accession number AC133450.6）Design primer RBGR,
Sequence is as shown in SEQ ID NO.4（5'-TGCAGTTGAGGTCGGTGT-3'）, expanded using RBGF and RBGR primer pairs PCR
To the genome sequence of the transgenic paddy rice B2A68 of 1740bp, as shown in SEQ ID NO.5, the sequence and online listed Jing
Rice sequence（AC133450.6）It is identical.
Then, two sequence SEQ ID NO.2 and SEQ ID NO.5 splicings for being expanded acquisition twice obtain right side sequence
Row SEQ ID NO.1, sequence 1975bp, comprising the exogenous gene sequence of the 1st to the 120th（Carrier sequence）With
The Rice Genome Sequence of 121 to the 1975th.
2）Obtain left flanking sequence
In the present invention, the exogenous gene of transgenic paddy rice B2A68 is additionally provided on a left side for rice chromosome on position
Flanking sequence, the flanking sequence of the T-DNA left margins side, it is characterised in that：The left flanking sequence such as SEQ ID NO.6 institutes
Show.
First, the left side partial sequence, as shown in SEQ ID NO.7, it is obtained by LD-PCR amplifications, total length
925bp.Concrete grammar is：Forward primer LB-1F is designed with reference to the site upstream Rice Genome Sequence announced, sequence is such as
Shown in SEQ ID NO.8（5’-GGCGTCACGTTTGTTGTT-3’）, according to T-DNA left margin sequential design reverse primer LB-
1R, sequence is as shown in SEQ ID NO.9（5’-CTGCCCGTCACCGAGATT-3）, transgenic water is obtained with the primer pair amplifies
The left flanking sequence in part of rice B2A68, as shown in SEQ ID NO.7, length is 925bp.Sent out by analyzing SEQ ID NO.7
It is existing, in addition to the 612nd has an A base deletion compared with No. 3 chromosomes of Oryza sativa L. the 36169th, remaining the 1st to the 613rd
Matched with 35557- the 36170th on No. 3 chromosome of Oryza sativa L. completely；614th to the 925th and carrier pC3300-
The left margin and CaMV35S terminator partial sequences of Cry2Aa# is identical.
Secondly, Rice Genome Sequence is announced in reference（NCBI accession number AC133450.6）Design primer LBGF, sequence
As shown in SEQ ID NO.10（5’-TAAACTGTTAGGCGGTGGA-3’）, using SEQ ID NO.7 primers
LBGR, sequence is as shown in SEQ ID NO.11（5’-TCGTGGAAATTGTGAGGG-3’）, using LBGF and LBGR primer pairs PCR
Amplification obtains the genome sequence of transgenic paddy rice B2A68, sequence as shown in SEQID NO.12, total length 1113bp.
Again, using SEQ ID NO.7 primers LBTF, sequence is as shown in SEQ ID NO.13（5'-
CCCTTATCTGGGAACTACTCAC-3'）, using 35S promoter primers LBTR on carrier pC3300-Cry2Aa#,
Sequence is as shown in SEQ ID NO.14（5'-TAACATGGTGGAGCACGACA-3'）, expanded using LBTF and LBTR primer pairs PCR
Increase to obtain sequence, as shown in SEQ ID NO.15, the sequence is identical with the corresponding sequence of carrier pC3300-Cry2Aa#, entirely for the sequence
Long 1068bp.
Finally, SEQ ID NO.7, SEQ ID NO.12 and SEQ ID NO.15 splicing is obtained into left boundary flanking sequence,
Sequence as shown in SEQ ID NO.6, total length 2856bp.Wherein the 1st to the 1541st is Rice Genome Sequence, and the 1542nd extremely
2856th is exogenous gene sequence（Carrier sequence）.
3）B2A68 transformation event method for detecting specificity based on right flanking sequence
The qualitative PCR detection method of the right flanking sequence of the external source Insert Fragment of transgenic rice lines B2A68, its feature
It is：Two primers in the PCR reactions are combined as the specific primer of the flanking sequence of T-DNA right margins：One primer
According to the 1st to the 120th bit sequence design in SEQ ID NO.1, another article of primer is according to the in SEQ ID NO.1 the 121st to the
1975 bit sequences are designed.
