CN113957149A - Kit for detecting expression quantity of alpha-fetoprotein gene and PGR13 gene and application thereof - Google Patents

Kit for detecting expression quantity of alpha-fetoprotein gene and PGR13 gene and application thereof Download PDF

Info

Publication number
CN113957149A
CN113957149A CN202111324996.8A CN202111324996A CN113957149A CN 113957149 A CN113957149 A CN 113957149A CN 202111324996 A CN202111324996 A CN 202111324996A CN 113957149 A CN113957149 A CN 113957149A
Authority
CN
China
Prior art keywords
gene
pgr13
alpha
liver cancer
fetoprotein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Granted
Application number
CN202111324996.8A
Other languages
Chinese (zh)
Other versions
CN113957149B (en
Inventor
杜飞
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Yuanjian Biotechnology Shanghai Co ltd
Original Assignee
Yuanjian Biotechnology Shanghai Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Yuanjian Biotechnology Shanghai Co ltd filed Critical Yuanjian Biotechnology Shanghai Co ltd
Priority to CN202111324996.8A priority Critical patent/CN113957149B/en
Publication of CN113957149A publication Critical patent/CN113957149A/en
Application granted granted Critical
Publication of CN113957149B publication Critical patent/CN113957149B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • C12Q1/6851—Quantitative amplification
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Immunology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Genetics & Genomics (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biophysics (AREA)
  • General Engineering & Computer Science (AREA)
  • Biotechnology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biochemistry (AREA)
  • Hospice & Palliative Care (AREA)
  • Oncology (AREA)
  • Epidemiology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides a kit for detecting expression levels of an alpha-fetoprotein gene and a PGR13 gene and application thereof, wherein the kit comprises a primer pair for respectively and specifically amplifying the alpha-fetoprotein gene and the PGR13 gene. The mRNA gene chip is used for analyzing the liver cancer tissues and the tissues beside the cancer, and the analysis and screening results show that the PGR13 gene has differential expression in the liver cancer tissues and the tissues beside the cancer. In the invention, the alpha fetoprotein gene and the PGR13 gene are used as liver cancer markers, the alpha fetoprotein gene and the PGR13 gene are both obviously highly expressed in liver cancer tissues and are in positive correlation, and compared with the method of singly using the alpha fetoprotein gene as a diagnosis index, the combined diagnosis of the alpha fetoprotein gene and the PGR13 gene has higher sensitivity and specificity.

Description

Kit for detecting expression quantity of alpha-fetoprotein gene and PGR13 gene and application thereof
Technical Field
The invention belongs to the field of biological medicines, and relates to a kit for detecting expression levels of alpha-fetoprotein gene and PGR13 gene and application thereof.
Background
The primary liver cancer is one of malignant tumors with high morbidity and mortality, Hepatocellular Carcinoma (HCC) accounts for a high proportion in the primary liver cancer, and most patients have reached a middle and advanced stage at the time of diagnosis due to lack of effective detection and diagnosis indexes, so that early treatment is missed. The liver cancer has high malignancy, unobvious early symptoms and rapid disease development, and is easy to have intrahepatic metastasis and multiple metastasis of other organs, so the early diagnosis of the liver cancer is the key of clinical diagnosis and treatment.
The current clinical screening method for liver cancer comprises B-ultrasonic imaging and serum content screening of tumor marker Alpha Fetoprotein (AFP).
Patent CN101984919A discloses a method for early detection of a lesion tissue target of liver cancer by three-dimensional ultrasonic imaging, which processes a scanned image to effectively reflect the phonography information in a three-dimensional manner, and the display precision of the image partially achieves the effect of a low power microscope, thus having important application value for diagnosing liver fibrosis, inflammation stage of chronic hepatitis, liver cirrhosis, early diagnosis of liver cancer and the like. However, the imaging means has low sensitivity to early HCC diagnosis, and has difficulty in detecting HCC postoperative recurrence.
Patent CN112098648A discloses a method for detecting serum biomarkers of liver cancer patients, wherein alpha fetoprotein is closely related to the occurrence and development of various tumors, is mainly clinically used as a serum marker of liver cancer, and is used for diagnosis and curative effect monitoring of primary liver cancer. Therefore, the high-sensitivity detection of the alpha-fetoprotein has important significance for early diagnosis and treatment of liver cancer patients. The method for detecting the serum biomarker of the liver cancer patient utilizes polydopamine and hollow nanogold to construct the signal controlled-release nanomaterial, and realizes simple and efficient detection of AFP. Despite its high sensitivity of detection, its false negative rate is as high as 40%, and some non-neoplastic diseases, such as hepatitis and liver cirrhosis, may have elevated AFP in the blood of their patients.
Therefore, the method searches for a new index which can be used for early diagnosis of the liver cancer, improves the accuracy of diagnosis, is beneficial to early discovery and early treatment of the liver cancer, and has important significance for treatment and diagnosis of the liver cancer.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide a kit for detecting expression levels of an alpha-fetoprotein gene and a PGR13 gene (G protein-coupled receptor 13, PGR13 and G protein coupled receptor 13) and application thereof, wherein the kit comprises a primer pair for respectively and specifically amplifying the alpha-fetoprotein gene and the PGR13 gene. The mRNA gene chip is used for analyzing the liver cancer tissue and the tissues beside the cancer, and the analysis and screening results show that the PGR13 gene has differential expression in the liver cancer tissue and the tissues beside the cancer. In the invention, the alpha fetoprotein gene and the PGR13 gene are used as liver cancer markers, the alpha fetoprotein gene and the PGR13 gene are both obviously highly expressed in liver cancer tissues and are in positive correlation, and compared with the method of singly using the alpha fetoprotein gene as a diagnosis index, the combined diagnosis of the alpha fetoprotein gene and the PGR13 gene has higher sensitivity and specificity.
In order to achieve the purpose, the invention adopts the following technical scheme:
in a first aspect, the invention provides a kit for detecting expression levels of an alpha-fetoprotein gene and a PGR13 gene, wherein the kit comprises a primer pair for specifically amplifying the alpha-fetoprotein gene and the PGR13 gene respectively.
The mRNA gene chip is used for analyzing the genes with different expressions in the liver cancer tissue and the tissues beside the cancer, and the result shows that the relative expression amount of the PGR13 gene in the liver cancer tissue is higher than that in the tissues beside the cancer.
Preferably, the upstream primer for specifically amplifying the alpha-fetoprotein gene in the kit comprises a nucleotide sequence shown in SEQ ID No.1, and the downstream primer for specifically amplifying the alpha-fetoprotein gene comprises a nucleotide sequence shown in SEQ ID No. 2.
In the present invention, SEQ ID No. 1: CTTTGGGCTGCTCGCTATGA, respectively;
SEQ ID No.2：GCATGTTGATTTAACAAGCTGCT。
preferably, an upstream primer for specifically amplifying the PGR13 gene in the kit comprises a nucleotide sequence shown in SEQ ID No.3, and a downstream primer for specifically amplifying the PGR13 gene comprises a nucleotide sequence shown in SEQ ID No. 4.
In the present invention, SEQ ID No. 3: TAGTGACACCCCACTTAATCAGC, respectively;
SEQ ID No.4：AGGTAGGTCAAGCGAAATGGC。
preferably, the kit further comprises a PCR buffer solution, an enzyme mixture solution and a fluorescent dye.
Preferably, the kit further comprises a primer pair for specifically amplifying the reference gene.