Preferably, the specific primer is as follows：
Forward primer RB-2F, sequence as shown in SEQ ID NO.16 (5 '-CCAACTTAATCGCCTTGC-3 '), foundation
1st to the 120th bit sequence design in SEQ ID NO.1；
Reverse primer RB-2R, sequence as shown in SEQ ID NO.17 (5 '-GGGTTCCAATCTTGTGCC-3 '), foundation
121st to the 1975th bit sequence design in SEQ ID NO.1；
Expanded using above-mentioned primer pair, transgenic rice lines B2A68 can obtain the purpose piece that length is 307bp
The transgenic paddy rice of section, non-transgenic Oryza sativa L. and the non-transformation event can not obtain purpose segment or size identical purpose piece
It is disconnected.
4）B2A68 transformation event method for detecting specificity based on left flanking sequence
The qualitative PCR detection method of the left flanking sequence of the external source Insert Fragment of transgenic rice lines B2A68, its feature
It is：Two primers in the PCR reactions are combined as the specific primer of T-DNA left boundary flanking sequences：One primer according to
Design according to the 1st to the 1541st bit sequence in SEQ ID NO.6, another article of primer is according to the in SEQ ID NO.6 the 1542nd to the
2856 bit sequences are designed.
Preferably, the specific primer is as follows：
Forward primer LB-2F, sequence such as SEQ ID NO.18:Shown (5 '-ACATTTCATCCAGCAGCAGA-3 '), according to
Design according to the 1st to the 1541st bit sequence in SEQ ID NO.6；
Reverse primer LB-2R, sequence such as SEQ ID NO.19:Shown (5 '-CCAGATAAGGGAATTAGGGT-3 '), according to
Design according to the 1542nd to the 2856th bit sequences of SEQ ID NO.6；
Expanded using above-mentioned primer pair, transgenic rice lines B2A68 can obtain the purpose piece that length is 521bp
The transgenic paddy rice of section, non-transgenic Oryza sativa L. and the non-transformation event can not obtain purpose segment or size identical purpose piece
It is disconnected.
5）Multi-PCR detection method based on left and right flanking sequence
1 specific primer is designed according to the 1st to the 120th bit sequence in SEQ ID NO.1, according in SEQ ID NO.1
121st to the 1975th bit sequence designs 1 specific primer, obtains 1 specific primer pair of right flanking sequence；According to SEQ
In ID NO.6, the 1st to the 1541st bit sequence designs 1 specific primer, according to the 1542nd to the 2856th in SEQ ID NO.6
1 specific primer of sequential design, obtains 1 specific primer pair of left flanking sequence；With this 2 specific primers to simultaneously
Amplification transgenic paddy rice genomic DNA, while obtaining the special band of 2 targets on left and right border.
Preferably, performing PCR amplification is entered with specific primer LB-2F, LB-2R, RB-2F and RB-2R to testing sample DNA,
Transgenic paddy rice B2A68 amplification obtain 521bp and 307bp 2 purpose fragments, other all Oryza sativa L. will not obtain band or
The target stripe of above-mentioned formed objects.
Hereinafter, the present invention, the test of unreceipted actual conditions in the following example are further described by embodiment
Method, is carried out according to normal condition, for example《Molecular cloning：Laboratory manual》Described in condition, or according to institute of manufacturer
The condition of suggestion.
Embodiment 1：The amplification of transgenic rice lines B2A68 right boundary flanking sequences
The extraction of 1.DNA：CTAB methods（Wang Guanlin etc., plant genetic engineering, Beijing：Science Press, 2009）.Take 2.0 μ
1.0% agarose gel electrophoresiies of L DNA detect its integrity, and determine DNA concentration with micro ultraviolet spectrophotometer.
2.hiTail-PCR separates the right flanking sequences of T-DNA：Reference Liu etc. (Liu et al., 2007,
BioTechniques,43(5):Method 649-456) is carried out, and each random primer is to repeat amplification protcol three times.Amplified production is used
1.0% agarose gel electrophoresiies are separated.The primer sequence is shown in Table 1, and amplification program is shown in Table 2.
Table 1：HiTail-PCR the primers
Table 2：HiTail-PCR amplification programs
3. the extension of right flanking sequence：Obtained sequence is expanded using hiTAIL-PCR（SEQ ID No.2）Design is drawn
Thing RBGF, sequence is as shown in SEQ ID NO.3（5'-TCGGCACAAGATTGGAAC-3'）, with reference to Rice Genome Sequence
（NCBI accession number AC133450.6）Design primer RBGR, sequence is as shown in SEQ ID NO.4（5'-
TGCAGTTGAGGTCGGTGT-3'）, using RBGF and RBGR primer pair amplifies transgenic paddy rice B2A68.Wherein, transgenic water
Rice new lines B2A68 are in document（Hybrid rice, 2013,28 (1):63-67）Disclosed in, can be by the Chinese Academy of Sciences
The mode that subtropical zones Agro-ecology institute letter is asked for is obtained, and the Institute of Subtropical Agriculture, The Chinese Academy of Sciences ensures from this
Transgenic paddy rice new lines B2A68 are provided to the public in 20 years from the applying date of invention.Amplification system is：20 μ L PCR react
System includes 1 × PCR Buffer, 200 μM of dNTPs, 1 μM of forward primer LBGF and 1 μM of reverse primer LBGR, 0.5U Taq
Archaeal dna polymerase and 20ng DNA profilings.PCR amplification programs are：95℃5min；34 circulations（94 DEG C of 30s, 57 DEG C of 30s, 72 DEG C
1min）；72℃10min.
The clone of 4.PCR products and sequencing：Pcr amplification product is separated with 1.0% agarose gel electrophoresiies, is cut corresponding
Specific band, reclaims specific fragment with Takara gel reclaims kits, and is cloned into pMD19-T simple vector,
Selecting positive colony send Guangzhou Ying Jun biotech firms to be sequenced.Sequence comparing analysis are carried out with the Blast softwares of NCBI.
5. result
According to 3 nested specific primers of the carrier sequence of T-DNA right margins design（RB-0b, RB-1b and RB-
2b）When combining with random primer LAD2, specific band is amplified in transgenic paddy rice B2A68, as shown in Figure 2.To LAD2
The third round product for amplifying carries out reclaiming, clone and sequencing obtains 591bp right margin fusion sequences, sequence such as SEQ ID
Shown in No.2.1740bp sequences are obtained using RBGF/RBGR primer pair amplifies, sequence is as shown in SEQ ID No.5.SEQ ID
No.2 with SEQ ID No.5 phases are spliced and obtain right flanking sequence, and sequence is as shown in SEQ ID No.1；The feature of the sequence is：The
1 to the 120th is the exogenous gene sequence in insertion Oryza sativa L.（Carrier sequence）, the 121st to the 1975th is rice genome sequence
Row, with sequence on No. 3 chromosome of the Oryza sativa L. announced（AC133450.6）Match completely.
Embodiment 2：The amplification of transgenic rice lines B2A68 left boundary flanking sequences
The extraction of 1.DNA：With embodiment 1
2. long-chain PCR（Long distance PCR,LD-PCR）：The lengthy motion picture that long-chain PCR is used in amplifying rice genome
Section.The left flanking sequences of T-DNA of the exogenous insertion vector in this example for expanding transgenic paddy rice B2A68.Primer sequence is shown in
Table 3.LD-PCR amplification systems are：20 μ L PCR reaction systems include 1 × PCR Buffer, 200 μM of dNTPs, and 1 μM positive
Primer（LB-1F,LBGF,LBTF）With 1 μM of reverse primer（LB-1R,LBGR,LBTR）, 0.5U Taq archaeal dna polymerases and 20ng
DNA profiling.LD-PCR amplification programs are：95℃5min；34 circulations（94 DEG C of 30s, anneal 30s, 72 DEG C of 1min）；72℃
10min。
Table 3：For the primer sequence and annealing temperature of LD-PCR
The clone of 3.PCR products and sequencing：Carried out using method same as Example 1.