In the invention, the upstream primer of the specific amplification reference gene in the kit comprises a nucleotide sequence shown by SEQ ID No.5, and the downstream primer of the specific amplification reference gene comprises a nucleotide sequence shown by SEQ ID No. 6.
In the present invention, SEQ ID No. 5: CTCACCGGATGCACCAATGTT, respectively;
SEQ ID No.6：CGCGTTGCTCACAATGTTCAT。
according to the invention, RT-qPCR verifies that the alpha-fetoprotein gene and the PGR13 gene are significantly and highly expressed in liver cancer tissues and are in positive correlation, and the alpha-fetoprotein gene and the PGR13 gene can be used as marker combinations for diagnosing liver cancer to assist clinical diagnosis and treatment. The alpha fetoprotein gene and PGR13 gene combined diagnosis has higher specificity and sensitivity, and provides basis for clinical diagnosis and treatment.
In a second aspect, the present invention provides a method for using the kit for detecting expression levels of an alpha fetoprotein gene and a PGR13 gene according to the first aspect for the purpose of non-disease diagnosis and/or treatment, the method comprising:
and performing RT-qPCR detection on the cancer tissue to be detected and the paracancer tissue by using the primer pair for respectively and specifically amplifying the alpha-fetoprotein gene and the PGR13 gene, calculating the relative expression quantity of the alpha-fetoprotein gene and the PGR13 gene in the cancer tissue to be detected and the paracancer tissue, and performing calculation analysis.
Preferably, the method of use comprises the steps of:
(1) preparing a template: extracting total RNA in the cancer tissue to be detected and the tissue beside the cancer and carrying out reverse transcription to synthesize cDNA;
(2) and (3) detection: detecting the obtained cDNA by RT-qPCR by using the primer pairs for respectively and specifically amplifying the alpha-fetoprotein gene and the PGR13 gene, taking the GAPDH gene as an internal reference gene, and calculating the relative expression quantity of the alpha-fetoprotein gene and the PGR13 gene according to the Ct value;
(3) and (3) analysis: and calculating the difference multiple of the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene in the cancer tissue and the paracarcinoma tissue according to the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene, and judging.
In the invention, the difference multiple of the alpha fetoprotein gene and the PGR13 gene in the liver cancer tissue and the para-carcinoma tissue is calculated according to the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene, and the risk of suffering from liver cancer and/or whether suffering from liver cancer is judged according to the difference multiple. Compared with the single use of the alpha-fetoprotein gene or the single use of the PGR13 gene as the judgment standard, the judgment by combining the alpha-fetoprotein gene and the PGR13 gene has higher specificity and sensitivity, and the diagnosis time is obviously shortened.
In a third aspect, the present invention provides a system for identifying liver cancer, comprising:
a template preparation module: extracting total RNA in a sample and carrying out reverse transcription to synthesize cDNA;
a detection module: performing RT-qPCR detection by using the obtained cDNA as a template, and calculating relative expression quantity;
an analysis module: the judgment is carried out according to the difference multiple of the relative expression quantity.
Preferably, the sample comprises cancer tissue and para-cancer tissue.
Preferably, the genes detected by the detection module include an alpha-fetoprotein gene and a PGR13 gene.
Preferably, the step of judging according to the difference multiple of the relative expression amount comprises: calculating the difference multiple of the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene in the cancer tissue and the para-cancer tissue, and carrying out liver cancer positive judgment according to the difference multiple.
In the system for identifying liver cancer, the positive judgment standard of liver cancer is as follows:
the difference multiple of the relative expression quantity of the alpha fetoprotein gene in the cancer tissue and the tissue beside the cancer is more than 2.65, namely the liver cancer is positive or high-risk diseased;
the difference multiple of the relative expression quantity of the PGR13 gene in the cancer tissue and the tissue beside the cancer is more than 3.241, and the cancer is positive or high-risk liver cancer.
In the present invention, the fold difference between the relative expression amounts of the alpha fetoprotein gene in the cancer tissue and the paraneoplastic tissue is the relative expression amount of the alpha fetoprotein gene in the cancer tissue/the relative expression amount of the alpha fetoprotein gene in the paraneoplastic tissue. The fold difference between the relative expression levels of the PGR13 gene in the cancer tissue and the paraneoplastic tissue is the relative expression level of the PGR13 gene in the cancer tissue/the relative expression level of the PGR13 gene in the paraneoplastic tissue.
The detection method used in the invention has the advantages of convenient sampling, simple operation, mature technology, capability of meeting the requirement of real-time mass detection and accurate detection result. The combined expression quantity of the liver cancer marker alpha fetoprotein gene and the PGR13 gene is used as a detection index, has high specificity and accuracy, and can be used for early clinical detection of liver cancer.