4. result
Using primer pair LB-1F/LB-1R enter performing PCR amplification, obtain sequence as shown in SEQ ID NO.7, length 925bp,
As shown in Figure 3.Using primer pair LBGF/LBGR enter performing PCR amplification, obtain sequence as shown in SEQ ID NO.12, total length
1113bp.Using primer pair LBTF/LBTR enter performing PCR amplification, obtain sequence as shown in SEQ ID NO.15, total length 1068bp.
SEQ ID NO.7, SEQ ID NO.12 and SEQ ID NO.15 splicing is obtained into left boundary flanking sequence, sequence such as SEQ ID
Shown in NO.6, total length 2856bp.Wherein：1st to the 1541st is Rice Genome Sequence, and the 1542nd to the 2856th is outer
Source gene order（Carrier sequence）.
By the analysis to the left and right border flanking sequences of transgenic paddy rice B2A68, it is found that its exogenous gene is inserted in Oryza sativa L.
The 36170th of No. 3 chromosome, compared with the Jing rice sequences delivered, the 36179th disappearance for having 1 base of flanking sequence,
Caused by being likely due to the insertion of exogenous gene, it is also possible to which the sequence of the Oryza sativa L. is exactly such.Compared with carrier sequence, turn
In trans-genetic hybrid rice, external source Gene Partial has disappearance and the replacement of 8 bases of 13 bases.It is water at exogenous gene insertion point
The non-coding sequence area of rice, its upstream and downstream gene nearby and insertion sequence it is as shown in Figure 4.
Embodiment 3：Qualitative PCR detection method based on the flanking sequence of the external source Insert Fragment of transgenic paddy rice B2A68
The extraction and detection of 1.DNA：Carried out using method same as Example 1.
2. the strain specificity PCR based on left and right flanking sequence is detected：According to the right side sequence obtained in embodiment 1 and 2
Row and left flanking sequence, respectively according to its Rice Genome Sequence part and exogenous gene sequence（Carrier sequence）Design special in part
Specific primer, it is preferred that primer sequence is shown in Table 4.PCR reaction systems are：20 μ L PCR reaction systems include 1 × PCR
Buffer, 200 μM of dNTPs, 1 μM of forward primer（RB-2F or LB-2F）, 1 μM of reverse primer（RB-2R or LB-2R）, 0.5U
Taq archaeal dna polymerases and 20ng DNA profilings.Amplification program is：95℃5min；34 circulations（94 DEG C of 30s, anneal 30s, 72 DEG C
1min）；72℃10min.Product analysis are carried out using 1.0% agarose gel electrophoresiies.
Table 4：The event-specific detection of the T-DNA right margins side and T-DNA left margins side of transgenic rice lines B2A68
Primer
The clone of 3.PCR products and sequencing：Carried out using method same as Example 1.
4. result：Enter performing PCR amplification using primer pair RB-2F/RB-2R, only obtain in transgenic paddy rice B2A68
The amplified production of 307bp, and amplified production is not obtained in other transgenic rice lines and check variety, see Fig. 5.Utilize
Primer pair LB-2F/LB-2R enters performing PCR amplification, and the amplified band of 521bp is only obtained in transgenic paddy rice B2A68, and at other
Amplified production is not obtained in transgenic rice lines and check variety, Fig. 6 is seen.Wherein, transgenic paddy rice B2A68 is used as detection
Standard substance（Hybrid rice, 2013,28 (1):63-67）, non-transgenic control is CD083, B2A4008S, EB7001S and B88S（It is miscellaneous
Friendship Oryza sativa L., 2013,28 (1):63-67）, non-transgenic reference is D68（Hybrid rice, 1998,13 (3):6-7）, lucky stalk 88（It is lucky
Woods agricultural sciences, 2006,31 (5):22-23）、4008S（Pacify and rouse agricultural sciences, 1996,24 (4):294-296）、7001S（Peace
Rouse agricultural sciences, 1994,22 (1):11-15）And P88S（Seed, 2008,27 (11):123-125）.Above-mentioned Oryza sativa L. exists
Disclosed in respective document, can be obtained by way of asking for the Institute of Subtropical Agriculture, The Chinese Academy of Sciences's letter,
The Institute of Subtropical Agriculture, The Chinese Academy of Sciences ensures to provide above-mentioned water to the public in 20 years from the applying date of the present invention
Rice.