In a fourth aspect, the invention provides the kit for detecting the expression levels of the alpha fetoprotein gene and the PGR13 gene in the first aspect and/or the application of the system for identifying liver cancer in the third aspect in preparing products for treating and/or diagnosing liver cancer.
In a fifth aspect, the invention provides a medicament for treating liver cancer, wherein the medicament for treating liver cancer takes an alpha fetoprotein gene and a PGR13 gene as targets.
It is to be noted that scientific and technical terms and abbreviations thereof used in the present invention have meanings commonly understood by those skilled in the art.
Compared with the prior art, the invention has the following beneficial effects:
(1) the mRNA gene chip is used for analyzing differentially expressed genes in a liver cancer tissue and a cancer adjacent tissue, the relative expression amount of a PGR13 gene in the liver cancer tissue is higher than that of the cancer adjacent tissue, RT-qPCR detection results show that the alpha fetoprotein gene and the PGR13 gene are obviously highly expressed in the liver cancer tissue and are positively correlated, the effect of jointly diagnosing the liver cancer by utilizing the alpha fetoprotein gene and the PGR13 gene is better than the effect of respectively and independently diagnosing the alpha fetoprotein gene and the PGR13 gene, and the diagnosis time can be obviously shortened.
(2) The detection method used in the invention has the advantages of convenient sampling, simple operation, mature technology, capability of realizing real-time mass detection and accurate detection result. The ROC curve analysis result shows that when the single alpha fetoprotein gene is used as an index to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 90 percent, and the specificity is 84 percent; when the single PGR13 gene is used as an index to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 95 percent, and the specificity is 85 percent; when the combination of the alpha fetoprotein gene and the PGR13 gene is used for distinguishing liver cancer tissues and non-liver cancer tissues, the sensitivity is 94 percent, and the specificity is 98 percent. The liver cancer marker alpha fetoprotein gene and PGR13 gene are used for combined diagnosis and detection of liver cancer, so that the specificity and sensitivity are high, and the application value in early clinical detection of liver cancer is important.
Drawings
FIG. 1 shows the expression of 8 pairs of differential genes in liver cancer and tissues adjacent to the cancer in example 1.
FIG. 2 shows the AFP expression in liver cancer and tissues adjacent to the cancer detected by RT-qPCR method 100 in example 3.
FIG. 3 shows the expression of PGR13 in liver cancer and tissues adjacent to the cancer detected by RT-qPCR method 100 in example 3.
FIG. 4 is the results of correlation analysis of 100 in example 3 on the expression of AFP and PGR13 in liver cancer and tissues adjacent to the cancer.
FIG. 5 is a ROC curve of the isolated diagnosis of liver cancer using the alpha-fetoprotein gene and the PGR13 gene of example 4.
FIG. 6 is a ROC curve of the combination diagnosis of liver cancer using the alpha-fetoprotein gene and PGR13 gene of example 4.
Detailed Description
The technical solution of the present invention is further explained by the following embodiments. It should be understood by those skilled in the art that the examples are only for the understanding of the present invention and should not be construed as the specific limitations of the present invention.
The examples do not show the specific techniques or conditions, according to the technical or conditions described in the literature in the field, or according to the product specifications. The reagents or apparatus used are conventional products commercially available from normal sources, not indicated by the manufacturer.
Materials and instruments:
agilent expression profile chip kit: low Input Rapid amplification Labeling Kit, Monochromatic (Low Input Quick Amp Labeling Kit, One-Color), Cat # 5190-.
cRNA purification kit: RNeasy mini kit, Cat #74106, QIAGEN, GmBH, Germany.
Gene expression hybridization kit: gene Expression Hybridization Kit, Cat # 5188-.
Washing buffer kit for gene expression: gene Expression Wash Buffer Kit, Cat # 5188-.
Trizol was purchased from Novonza.
Reverse transcriptase was purchased from TAKARA.
The real-time fluorescent quantitative PCR kit is purchased from ABI company.
Rolling a hybridization furnace: hybridization Oven, Cat # G2545A, Agilent technologies, Santa Clara, Calif., US.
Washing the vat: stating disks, Cat #121, Thermo Shandon, Waltham, MA, US.
Microarray chip scanner platform: cat # G2565CA, Agilent technologies, Santa Clara, Calif., US.
Example 1
The present example provides a method for screening liver cancer markers. Through mRNA gene chip analysis, the gene which is differentially expressed in liver cancer tissues and tissues beside the cancer is obtained by screening and is used as a liver cancer marker. And 8 pairs of liver cancer tissues and tissues beside the cancer which are mutually matched are collected to be used as mRNA gene chips. The mRNA gene chip analysis steps are as follows:
(1) amplification and labeling of sample RNA
Extracting total RNA in the tissue, amplifying and marking mRNA in the total RNA of the sample by adopting an Agilent expression profile chip matched kit and a standard operation process, and purifying the marked cRNA by using a cRNA purification kit.