The preferred embodiment of the present invention described in detail above, but, the present invention is not limited in above-mentioned embodiment
Detail, the present invention range of the technology design in, various simple variants can be carried out to technical scheme, this
A little simple variants belong to protection scope of the present invention.
It is further to note that each particular technique feature described in above-mentioned specific embodiment, in not lance
In the case of shield, can be combined by any suitable means, in order to avoid unnecessary repetition, the present invention to it is various can
The compound mode of energy is no longer separately illustrated.
Additionally, combination in any between a variety of embodiments of the present invention, can also be carried out, as long as which is without prejudice to this
The thought of invention, which should equally be considered as content disclosed in this invention.
Claims (14)
1. a kind of nucleic acid, nucleic acid of the nucleic acid shown in the flanking sequence of transgenic paddy rice B2A68, the transgenic paddy rice
Fragment of the flanking sequence of B2A68 for SEQ ID NO.1 or SEQ ID NO.1, the piece of SEQ ID NO.6 or SEQ ID NO.6
Section；Wherein, the fragment of SEQ ID NO.1 at least includes the sequence of the 100-141 positions of SEQ ID NO.1, SEQ ID NO.6's
Fragment at least includes the sequence of the 1520-1561 positions of SEQ ID NO.6.
2. nucleic acid according to claim 1, the 90- of the fragment of the SEQ ID NO.1 at least including SEQ ID NO.1
The sequence of 151.
3. nucleic acid according to claim 1 and 2, the fragment of the SEQ ID NO.1 at least including SEQ ID NO.1 the
The sequence of 80-161 positions.
4. nucleic acid according to claim 1, the fragment of the SEQ ID NO.6 at least including SEQ ID NO.6 the
The sequence of 1510-1571 positions.
5. the nucleic acid according to claim 1 or 4, the fragment of the SEQ ID NO.6 at least including SEQ ID NO.6 the
The sequence of 1500-1581 positions.
6. it is a kind of detection transgenic paddy rice method, the transgenic paddy rice be transgenic paddy rice B2A68 or by B2A68 hybridization produce
The Derivative line of the raw transgenic paddy rice B2A68 containing the nucleic acid described in any one in claim 1-5, the method include：
(1) using the specific primer for the nucleic acid in claim 1-5 described in any one, the core to taking from Oryza sativa L. to be measured
Sour sample enters performing PCR amplification, obtains the product after PCR amplifications；
(2) whether contain the specificity purpose piece that the primer amplified is produced in checking the product after the PCR amplifications
Section；If containing the specificity purpose fragment in the product after the PCR amplifications, it indicates that the Oryza sativa L. to be measured is described turn
Trans-genetic hybrid rice B2A68 or by B2A68 hybridize produce containing claim 1-5 in nucleic acid described in any one transgenic
The Derivative line of Oryza sativa L. B2A68.
7. method according to claim 6, wherein, the specific primer be the nucleic acid shown in SEQ ID NO.16 and
Nucleic acid shown in SEQ ID NO.17；The length of the purpose fragment that the primer amplified is produced is 307bp.
8. method according to claim 7, wherein, the condition of PCR amplifications includes that annealing temperature is 55-60 DEG C.
9. method according to claim 6, wherein, the specific primer be the nucleic acid shown in SEQ ID NO.18 and
Nucleic acid shown in SEQ ID NO.19；The length of the purpose fragment that the primer amplified is produced is 521bp.
10. method according to claim 9, wherein, the condition of PCR amplifications includes that annealing temperature is 52-58 DEG C.
A kind of 11. test kits, the test kit include right side specific primer and/or left side specific primer, wherein, the right side
Specific primer is the nucleic acid and the nucleic acid shown in SEQ ID NO.17 shown in SEQ ID NO.16；The left side specific primer
The nucleic acid shown in nucleic acid and SEQ ID NO.19 shown in SEQ ID NO.18.
12. test kits according to claim 11, wherein, the test kit also includes positive control nucleic acid, the positive
Control nucleic acid is the nucleic acid and/or the nucleic acid shown in SEQ ID NO.6 shown in SEQ ID NO.1.
13. test kits according to claim 11 or 12, wherein, the test kit also include dNTPs, PCR buffer and
High temperature-resisting DNA polymerase.
Test kit in 14. claim 11-13 described in any one is in detection transgenic paddy rice B2A68 or miscellaneous by B2A68
Purposes in the Derivative line of the transgenic paddy rice B2A68 containing the nucleic acid described in any one in claim 1-5 that friendship is produced.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310068126.8A CN104031912B (en) | 2013-03-04 | 2013-03-04 | Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201310068126.8A CN104031912B (en) | 2013-03-04 | 2013-03-04 | Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN104031912A CN104031912A (en) | 2014-09-10 |
| CN104031912B true CN104031912B (en) | 2017-05-03 |
Family
ID=51462910
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201310068126.8A Active CN104031912B (en) | 2013-03-04 | 2013-03-04 | Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN104031912B (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107267503B (en) * | 2016-04-06 | 2021-01-01 | 中国科学院亚热带农业生态研究所 | Nucleic acid, method for detecting transgenic rice B1C893 and derivative line thereof, kit and application thereof |
| CN112301146A (en) * | 2020-10-13 | 2021-02-02 | 中国农业科学院生物技术研究所 | RPA detection primer and probe combination, kit and detection method for transgenic rice B2A68-1 |
| CN112592920B (en) * | 2020-12-16 | 2022-05-06 | 中国农业科学院生物技术研究所 | Complete sequence of exogenous insertion fragment of transgenic rice mfb-MH3301 and flanking sequence thereof |
| CN112899392B (en) * | 2021-03-10 | 2022-05-13 | 浙江大学 | Primer group for specific identification molecular marker of transgenic insect-resistant and glyphosate-resistant cotton and application thereof |
Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240279A (en) * | 2007-02-09 | 2008-08-13 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 |
| CN101240278B (en) * | 2007-02-09 | 2011-07-06 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kemingdao 1 |
| CN102212528A (en) * | 2010-04-01 | 2011-10-12 | 浙江省农业科学院 | Flanking sequence of foreign insert of transgene rice strain |
| CN102628040A (en) * | 2012-03-27 | 2012-08-08 | 山东农业大学 | Flanking sequence of exogenous insert vector for transgenic rice and application of flanking sequence |
| CN102888398A (en) * | 2011-07-22 | 2013-01-23 | 中国农业科学院生物技术研究所 | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof |
-
2013
- 2013-03-04 CN CN201310068126.8A patent/CN104031912B/en active Active
Patent Citations (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101240279A (en) * | 2007-02-09 | 2008-08-13 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kefeng 6 |
| CN101240278B (en) * | 2007-02-09 | 2011-07-06 | 中国农业科学院植物保护研究所 | Side sequence of exogenous insert of transgene paddy strain Kemingdao 1 |
| CN102212528A (en) * | 2010-04-01 | 2011-10-12 | 浙江省农业科学院 | Flanking sequence of foreign insert of transgene rice strain |
| CN102888398A (en) * | 2011-07-22 | 2013-01-23 | 中国农业科学院生物技术研究所 | Flanking sequence of exogenous insertion fragment of transgenic rice variety Bar68-1 and application thereof |
| CN102628040A (en) * | 2012-03-27 | 2012-08-08 | 山东农业大学 | Flanking sequence of exogenous insert vector for transgenic rice and application of flanking sequence |
Non-Patent Citations (7)
| Title |
|---|
| AC_133450.6;Genbank;《NCBI》;20040731;全文 * |
| Generation and flanking sequence analysis of a rice T-DNA tagged population;Y. She et al.;《Theoretical and applied genetics》;20030919;第306-314页 * |
| High-efficiency thermal asymmetric interlaced PCRfor amplificaiton of unknown flanking sequences;Liu YG et al.;《Biotechniques》;20071130;第649-650页 * |
| Transgene structures in T-DNA-inserted rice plants;Sung-Ryul Kim et al.;《Plant Molecular Biology》;20030731;第761-773页 * |
| 抗虫抗除草剂转基因水稻恢复系B2A68 的培育;翁绿水 等;《杂交水稻》;20130131;第63-67页 * |
| 曲霉phyA基因的克隆及在Pichia pastois中的分泌表达;蒋利平;《中国优秀硕士学位论文全文数据库 基础科学辑》;20070815;A006-35 * |
| 转基因玉米MON88017旁侧序列分析及定性PCR检测;袁磊 等;《作物学报》;20101231;全文 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN104031912A (en) | 2014-09-10 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Nadeem et al. | DNA molecular markers in plant breeding: current status and recent advancements in genomic selection and genome editing | |
| ES2785329T3 (en) | Methods and Compositions for Identifying and Enriching Cells Comprising Site-Specific Genomic Modifications | |
| Chung et al. | Chromosomal polymorphism of ribosomal genes in the genus Oryza | |
| Rosato et al. | Conserved organisation of 45S rDNA sites and rDNA gene copy number among major clades of early land plants | |
| CN104419708B (en) | Nucleic acid and detection transgenic paddy rice EB7001S and its method for Derivative line and kit and application thereof | |
| Kalendar et al. | Retrotransposable elements: DNA fingerprinting and the assessment of genetic diversity | |
| CN104031912B (en) | Nucleic acid, method for detecting transgenic rice B2A68 and derived line thereof, and kit and application thereof | |
| Duan et al. | Physical location of new PCR-based markers and powdery mildew resistance gene (s) on rye (Secale cereale L.) chromosome 4 using 4R dissection lines | |
| CN104672315B (en) | Control gene and to Cucumber Roll palpus character related SNP marker of the cucumber without tendril character | |
| Huang et al. | The maize B chromosome is capable of expressing microRNAs and altering the expression of microRNAs derived from A chromosomes | |
| CN102162012A (en) | Qualitative PCR detection method for transgenic rice kefeng No. 6 | |
| CN101824411A (en) | Flanking sequence of transgenic rice Kefeng No. 6 and qualitative PCR detection method | |
| Zeng et al. | Identification of genomic insertion and flanking sequences of the transgenic drought-tolerant maize line “SbSNAC1-382” using the single-molecule real-time (SMRT) sequencing method | |
| CN103215346A (en) | Recombinant standard plasmid and kit used in transgenic rice screening | |
| Bhat et al. | Developing transposable element marker system for molecular breeding | |
| CN104988236B (en) | The strain specificity quantitative PCR detection kit of transgenic wheat B73 61 a kind of and application | |
| CN103146824A (en) | Recombinant standard plasmid and kit for PCR (Polymerase Chain Reaction) detection of transgenic rice | |
| CN103667475B (en) | A kind of detection method turning Cry1Ab anti insect gene rice strain mfb-MH86 | |
| CN102586306A (en) | Standard plasmid molecules for transgenetic soybean BPS-CV127-9 detection, constructing method thereof and application thereof | |
| TW201307569A (en) | Method and kit for plant species identification | |
| Shirao et al. | Development of DNA markers for identifying chrysanthemum cultivars generated by ion-beam irradiation | |
| CN105671180B (en) | Lead to the increased related gene of Grain Weight in Common Wheat and its application | |
| CN107267503B (en) | Nucleic acid, method for detecting transgenic rice B1C893 and derivative line thereof, kit and application thereof | |
| CN108251551A (en) | Using the joint inspection of RPA-DNA test strips to transgenic paddy rice PA110-15 event-specific detection methods | |
| KR101546428B1 (en) | SCAR marker for cultivar discrimination in Korean breeding wheat and use thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Application publication date: 20140910 Assignee: Hunan Luojia Biotechnology Co.,Ltd. Assignor: INSTITUTE OF SUBTROPICAL AGRICULTURE, CHINESE ACADEMY OF SCIENCES Contract record no.: X2024980010218 Denomination of invention: Nucleic acid testing and detection of transgenic rice B2A68 and its derivative lines, as well as the method and reagent kit and their applications Granted publication date: 20170503 License type: Exclusive License Record date: 20240722 |