(2) Chip hybridization
According to a hybridization standard flow, a matched kit and a gene expression hybridization kit which are provided by matching an Agilent expression profile chip, carrying out rolling hybridization for 17 hours in a rolling hybridization furnace at 65 ℃ and 10rpm, wherein the sample loading amount of hybridized cRNA is 600ng, washing the film in a washing tank, and washing the film by using a washing buffer solution kit for gene expression.
(3) Chip scanning
The chip that completed the hybridization was scanned using a microarray scanner platform, and the software set up the Dye channel: green, Scan resolution 3 μm, 20 bit. Data were read using Feature Extraction Software 10.7(Agilent technologies, Santa Clara, Calif., US) and finally normalized using Gene Spring Software 11.0(Agilent technologies, Santa Clara, Calif., US) using Quantiline as the algorithm.
(4) Detection and analysis of chip signals
The statistical analysis uses a classifier PAM and a classifier WEKA to select subsets and construct classification models. The expression of 8 different genes in liver cancer and para-cancer tissues is shown in FIG. 1, wherein the fold difference of PGR13 is most obvious.
Example 2
The embodiment provides a kit for detecting expression levels of an alpha-fetoprotein gene and a PGR13 gene, which comprises primer pairs for specifically amplifying the alpha-fetoprotein gene and the PGR13 gene respectively.
The upstream primer of the specific amplification alpha-fetoprotein gene in the kit comprises a nucleotide sequence shown by SEQ ID No.1, and the downstream primer of the specific amplification alpha-fetoprotein gene comprises a nucleotide sequence shown by SEQ ID No. 2.
The upstream primer of the specific amplification PGR13 gene in the kit comprises a nucleotide sequence shown in SEQ ID No.3, and the downstream primer of the specific amplification PGR13 gene comprises a nucleotide sequence shown in SEQ ID No. 4.
The kit also comprises a PCR buffer solution, an enzyme mixed solution and a fluorescent dye, and the kit also comprises a primer pair for specifically amplifying the internal reference gene GAPDH.
In the invention, an upstream primer for specifically amplifying the internal reference gene GAPDH in the kit comprises a nucleotide sequence shown in SEQ ID No.5, and a downstream primer for specifically amplifying the internal reference gene GAPDH comprises a nucleotide sequence shown in SEQ ID No. 6.
Example 3
In this example, the kit for detecting expression levels of the alpha-fetoprotein gene and the PGR13 gene prepared in example 2 was used to detect the alpha-fetoprotein gene and the PGR13 gene in the tissue, and the expression levels of the AFP gene and the PGR13 gene in the tissue were detected by RT-qPCR.
(1) Extraction of Total RNA
Shearing 100 collected liver cancer tissues and paired paracarcinoma tissues, placing the cut soybean grains into an EP tube, adding 1ml of Trizol (total RNA extraction reagent) into a grinder for grinding, sucking out the Trizol after the tissues are ground, adding 200 mu L of chloroform into each tube, violently shaking and uniformly mixing for 30s, and centrifuging at 12000g for 20min at 4 ℃ after the chloroform is fully emulsified. The supernatant was transferred to a new EP tube (taking care not to suck the intermediate protein layer), and an equal volume of precooled isopropanol was added to the aspirated supernatant, and after reversing the EP tube upside down and mixing, the mixture was left to stand at-20 ℃ for 20min, and centrifuged at 12000g for 10min at 4 ℃ to precipitate RNA. Removing supernatant, adding 70% cold ethanol solution prepared from 250 μ L DEPC water (ultrapure water treated with diethyl pyrocarbonate, DEPC, diethyl pyrocarbonate and sterilized at high temperature and high pressure), mixing, centrifuging at 4 deg.C and 12000g for 10min, removing ethanol, air drying at room temperature to precipitate, adding 50 μ L DEPC water to dissolve RNA, measuring RNA concentration and A260/280 value with spectrophotometer, and storing at-80 deg.C.
(2) Reverse transcription to synthesize cDNA
The PCR system for reverse transcription synthesis is shown in Table 1.
TABLE 1
Reagent Dosage of
Mixtures of reverse transcriptase, dNTPs and buffer 2μL
Genomic DNA 100ng
Water (W) Make up to 20. mu.L
The PCR conditions for reverse transcription are shown in Table 2.
TABLE 2
Temperature of Time
25℃ 10min
42℃ 30min
85℃ 5min
Synthesizing cDNA by reverse transcription in a PCR instrument, subpackaging the cDNA and storing at-20 ℃ to be used as a cDNA template to be detected.
(3)RT-qPCR
A real-time fluorescent quantitative PCR kit is used, a PCR system of RT-qPCR reaction is prepared according to the instruction, the reaction system is shown in table 3, each reaction is provided with 3 multiple wells, and meanwhile, no-template control is arranged. The enzyme mixture, fluorochrome and PCR buffer mixture was 2 × SYBR Green qPCR Mix, and 50 × ROX DyeII was added to correct for errors between wells due to sample loading etc.
TABLE 3
Reagent Dosage (mu L)
Mixture of enzyme mixture, fluorescent dye and PCR buffer solution 10
Forward primer (10. mu.M) 1
Reverse primer (10. mu.M) 1
cDNA template 2
50×ROX DyeII 0.4
Water (W) Make up to 20
The primer sequences are shown in Table 4.
TABLE 4
Figure BDA0003346724850000111
The reaction conditions for the optimized RT-qPCR are shown in table 5.
TABLE 5
Figure BDA0003346724850000112
The fluorescent signal is collected in the extension stage, and the round threshold (CT value) of each gene in the sample is obtained through the analysis of Quant Studio software. And (4) detecting a melting curve after the RT-qPCR reaction is finished, and reacting for 1 cycle. Each sample experiment was repeated 3 times. The reaction conditions for melting curve detection are shown in Table 6.
TABLE 6
Reaction temperature Time
95℃ 15s
60℃ 60s
95℃ 15s
Calculating the relative expression quantity of the alpha-fetoprotein gene and the PGR13 gene according to the Ct value, and calculating the relative expression quantity of the AFP gene and the PGR13 gene by adopting a delta Ct method, namely, the delta Ctgene is delta Ctgene-delta Ctref; wherein gene is a target gene, ref is a GAPDH gene, and the GAPDH gene is an internal reference gene. All data are analyzed and output by SPSS 21.0 statistical software, the measurement data are expressed by mean + -standard deviation, t test is adopted, variance analysis is adopted for the difference between groups, and P <0.05 is the difference with statistical significance.
The results of the detection are shown in FIGS. 2 and 3, in which the ordinate represents 2 of the target gene-ΔΔCtValues, abscissa, are different types of tissue. The expression of AFP gene and PGR13 gene is detected in 100 liver cancer tissues and matched tissues beside the liver cancer tissues, and the remarkable high expression of AFP and PGR13 in the liver cancer tissues is found; it can be seen from FIG. 4 that the relative expression levels of the AFP gene and the PGR13 gene are positively correlated with each other.
Example 4
This example provides ROC curve validation of the markers AFP gene and PGR13 gene described herein. ROC curve: a receiver operating characteristic curve (ROC curve for short), also called sensitivity curve (sensitivity curve).
According to the relative expression quantity (internal reference gene is GAPDH) of AFP gene and PGR13 gene in 100 liver cancer tissues and matched paracarcinoma tissues, ROC curve analysis is carried out on the measurement results of the test group and the control group, and the ROC curve is drawn by drawing with sensitivity (representing true positive rate) as ordinate and 1-specificity (representing false positive rate) as abscissa.
AUC (area Under curve) is the area enclosed by the ROC curve and the coordinate axis, and the area is less than 1. The AUC is between 0.5 and 1.0, and in the case that the AUC is greater than 0.5, the closer the AUC is to 1, the higher the authenticity of the detection result is, which indicates that the diagnosis effect is better. When the AUC is 0.5-0.7, the diagnosis result has lower accuracy; when the AUC is 0.7-0.9, the diagnosis result has certain accuracy; when the AUC is more than 0.9, the accuracy is higher; when AUC is 0.5, the detection result has the lowest authenticity, which indicates that the diagnostic method is close to random guess and has no application value.
The relative expression of the AFP gene alone and the PGR13 gene alone was used to diagnose liver cancer, and the specificity and accuracy of the diagnosis of liver cancer were shown in FIG. 5.
FIG. 5 shows the diagnostic effect of AFP gene alone and PGR13 gene alone for diagnosing liver cancer. When the alpha fetoprotein gene is used as an index to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 90 percent, the specificity is 84 percent, the cut off value (critical value) is 2.65, and the AUC is 0.937; when the PGR13 gene is used as an index to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 95 percent, the specificity is 85 percent, the cut off value (critical value) is 3.241, and the AUC is 0.959.
The combined expression level of AFP gene and PGR13 gene was used to diagnose liver cancer, and the specificity and accuracy of liver cancer diagnosis are shown in FIG. 6.
FIG. 6 is a graph showing the diagnostic effect of diagnosing liver cancer using the combined expression amount of AFP gene and PGR13 gene. When the combination of the alpha fetoprotein gene and the PGR13 gene is used for distinguishing liver cancer and non-liver cancer, the sensitivity is 94%, the specificity is 98%, the cut off value (critical value) is 0.655, and the AUC is 0.989.
In conclusion, the invention provides an AFP gene and a PGR13 gene which are liver cancer markers, and the liver cancer markers have high specificity and accuracy, can be used for diagnosing early liver cancer and detecting postoperative recurrence of liver cancer, and have important clinical significance.
The applicant declares that the above description is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be understood by those skilled in the art that any changes or substitutions that can be easily conceived by those skilled in the art within the technical scope of the present invention are within the scope and disclosure of the present invention.
Sequence listing
<110> Severe Biotechnology (Shanghai) Co., Ltd
<120> kit for detecting expression level of alpha-fetoprotein gene and PGR13 gene and application thereof
<130> 2021
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> artificially synthesized sequence
<400> 1
ctttgggctg ctcgctatga 20
<210> 2
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 2
gcatgttgat ttaacaagct gct 23
<210> 3
<211> 23
<212> DNA
<213> artificially synthesized sequence
<400> 3
tagtgacacc ccacttaatc agc 23
<210> 4
<211> 21
<212> DNA
<213> artificially synthesized sequence
<400> 4
aggtaggtca agcgaaatgg c 21
<210> 5
<211> 21
<212> DNA
<213> artificially synthesized sequence
<400> 5
ctcaccggat gcaccaatgt t 21
<210> 6
<211> 21
<212> DNA
<213> artificially synthesized sequence
<400> 6
cgcgttgctc acaatgttca t 21
21

Claims (10)

1. A kit for detecting expression levels of an alpha-fetoprotein gene and a PGR13 gene is characterized by comprising a primer pair for specifically amplifying the alpha-fetoprotein gene and the PGR13 gene respectively.
2. The kit for detecting the expression levels of the alpha-fetoprotein gene and the PGR13 gene as claimed in claim 1, wherein an upstream primer for specifically amplifying the alpha-fetoprotein gene in the kit comprises a nucleotide sequence shown in SEQ ID No.1, and a downstream primer for specifically amplifying the alpha-fetoprotein gene comprises a nucleotide sequence shown in SEQ ID No. 2.
3. The kit for detecting the expression levels of the alpha fetoprotein gene and the PGR13 gene as claimed in claim 1 or 2, wherein an upstream primer for specifically amplifying the PGR13 gene in the kit comprises a nucleotide sequence shown as SEQ ID No.3, and a downstream primer for specifically amplifying the PGR13 gene comprises a nucleotide sequence shown as SEQ ID No. 4;
preferably, the kit further comprises a PCR buffer solution, an enzyme mixed solution and a fluorescent dye;
preferably, the kit further comprises a primer pair for specifically amplifying the reference gene.
4. A method for using the kit for detecting the expression levels of the alpha fetoprotein gene and the PGR13 gene according to any one of claims 1 to 3 for the purpose of non-disease diagnosis and/or treatment, the method comprising:
and performing RT-qPCR detection on the cancer tissue to be detected and the paracancer tissue by using the primer pair for respectively and specifically amplifying the alpha-fetoprotein gene and the PGR13 gene, calculating the relative expression quantity of the alpha-fetoprotein gene and the PGR13 gene in the cancer tissue to be detected and the paracancer tissue, and performing calculation analysis.
5. The method for using the kit for detecting the expression levels of the alpha fetoprotein gene and the PGR13 gene for the purpose of non-disease diagnosis and/or treatment according to claim 4, wherein the method comprises the following steps:
(1) preparing a template: extracting total RNA in the cancer tissue to be detected and the tissue beside the cancer and carrying out reverse transcription to synthesize cDNA;
(2) and (3) detection: detecting the obtained cDNA by RT-qPCR by using the primer pairs for respectively and specifically amplifying the alpha-fetoprotein gene and the PGR13 gene, taking the GAPDH gene as an internal reference gene, and calculating the relative expression quantity of the alpha-fetoprotein gene and the PGR13 gene according to the Ct value;
(3) and (3) analysis: and calculating the difference multiple of the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene in the cancer tissue and the paracarcinoma tissue according to the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene, and judging.
6. A system for identifying liver cancer, the system comprising:
a template preparation module: extracting total RNA in a sample and carrying out reverse transcription to synthesize cDNA;
a detection module: performing RT-qPCR detection by using the obtained cDNA as a template, and calculating relative expression quantity;
an analysis module: the judgment is carried out according to the difference multiple of the relative expression quantity.
7. The system for identifying liver cancer according to claim 6, wherein the sample comprises cancer tissue and paracancerous tissue;
preferably, the genes detected by the detection module include an alpha-fetoprotein gene and a PGR13 gene.
8. The system for screening liver cancer according to claim 6 or 7, wherein the step of determining the liver cancer according to the fold difference between the relative expression levels comprises: calculating the difference multiple of the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene in the cancer tissue and the para-cancer tissue, and carrying out liver cancer positive judgment according to the difference multiple.
9. Use of the kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene according to any one of claims 1 to 3 and/or the system for identifying liver cancer according to any one of claims 6 to 8 in preparation of products for treatment and/or diagnosis of liver cancer.
10. The medicine for treating the liver cancer is characterized in that an alpha fetoprotein gene and a PGR13 gene are taken as targets.
CN202111324996.8A 2021-11-10 2021-11-10 Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof Active CN113957149B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202111324996.8A CN113957149B (en) 2021-11-10 2021-11-10 Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202111324996.8A CN113957149B (en) 2021-11-10 2021-11-10 Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof

Publications (2)

Publication Number Publication Date
CN113957149A true CN113957149A (en) 2022-01-21
CN113957149B CN113957149B (en) 2024-03-19

Family

ID=79469963

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202111324996.8A Active CN113957149B (en) 2021-11-10 2021-11-10 Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof

Country Status (1)

Country Link
CN (1) CN113957149B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140100127A1 (en) * 2011-03-31 2014-04-10 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Liver cancer diagnosis marker and use thereof

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20140100127A1 (en) * 2011-03-31 2014-04-10 Shanghai Institutes For Biological Sciences, Chinese Academy Of Sciences Liver cancer diagnosis marker and use thereof

Also Published As

Publication number Publication date
CN113957149B (en) 2024-03-19

Similar Documents

Publication Publication Date Title
WO2004081564A1 (en) Expression profiling of tumours
WO2017202185A1 (en) Peripheral blood gene marker for screening benign and malignant small pulmonary nodules and use thereof
CN109055555B (en) Lung cancer early stage metastasis diagnosis marker and kit and application thereof
CN101851682A (en) MiRNA combination used for detecting esophageal squamous cell carcinoma and application thereof
CN114150066B (en) Application of exosomes CDA, HMGN1 and the like in lung cancer diagnosis
CN108949969B (en) Application of long-chain non-coding RNA in colorectal cancer
CN117165688A (en) Marker for urothelial cancer and application thereof
CN110229899B (en) Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer
CN114875139A (en) Application of exosome miR-106b-3p, et-7a and the like in lung cancer diagnosis
KR102194215B1 (en) Biomarkers for Diagnosing Gastric Cancer And Uses Thereof
CN112553341A (en) Kidney clear cell carcinoma SCNN1 primer, diagnosis kit and application thereof
CN113957149B (en) Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof
CN113249479B (en) Pancreatic cancer related lncRNA marker, probe and application of detection kit in pancreatic cancer diagnosis
US20110097271A1 (en) Colon Cancer Associated Transcript 1 (CCAT1) As A Cancer Marker
CN111154880B (en) Bladder cancer body fluid biopsy biomarker and application thereof
CN112391478A (en) Application of exosome mRNA in diagnosis of breast diseases
CN113373229B (en) Gastric cancer related biomarker and application thereof
CN114150065B (en) Marker for colorectal cancer or precancerous lesion and application thereof
CN111455057B (en) Kit, device and method for lung cancer diagnosis
CN111455051B (en) Exosome RNA for colorectal cancer diagnosis and prediction and application thereof
WO2024001602A1 (en) Composition for detecting gastric cancer, kit, and use thereof
CN118186088A (en) MiRNA composition for auxiliary diagnosis of esophageal cancer and application thereof
AU2004219989B2 (en) Expression profiling of tumours
CN118127151A (en) Composition for detecting bladder cancer, kit and application thereof
CN115961036A (en) Marker, reagent and kit for early recurrence molecular diagnosis of primary liver cancer

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant