CN113957149B - Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof - Google Patents
Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof Download PDFInfo
- Publication number
- CN113957149B CN113957149B CN202111324996.8A CN202111324996A CN113957149B CN 113957149 B CN113957149 B CN 113957149B CN 202111324996 A CN202111324996 A CN 202111324996A CN 113957149 B CN113957149 B CN 113957149B
- Authority
- CN
- China
- Prior art keywords
- gene
- pgr13
- alpha fetoprotein
- liver cancer
- kit
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
- 101000887420 Homo sapiens Probable G-protein coupled receptor 141 Proteins 0.000 title claims abstract description 93
- 108010026331 alpha-Fetoproteins Proteins 0.000 title claims abstract description 80
- 230000014509 gene expression Effects 0.000 title claims abstract description 65
- 201000007270 liver cancer Diseases 0.000 claims abstract description 94
- 208000014018 liver neoplasm Diseases 0.000 claims abstract description 91
- 108090000623 proteins and genes Proteins 0.000 claims abstract description 28
- 238000003745 diagnosis Methods 0.000 claims abstract description 24
- 238000004458 analytical method Methods 0.000 claims abstract description 13
- 238000001514 detection method Methods 0.000 claims description 31
- 238000000034 method Methods 0.000 claims description 17
- 238000011529 RT qPCR Methods 0.000 claims description 16
- 238000003762 quantitative reverse transcription PCR Methods 0.000 claims description 15
- 239000002299 complementary DNA Substances 0.000 claims description 12
- 238000011144 upstream manufacturing Methods 0.000 claims description 10
- 230000003321 amplification Effects 0.000 claims description 8
- 238000003199 nucleic acid amplification method Methods 0.000 claims description 8
- 238000010839 reverse transcription Methods 0.000 claims description 8
- 238000002360 preparation method Methods 0.000 claims description 6
- 102000004190 Enzymes Human genes 0.000 claims description 5
- 108090000790 Enzymes Proteins 0.000 claims description 5
- 201000010099 disease Diseases 0.000 claims description 5
- 208000037265 diseases, disorders, signs and symptoms Diseases 0.000 claims description 5
- 239000007850 fluorescent dye Substances 0.000 claims description 5
- 101150112014 Gapdh gene Proteins 0.000 claims description 4
- 230000002194 synthesizing effect Effects 0.000 claims description 4
- 239000007853 buffer solution Substances 0.000 claims description 2
- 238000004364 calculation method Methods 0.000 claims description 2
- 239000011259 mixed solution Substances 0.000 claims description 2
- 230000035945 sensitivity Effects 0.000 abstract description 16
- 108020004999 messenger RNA Proteins 0.000 abstract description 8
- 238000012216 screening Methods 0.000 abstract description 6
- 230000002596 correlated effect Effects 0.000 abstract description 5
- 206010028980 Neoplasm Diseases 0.000 description 24
- 201000011510 cancer Diseases 0.000 description 24
- 239000002773 nucleotide Substances 0.000 description 12
- 125000003729 nucleotide group Chemical group 0.000 description 12
- 101150055123 afp gene Proteins 0.000 description 11
- 108091032973 (ribonucleotides)n+m Proteins 0.000 description 10
- 238000005516 engineering process Methods 0.000 description 9
- 238000009396 hybridization Methods 0.000 description 9
- 238000006243 chemical reaction Methods 0.000 description 8
- 102100023635 Alpha-fetoprotein Human genes 0.000 description 6
- 230000000694 effects Effects 0.000 description 6
- 239000000439 tumor marker Substances 0.000 description 6
- 102100039863 Probable G-protein coupled receptor 141 Human genes 0.000 description 5
- 206010073071 hepatocellular carcinoma Diseases 0.000 description 5
- HEDRZPFGACZZDS-UHFFFAOYSA-N Chloroform Chemical compound ClC(Cl)Cl HEDRZPFGACZZDS-UHFFFAOYSA-N 0.000 description 4
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 4
- 102000013529 alpha-Fetoproteins Human genes 0.000 description 4
- 239000000872 buffer Substances 0.000 description 4
- 239000003153 chemical reaction reagent Substances 0.000 description 4
- 238000013399 early diagnosis Methods 0.000 description 4
- 108020004445 glyceraldehyde-3-phosphate dehydrogenase Proteins 0.000 description 4
- 239000000203 mixture Substances 0.000 description 4
- 210000002966 serum Anatomy 0.000 description 4
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 4
- 208000019425 cirrhosis of liver Diseases 0.000 description 3
- 238000003759 clinical diagnosis Methods 0.000 description 3
- 239000003814 drug Substances 0.000 description 3
- 238000002372 labelling Methods 0.000 description 3
- 239000000047 product Substances 0.000 description 3
- 239000006228 supernatant Substances 0.000 description 3
- 239000011534 wash buffer Substances 0.000 description 3
- 102100034343 Integrase Human genes 0.000 description 2
- KFZMGEQAYNKOFK-UHFFFAOYSA-N Isopropanol Chemical compound CC(C)O KFZMGEQAYNKOFK-UHFFFAOYSA-N 0.000 description 2
- 206010027476 Metastases Diseases 0.000 description 2
- 108010092799 RNA-directed DNA polymerase Proteins 0.000 description 2
- 239000000090 biomarker Substances 0.000 description 2
- 238000011161 development Methods 0.000 description 2
- FFYPMLJYZAEMQB-UHFFFAOYSA-N diethyl pyrocarbonate Chemical compound CCOC(=O)OC(=O)OCC FFYPMLJYZAEMQB-UHFFFAOYSA-N 0.000 description 2
- 239000000975 dye Substances 0.000 description 2
- 238000010195 expression analysis Methods 0.000 description 2
- 238000000227 grinding Methods 0.000 description 2
- 208000006454 hepatitis Diseases 0.000 description 2
- 231100000844 hepatocellular carcinoma Toxicity 0.000 description 2
- 238000003384 imaging method Methods 0.000 description 2
- 239000003550 marker Substances 0.000 description 2
- 238000002844 melting Methods 0.000 description 2
- 230000008018 melting Effects 0.000 description 2
- 230000009401 metastasis Effects 0.000 description 2
- 238000002493 microarray Methods 0.000 description 2
- 238000002156 mixing Methods 0.000 description 2
- 238000000746 purification Methods 0.000 description 2
- 238000003753 real-time PCR Methods 0.000 description 2
- 238000005096 rolling process Methods 0.000 description 2
- 238000005070 sampling Methods 0.000 description 2
- 238000012795 verification Methods 0.000 description 2
- 238000005406 washing Methods 0.000 description 2
- 102100039196 CX3C chemokine receptor 1 Human genes 0.000 description 1
- 206010008909 Chronic Hepatitis Diseases 0.000 description 1
- -1 DEPC Chemical compound 0.000 description 1
- 108091006027 G proteins Proteins 0.000 description 1
- 102000030782 GTP binding Human genes 0.000 description 1
- 108091000058 GTP-Binding Proteins 0.000 description 1
- 241000288113 Gallirallus australis Species 0.000 description 1
- 102100031181 Glyceraldehyde-3-phosphate dehydrogenase Human genes 0.000 description 1
- 235000010469 Glycine max Nutrition 0.000 description 1
- 244000068988 Glycine max Species 0.000 description 1
- 101000746022 Homo sapiens CX3C chemokine receptor 1 Proteins 0.000 description 1
- 206010061218 Inflammation Diseases 0.000 description 1
- 101710159875 Probable G-protein coupled receptor 141 Proteins 0.000 description 1
- 238000002123 RNA extraction Methods 0.000 description 1
- 238000011530 RNeasy Mini Kit Methods 0.000 description 1
- 230000009286 beneficial effect Effects 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 210000004369 blood Anatomy 0.000 description 1
- 239000008280 blood Substances 0.000 description 1
- 238000010804 cDNA synthesis Methods 0.000 description 1
- 238000004422 calculation algorithm Methods 0.000 description 1
- 238000005119 centrifugation Methods 0.000 description 1
- 238000013145 classification model Methods 0.000 description 1
- 230000000295 complement effect Effects 0.000 description 1
- 150000001875 compounds Chemical class 0.000 description 1
- 238000013270 controlled release Methods 0.000 description 1
- 238000012937 correction Methods 0.000 description 1
- 230000008878 coupling Effects 0.000 description 1
- 238000010168 coupling process Methods 0.000 description 1
- 238000005859 coupling reaction Methods 0.000 description 1
- 238000013211 curve analysis Methods 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 238000002405 diagnostic procedure Methods 0.000 description 1
- 238000002474 experimental method Methods 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 239000010931 gold Substances 0.000 description 1
- 229910052737 gold Inorganic materials 0.000 description 1
- 231100000283 hepatitis Toxicity 0.000 description 1
- 230000004054 inflammatory process Effects 0.000 description 1
- 238000011068 loading method Methods 0.000 description 1
- 230000036210 malignancy Effects 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 238000012544 monitoring process Methods 0.000 description 1
- 239000002086 nanomaterial Substances 0.000 description 1
- 230000001613 neoplastic effect Effects 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 230000001575 pathological effect Effects 0.000 description 1
- 239000008188 pellet Substances 0.000 description 1
- 229920001690 polydopamine Polymers 0.000 description 1
- 230000002980 postoperative effect Effects 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000012545 processing Methods 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000011897 real-time detection Methods 0.000 description 1
- 102000005962 receptors Human genes 0.000 description 1
- 108020003175 receptors Proteins 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000002798 spectrophotometry method Methods 0.000 description 1
- 238000007619 statistical method Methods 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000001356 surgical procedure Methods 0.000 description 1
- 208000024891 symptom Diseases 0.000 description 1
- 238000003786 synthesis reaction Methods 0.000 description 1
- 238000012353 t test Methods 0.000 description 1
- 238000012360 testing method Methods 0.000 description 1
- 229910021642 ultra pure water Inorganic materials 0.000 description 1
- 239000012498 ultrapure water Substances 0.000 description 1
- 238000012285 ultrasound imaging Methods 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K45/00—Medicinal preparations containing active ingredients not provided for in groups A61K31/00 - A61K41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/16—Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/166—Oligonucleotides used as internal standards, controls or normalisation probes
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Veterinary Medicine (AREA)
- Genetics & Genomics (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Biophysics (AREA)
- General Engineering & Computer Science (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Physics & Mathematics (AREA)
- Molecular Biology (AREA)
- General Chemical & Material Sciences (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Oncology (AREA)
- Epidemiology (AREA)
- Hospice & Palliative Care (AREA)
- Gastroenterology & Hepatology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a kit for detecting the expression levels of alpha fetoprotein genes and PGR13 genes and application thereof, wherein the kit comprises primer pairs for respectively and specifically amplifying the alpha fetoprotein genes and the PGR13 genes. And analyzing the liver cancer tissues and the paracancerous tissues by using an mRNA gene chip, wherein the analysis and screening results show that the PGR13 gene is differentially expressed in the liver cancer tissues and the paracancerous tissues. In the invention, alpha fetoprotein gene and PGR13 gene are taken as liver cancer markers, the alpha fetoprotein gene and the PGR13 gene are obviously and highly expressed in liver cancer tissues and are positively correlated, and compared with the single alpha fetoprotein gene which is taken as a diagnosis index, the combined diagnosis of the alpha fetoprotein gene and the PGR13 gene has higher sensitivity and specificity.
Description
Technical Field
The invention belongs to the field of biological medicine, and relates to a kit for detecting the expression levels of alpha fetoprotein genes and PGR13 genes and application thereof.
Background
Primary liver cancer is one of malignant tumors with high morbidity and mortality, and in primary liver cancer, hepatocellular carcinoma (Hepatocellular Carcinoma, HCC) accounts for a relatively high proportion, and most patients reach middle and late stages in diagnosis and may miss early treatment due to lack of effective detection and diagnosis indexes. The liver cancer has high malignancy, unobvious early symptoms, rapid disease development and easy occurrence of intrahepatic metastasis and multiple metastasis of other organs, so the early diagnosis of the liver cancer is the key of clinical diagnosis and treatment.
Current screening methods for clinical liver cancer include B-mode ultrasound imaging and serum content screening of tumor marker alpha fetoprotein (alpha fetoprotein, AFP).
Patent CN101984919a discloses a method for detecting liver cancer pathological tissue targets in early stage by three-dimensional ultrasonic imaging, by processing scanned images, the sonography information can be effectively reflected in three-dimensional mode, the display accuracy of the images achieves the effect of low power microscope, and the method has important application value for diagnosing liver fibrosis in each stage, inflammation stage of chronic hepatitis, liver cirrhosis, early diagnosis of liver cancer and the like. However, imaging means have low sensitivity to early HCC diagnosis and have difficulty in detecting recurrence after HCC surgery.
Patent CN112098648A discloses a method for detecting serum biomarkers of liver cancer patients, alpha fetoprotein is closely related to the occurrence and development of various tumors, is clinically mainly used as serum markers of liver cancer, and is used for diagnosis and curative effect monitoring of primary liver cancer. Therefore, the high-sensitivity detection of alpha fetoprotein has important significance for early diagnosis and treatment of liver cancer patients. According to the method for detecting the serum biomarker of the liver cancer patient, the polydopamine and the hollow nano gold are utilized to construct the signal controlled release nano material, so that the AFP is simply and efficiently detected. Although its sensitivity of detection is high, its false negative rate is as high as 40%, and some non-neoplastic diseases such as hepatitis and liver cirrhosis, the AFP in the blood of its patients may also be elevated.
Therefore, the novel index for early diagnosis of liver cancer is searched, the accuracy of diagnosis is improved, early discovery and early treatment of liver cancer can be facilitated, and the method has important significance for treatment and diagnosis of liver cancer.
Disclosure of Invention
In order to overcome the defects of the prior art, the invention aims to provide a kit for detecting the expression levels of alpha fetoprotein genes and PGR13 genes (G protein-coupled receptor 13, PGR13 and G protein coupling receptor 13) and application thereof, wherein the kit comprises primer pairs for respectively and specifically amplifying the alpha fetoprotein genes and the PGR13 genes. And analyzing the liver cancer tissues and the paracancerous tissues by using an mRNA gene chip, wherein the analysis and screening results show that the PGR13 gene is differentially expressed in the liver cancer tissues and the paracancerous tissues. In the invention, alpha fetoprotein gene and PGR13 gene are taken as liver cancer markers, the alpha fetoprotein gene and the PGR13 gene are obviously and highly expressed in liver cancer tissues and are positively correlated, and compared with the single alpha fetoprotein gene which is taken as a diagnosis index, the combined diagnosis of the alpha fetoprotein gene and the PGR13 gene has higher sensitivity and specificity.
In order to achieve the aim of the invention, the invention adopts the following technical scheme:
in a first aspect, the present invention provides a kit for detecting the expression levels of alpha fetoprotein gene and PGR13 gene, the kit comprising a primer pair for specifically amplifying alpha fetoprotein gene and PGR13 gene, respectively.
In the invention, the mRNA gene chip is used for analyzing the genes differentially expressed in liver cancer tissues and cancer tissues, and the result shows that the relative expression level of the PGR13 gene in the liver cancer tissues is higher than that in the cancer tissues.
Preferably, the upstream primer for specifically amplifying the alpha-fetoprotein gene in the kit comprises a nucleotide sequence shown in SEQ ID No.1, and the downstream primer for specifically amplifying the alpha-fetoprotein gene comprises a nucleotide sequence shown in SEQ ID No. 2.
In the present invention, SEQ ID No.1: CTTTGGGCTGCTCGCTATGA;
SEQ ID No.2：GCATGTTGATTTAACAAGCTGCT。
preferably, the upstream primer for specifically amplifying the PGR13 gene in the kit comprises a nucleotide sequence shown in SEQ ID No.3, and the downstream primer for specifically amplifying the PGR13 gene comprises a nucleotide sequence shown in SEQ ID No. 4.
In the present invention, SEQ ID No.3: TAGTGACACCCCACTTAATCAGC;
SEQ ID No.4：AGGTAGGTCAAGCGAAATGGC。
preferably, the kit further comprises a PCR buffer, an enzyme cocktail, and a fluorescent dye.
Preferably, the kit further comprises a primer pair for specifically amplifying the reference gene.
In the invention, the upstream primer of the specific amplification reference gene in the kit comprises a nucleotide sequence shown as SEQ ID No.5, and the downstream primer of the specific amplification reference gene comprises a nucleotide sequence shown as SEQ ID No. 6.
In the present invention, SEQ ID No.5: CTCACCGGATGCACCAATGTT;
SEQ ID No.6：CGCGTTGCTCACAATGTTCAT。
in the invention, through RT-qPCR verification, the alpha fetoprotein gene and the PGR13 gene are obviously and highly expressed in liver cancer tissues and are positively correlated, and the alpha fetoprotein gene and the PGR13 gene can be used as marker combinations for diagnosing liver cancer to assist clinical diagnosis and treatment. The alpha fetoprotein gene and the PGR13 gene combined diagnosis has higher specificity and sensitivity, and provides basis for clinical diagnosis and treatment.
In a second aspect, the present invention provides a method for using the kit for detecting the expression levels of alpha fetoprotein gene and PGR13 gene according to the first aspect for the purpose of non-disease diagnosis and/or treatment, the method comprising:
and carrying out RT-qPCR detection on the tissue to be detected and the tissue beside the cancer by using the primers for respectively and specifically amplifying the alpha fetoprotein gene and the PGR13 gene, calculating the relative expression amounts of the alpha fetoprotein gene and the PGR13 gene in the tissue to be detected and the tissue beside the cancer, and carrying out calculation and analysis.
Preferably, the use method comprises the following steps:
(1) Template preparation: extracting total RNA in the tissue of the cancer to be detected and the tissue beside the cancer and synthesizing cDNA by reverse transcription;
(2) And (3) detection: detecting the obtained cDNA by RT-qPCR by using the primer pair for respectively and specifically amplifying the alpha fetoprotein gene and the PGR13 gene, and calculating the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene according to a Ct value by using the GAPDH gene as an internal reference gene;
(3) Analysis: and calculating the difference multiple of the relative expression amounts of the alpha fetoprotein gene and the PGR13 gene in the cancer tissue and the tissues beside the cancer according to the relative expression amounts of the alpha fetoprotein gene and the PGR13 gene, and judging.
In the invention, the difference times of the alpha fetoprotein gene and the PGR13 gene in liver cancer tissues and paracancerous tissues are calculated through the relative expression of the alpha fetoprotein gene and the PGR13 gene, and the risk of suffering from liver cancer and/or whether the liver cancer is suffered from are judged according to the difference times. Compared with the single use of alpha fetoprotein gene or the single use of PGR13 gene as a judgment standard, the combined use of the alpha fetoprotein gene and the PGR13 gene for judgment has higher specificity and sensitivity, and the diagnosis time is obviously shortened.
In a third aspect, the present invention provides a system for identifying liver cancer, the system for identifying liver cancer comprising:
and (3) a template preparation module: extracting total RNA in a sample and synthesizing cDNA by reverse transcription;
and a detection module: using the obtained cDNA as a template, carrying out RT-qPCR detection, and calculating the relative expression quantity;
and an analysis module: and judging according to the difference multiple of the relative expression quantity.
Preferably, the sample comprises cancer tissue and paracancerous tissue.
Preferably, the genes detected by the detection module include alpha fetoprotein gene and PGR13 gene.
Preferably, the step of judging according to the multiple of difference of the relative expression amounts includes: calculating the difference times of the relative expression amounts of alpha fetoprotein gene and PGR13 gene in cancer tissue and paracancer tissue, and carrying out positive judgment on liver cancer according to the difference times.
In the system for identifying liver cancer, the judgment standard of positive liver cancer is as follows:
the multiple difference of the relative expression quantity of alpha fetoprotein genes in cancer tissues and paracancerous tissues is more than 2.65, namely positive liver cancer or high risk of suffering from liver cancer;
the multiple difference of the relative expression quantity of PGR13 genes in cancer tissues and paracancer tissues is larger than 3.241, namely positive liver cancer or high risk of suffering from liver cancer.
In the present invention, the fold difference in the relative expression amounts of alpha fetoprotein genes in the cancer tissue and the paracancerous tissue=the relative expression amount of alpha fetoprotein genes in the cancer tissue/the relative expression amount of alpha fetoprotein genes in the paracancerous tissue. Fold difference in the relative expression amount of PGR13 gene in the cancer tissue and the paracancerous tissue=the relative expression amount of PGR13 gene in the cancer tissue/the relative expression amount of PGR13 gene in the paracancerous tissue.
The detection method used in the invention has the advantages of convenient sampling, simple operation, mature technology, capability of meeting the real-time detection of a large number and accurate detection result. The combined expression quantity of the liver cancer marker alpha fetoprotein gene and the PGR13 gene is used as a detection index, has high specificity and accuracy, and can be used for early clinical detection of liver cancer.
In a fourth aspect, the invention provides an application of the kit for detecting the expression levels of alpha fetoprotein gene and PGR13 gene in the first aspect and/or the system for identifying liver cancer in the third aspect in preparing products for treating and/or diagnosing liver cancer.
In a fifth aspect, the present invention provides a medicament for treating liver cancer, wherein the medicament for treating liver cancer uses alpha fetoprotein gene and PGR13 gene as targets.
It is to be noted that scientific and technical terms used in the present invention and abbreviations thereof have meanings commonly understood by those skilled in the art.
Compared with the prior art, the invention has the following beneficial effects:
(1) In the invention, the mRNA gene chip is used for analyzing the genes differentially expressed in liver cancer tissues and cancer tissues beside, the relative expression amount of the PGR13 gene in the liver cancer tissues is higher than that of the cancer tissues beside, the RT-qPCR detection result shows that the alpha fetoprotein gene and the PGR13 gene are obviously and highly expressed in the liver cancer tissues and are positively correlated, and the effect of diagnosing liver cancer by utilizing the alpha fetoprotein gene and the PGR13 gene in a combined way is better than that of diagnosing the alpha fetoprotein gene and the PGR13 gene respectively and singly, so that the diagnosis time can be obviously shortened.
(2) The detection method used in the invention has the advantages of convenient sampling, simple operation, mature technology, capability of realizing real-time and large-scale detection and accurate detection result. The ROC curve analysis result shows that when the single alpha fetoprotein gene is used as an index to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 90% and the specificity is 84%; when the single PGR13 gene is used as an index to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 95%, and the specificity is 85%; when the alpha fetoprotein gene and the PGR13 gene are combined to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 94% and the specificity is 98%. The liver cancer marker alpha fetoprotein gene and PGR13 gene are used for combined diagnosis and detection of liver cancer, and the kit has high specificity and sensitivity and important use value in early clinical detection of liver cancer.
Drawings
FIG. 1 shows the expression of 8 pairs of differential genes in liver cancer and tissues beside the cancer in example 1.
FIG. 2 shows the detection of AFP expression in tissues beside and in liver cancer by RT-qPCR method 100 in example 3.
FIG. 3 shows the detection of PGR13 expression in tissues beside and on liver cancer by RT-qPCR method of example 3.
FIG. 4 shows the results of the analysis of the correlation of the expression of AFP and PGR13 in liver cancer and other tissues in example 3.
FIG. 5 is a ROC curve of diagnosing liver cancer by the alpha fetoprotein gene and PGR13 gene alone in example 4.
FIG. 6 is a ROC curve of the combination of alpha fetoprotein gene and PGR13 gene for diagnosing liver cancer in example 4.
Detailed Description
The technical scheme of the invention is further described by the following specific embodiments. It will be apparent to those skilled in the art that the examples are merely to aid in understanding the invention and are not to be construed as a specific limitation thereof.
The specific techniques or conditions are not identified in the examples and are described in the literature in this field or are carried out in accordance with the product specifications. The reagents or apparatus used were conventional products commercially available through regular channels, with no manufacturer noted.
Materials and instruments:
agilent expression profile chip kit: low input rapid amplification labelling kit, monochrome (Low Input Quick Amp Labeling Kit, one-Color), cat#5190-2305,Agilent technologies,Santa Clara,CA,US.
cRNA purification kit: RNeasy mini kit, cat#74106, QIAGEN, gmBH, germany.
Gene expression hybridization kit: gene Expression Hybridization Kit, cat#5188-5242,Agilent technologies,Santa Clara,CA,US.
Washing buffer kit for gene expression: gene Expression Wash Buffer Kit, cat#5188-5327,Agilent technologies,Santa Clara,CA,US.
Trizol was purchased from Norwegian corporation.
Reverse transcriptase was purchased from TAKARA corporation.
Real-time fluorescent quantitative PCR kits were purchased from ABI corporation.
Rolling hybridization furnace: hybridization Oven Cat #G2545A, agilent technologies Santa Clara, calif., US.
Washing a jar: starting dishes, cat#121,Thermo Shandon,Waltham,MA,US.
Microarray chip scanner platform: cat#G2565CA, agilent technologies, santa Clara, calif., US.
Example 1
The embodiment provides a screening method of liver cancer markers. And (3) screening genes which are differentially expressed in liver cancer tissues and tissues beside the cancer by mRNA gene chip analysis to obtain the gene serving as a liver cancer marker. The mRNA gene chip is prepared by 8 pairs of paired liver cancer tissues and paracancerous tissues. The mRNA gene chip analysis steps are as follows:
(1) Amplification and labelling of sample RNA
Extracting total RNA in tissues, amplifying and marking mRNA in the total RNA of the samples by adopting an Agilent expression profiling chip matched kit and a standard operation flow, and purifying the marked cRNA by using a cRNA purification kit.
(2) Chip hybridization
According to the hybridization standard flow and the kit and the gene expression hybridization kit provided by the Agilent expression profiling chip, the hybridization is carried out in a rolling hybridization furnace at 65 ℃ and 10rpm for 17 hours, the loading amount of hybridized cRNA is 600ng, and the film is washed in a washing tank, and the film is washed by using a washing buffer kit for gene expression.
(3) Chip scanning
The hybridized chip is scanned by a micro array chip scanner platform, and Dye channel is set by software: green, scan resolution=3 μm,20 bits. Data were read with Feature Extraction software 10.7.7 (Agilent technologies, santa Clara, calif., US) and normalized with Gene Spring Software 11.0.0 (Agilent technologies, santa Clara, calif., US) using the algorithm Quantile.
(4) Detection and analysis of chip signals
Statistical analysis uses classifier PAM and classifier WEKA to select subsets and construct classification models. The expression of 8 differential genes in liver cancer and tissues beside the cancer is shown in figure 1, wherein the PGR13 differential multiple is most obvious.
Example 2
The embodiment provides a kit for detecting the expression levels of alpha fetoprotein genes and PGR13 genes, wherein the kit comprises primer pairs for respectively and specifically amplifying the alpha fetoprotein genes and the PGR13 genes.
The upstream primer for specifically amplifying the alpha fetoprotein gene in the kit comprises a nucleotide sequence shown as SEQ ID No.1, and the downstream primer for specifically amplifying the alpha fetoprotein gene comprises a nucleotide sequence shown as SEQ ID No. 2.
The upstream primer for specifically amplifying the PGR13 gene in the kit comprises a nucleotide sequence shown as SEQ ID No.3, and the downstream primer for specifically amplifying the PGR13 gene comprises a nucleotide sequence shown as SEQ ID No. 4.
The kit also comprises a PCR buffer solution, an enzyme mixed solution and a fluorescent dye, and further comprises a primer pair for specifically amplifying the reference gene GAPDH.
In the invention, the upstream primer for specifically amplifying the reference gene GAPDH in the kit comprises a nucleotide sequence shown in SEQ ID No.5, and the downstream primer for specifically amplifying the reference gene GAPDH comprises a nucleotide sequence shown in SEQ ID No. 6.
Example 3
In this example, the kit for detecting the expression levels of alpha fetoprotein gene and PGR13 gene prepared in example 2 was used to detect the expression levels of alpha fetoprotein gene and PGR13 gene in tissues, and the RT-qPCR method was used to detect the expression levels of AFP gene and PGR13 gene in tissues.
(1) Extraction of Total RNA
Cutting soybean grains of 100 liver cancer tissues and paired cancer tissues, placing into an EP tube, adding 1ml of Trizol (total RNA extraction reagent), grinding in a grinder, sucking out Trizol after grinding the tissue, adding 200 μl of chloroform into each tube, shaking vigorously, mixing for 30s, and centrifuging at 4deg.C for 20min at 12000g after the chloroform is fully emulsified. The supernatant was transferred to a fresh EP tube (note not to be aspirated into the intermediate protein layer), an equal volume of pre-chilled isopropanol was added to the aspirated supernatant, the EP tube was inverted upside down, mixed well, and left to stand at-20℃for 20min, and centrifuged at 12000g for 10min to pellet RNA. The supernatant was aspirated, and a 70% cold ethanol solution prepared by adding 250. Mu.L of DEPC water (ultra pure water treated with diethyl pyrocarbonate, DEPC, diethyl pyrocarbonate and sterilized at high temperature) was added, and after mixing, centrifugation was performed at 4℃and 12000g for 10min, ethanol was removed, and the precipitate was air-dried at room temperature, and 50. Mu.L of DEPC water was added to dissolve RNA, and after spectrophotometry to determine the concentration of RNA and the A260/280 value, the RNA was stored at-80 ℃.
(2) cDNA synthesis by reverse transcription
The PCR system for reverse transcription synthesis is shown in Table 1.
TABLE 1
| Reagent(s) | Dosage of |
| Mixtures of reverse transcriptase, dNTPs and buffer | 2μL |
| Genomic DNA | 100ng |
| Water and its preparation method | Make up to 20 mu L |
The PCR conditions for reverse transcription are shown in Table 2.
TABLE 2
| Temperature (temperature) | Time |
| 25℃ | 10min |
| 42℃ | 30min |
| 85℃ | 5min |
The cDNA is synthesized by reverse transcription in a PCR instrument, and the cDNA is subpackaged and stored at-20 ℃ to be used as a cDNA template to be detected.
(3)RT-qPCR
The real-time fluorescent quantitative PCR kit is used for preparing a PCR system of RT-qPCR reaction according to instructions, the reaction system is shown in table 3, 3 compound wells are arranged in each reaction, and no template control is arranged at the same time. The mixture of enzyme cocktail, fluorescent dye and PCR buffer was 2X SYBR Green qPCR Mix, and 50X ROX dye II was added for correction of errors between wells due to sample addition and the like.
TABLE 3 Table 3
| Reagent(s) | Dosage (mu L) |
| Enzyme cocktail, mixture of fluorescent dye and PCR buffer | 10 |
| Forward primer (10. Mu.M) | 1 |
| Reverse primer (10. Mu.M) | 1 |
| cDNA template | 2 |
| 50×ROX DyeII | 0.4 |
| Water and its preparation method | Complement to 20 |
The primer sequences are shown in Table 4.
TABLE 4 Table 4
The reaction conditions for the optimized RT-qPCR are shown in Table 5.
TABLE 5
Fluorescence signals are collected during the extension phase, and the Quant Studio software analyzes to obtain the cycle threshold (CT value) of each gene in the sample. After the RT-qPCR reaction is finished, melting curve detection is carried out, and the reaction is carried out for 1 cycle. Each sample experiment was repeated 3 times. The reaction conditions for the melting curve detection are shown in Table 6.
TABLE 6
| Reaction temperature | Time |
| 95℃ | 15s |
| 60℃ | 60s |
| 95℃ | 15s |
Calculating the relative expression quantity of the AFP gene and the PGR13 gene according to the Ct value, wherein the relative expression quantity adopts a delta Ct method, namely delta Ctgene=delta Ctgene-delta Ctref; wherein gene is the target gene, ref is GAPDH gene, and GAPDH gene is the reference gene. All data are analyzed and output by SPSS 21.0 statistical software, metering data are expressed by mean ± standard deviation, t test is adopted, variance analysis is adopted for the differences among groups, and P <0.05 is the difference with statistical significance.
The detection results are shown in FIG. 2 and FIG. 3, wherein the ordinate is 2 of the target gene -ΔΔCt Values, abscissa are different types of tissue. Detecting the expression of AFP gene and PGR13 gene in 100 liver cancer tissues and paired paracancerous tissues, and finding that the AFP and PGR13 are remarkably and highly expressed in the liver cancer tissues; from FIG. 4, it can be seen that the relative expression amounts of the AFP gene and the PGR13 gene are positively correlated.
Example 4
The present example provides ROC curve verification of the marker AFP gene and PGR13 gene of the present invention. ROC curve: the receiver operating characteristic (receiver operating characteristic curve, ROC for short) is also called the sensitivity curve (sensitivity curve).
ROC curves were plotted by analyzing ROC curves of test and control groups based on the relative expression amounts of AFP gene and PGR13 gene (GAPDH as internal reference) in 100 liver cancer tissues and paired paracarcinoma tissues, with sensitivity (representing true positive rate) as ordinate and 1-specificity (representing false positive rate) as abscissa.
AUC (Area Under Curve) is the area enclosed by the ROC curve and the coordinate axis, and the area is smaller than 1. The AUC is between 0.5 and 1.0, and in the case that the AUC is greater than 0.5, the closer to 1 the AUC is, the higher the authenticity of the detection result is, which means that the better the diagnosis effect is. When the AUC is between 0.5 and 0.7, the diagnosis result has lower accuracy; when the AUC is between 0.7 and 0.9, the diagnosis result has certain accuracy; higher accuracy when AUC is greater than 0.9 or more; when auc=0.5, the detection result is the lowest in authenticity, which indicates that the diagnostic method is close to random guessing and has no application value.
The liver cancer was diagnosed by using the relative expression amounts of the AFP gene alone and the PGR13 gene alone, and the specificity and accuracy of the diagnosis of liver cancer were shown in FIG. 5.
FIG. 5 shows the diagnostic effects of AFP gene alone and PGR13 gene alone on liver cancer diagnosis. When the alpha fetoprotein gene is used as an index to distinguish liver cancer tissues from non-liver cancer tissues, the sensitivity is 90%, the specificity is 84%, the cut off value (critical value) is 2.65, and the AUC is 0.937; when PGR13 gene is used as an index to distinguish liver cancer tissue from non-liver cancer tissue, the sensitivity is 95%, the specificity is 85%, the cut off value (critical value) is 3.241, and the AUC is 0.959.
The liver cancer is diagnosed by adopting the combined expression quantity of the AFP gene and the PGR13 gene, the specificity and the accuracy of the diagnosis of the liver cancer are shown in the figure 6.
FIG. 6 shows the diagnostic effect of diagnosing liver cancer using the combined expression levels of AFP gene and PGR13 gene. When the alpha fetoprotein gene and the PGR13 gene are combined to distinguish liver cancer from non-liver cancer, the sensitivity is 94%, the specificity is 98%, the cut off value (critical value) is 0.655, and the AUC is 0.989.
In conclusion, the invention provides the liver cancer marker AFP gene and the PGR13 gene, and the liver cancer marker has high specificity and accuracy, can be used for diagnosing early liver cancer and detecting postoperative recurrence of liver cancer, and has important clinical significance.
The applicant declares that the above is only a specific embodiment of the present invention, but the scope of the present invention is not limited thereto, and it should be apparent to those skilled in the art that any changes or substitutions that are easily conceivable within the technical scope of the present invention disclosed by the present invention fall within the scope of the present invention and the disclosure.
Sequence listing
<110> Okamura Biotechnology (Shanghai) Co., ltd
<120> kit for detecting expression amounts of alpha fetoprotein gene and PGR13 gene and application thereof
<130> 2021
<160> 6
<170> PatentIn version 3.3
<210> 1
<211> 20
<212> DNA
<213> synthetic sequences
<400> 1
ctttgggctg ctcgctatga 20
<210> 2
<211> 23
<212> DNA
<213> synthetic sequences
<400> 2
gcatgttgat ttaacaagct gct 23
<210> 3
<211> 23
<212> DNA
<213> synthetic sequences
<400> 3
tagtgacacc ccacttaatc agc 23
<210> 4
<211> 21
<212> DNA
<213> synthetic sequences
<400> 4
aggtaggtca agcgaaatgg c 21
<210> 5
<211> 21
<212> DNA
<213> synthetic sequences
<400> 5
ctcaccggat gcaccaatgt t 21
<210> 6
<211> 21
<212> DNA
<213> synthetic sequences
<400> 6
cgcgttgctc acaatgttca t 21
21
Claims (6)
1.A kit for detecting the expression levels of alpha fetoprotein genes and PGR13 genes, which is characterized by comprising a primer pair for specifically amplifying the alpha fetoprotein genes and the PGR13 genes respectively;
the upstream primer of the specific amplification alpha-fetoprotein gene in the kit is shown as SEQ ID No.1, and the downstream primer of the specific amplification alpha-fetoprotein gene is shown as SEQ ID No. 2;
the upstream primer for specifically amplifying the PGR13 gene in the kit is shown as SEQ ID No.3, and the downstream primer for specifically amplifying the PGR13 gene is shown as SEQ ID No. 4;
the kit also comprises a PCR buffer solution, an enzyme mixed solution and a fluorescent dye;
the kit also comprises a primer pair for specifically amplifying the reference genes.
2. A method of using the kit for detecting the expression levels of alpha fetoprotein gene and PGR13 gene according to claim 1 for the purpose of non-disease diagnosis, comprising:
and carrying out RT-qPCR detection on the sample to be detected by using the primer pair for respectively specifically amplifying the alpha fetoprotein gene and the PGR13 gene, calculating the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene in the sample to be detected, and carrying out calculation analysis.
3. The method for using a kit for detecting the expression levels of alpha fetoprotein gene and PGR13 gene according to claim 2 for the purpose of non-disease diagnosis, comprising the steps of:
(1) Template preparation: extracting total RNA in a sample to be detected and synthesizing cDNA by reverse transcription;
(2) And (3) detection: detecting the obtained cDNA by RT-qPCR by using the primer pair for respectively and specifically amplifying the alpha fetoprotein gene and the PGR13 gene, and calculating the relative expression quantity of the alpha fetoprotein gene and the PGR13 gene according to a Ct value by using the GAPDH gene as an internal reference gene;
(3) Analysis: calculating the difference multiple of the relative expression amounts of the alpha fetoprotein gene and the PGR13 gene in the sample to be detected according to the relative expression amounts of the alpha fetoprotein gene and the PGR13 gene, and judging.
4. A system for identifying liver cancer, the system comprising:
and (3) a template preparation module: extracting total RNA in a sample and synthesizing cDNA by reverse transcription;
and a detection module: using the obtained cDNA as a template, carrying out RT-qPCR detection, and calculating the relative expression quantity;
and an analysis module: judging according to the difference multiple of the relative expression quantity;
genes detected by the detection module comprise alpha fetoprotein genes and PGR13 genes;
the upstream primer of the specific amplification alpha-fetoprotein gene is shown as SEQ ID No.1, and the downstream primer of the specific amplification alpha-fetoprotein gene is shown as SEQ ID No. 2;
the upstream primer for specifically amplifying the PGR13 gene is shown as SEQ ID No.3, and the downstream primer for specifically amplifying the PGR13 gene is shown as SEQ ID No. 4.
5. The system for identifying liver cancer according to claim 4, wherein the step of judging based on a multiple of the difference in the relative expression amounts comprises: calculating the difference multiple of the relative expression quantity of alpha fetoprotein gene and PGR13 gene in the sample, and carrying out liver cancer positive judgment according to the difference multiple.
6. Use of the kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene according to claim 1 and/or the system for identifying liver cancer according to claim 4 or 5 for preparing a product for diagnosis of liver cancer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111324996.8A CN113957149B (en) | 2021-11-10 | 2021-11-10 | Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111324996.8A CN113957149B (en) | 2021-11-10 | 2021-11-10 | Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113957149A CN113957149A (en) | 2022-01-21 |
| CN113957149B true CN113957149B (en) | 2024-03-19 |
Family
ID=79469963
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111324996.8A Active CN113957149B (en) | 2021-11-10 | 2021-11-10 | Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113957149B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102732608B (en) * | 2011-03-31 | 2014-12-10 | 中国科学院上海生命科学研究院 | Marker for diagnosing liver cancer and application thereof |
-
2021
- 2021-11-10 CN CN202111324996.8A patent/CN113957149B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113957149A (en) | 2022-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20230366034A1 (en) | Compositions and methods for diagnosing lung cancers using gene expression profiles | |
| WO2017202185A1 (en) | Peripheral blood gene marker for screening benign and malignant small pulmonary nodules and use thereof | |
| CN109055555B (en) | Lung cancer early stage metastasis diagnosis marker and kit and application thereof | |
| CN101851682A (en) | MiRNA combination used for detecting esophageal squamous cell carcinoma and application thereof | |
| CN108949969B (en) | Application of long-chain non-coding RNA in colorectal cancer | |
| CN110229899B (en) | Plasma marker combinations for early diagnosis or prognosis prediction of colorectal cancer | |
| CN113337613A (en) | Serum exosome tsRNA marker related to liver cancer, probe and application thereof | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN108950003B (en) | miRNA marker for diagnosing breast cancer and application of miRNA thereof | |
| CN110699454A (en) | Oligonucleotide, method and kit for detecting relative expression quantity of MLL5 gene in sample | |
| CN111518908B (en) | Urine prostate cancer marker combination and application thereof in preparation of accurate diagnostic reagent | |
| KR102194215B1 (en) | Biomarkers for Diagnosing Gastric Cancer And Uses Thereof | |
| CN112553341A (en) | Kidney clear cell carcinoma SCNN1 primer, diagnosis kit and application thereof | |
| CN113957149B (en) | Kit for detecting expression levels of alpha fetoprotein gene and PGR13 gene and application thereof | |
| CN113584169B (en) | Serum tsRNA marker and probe related to liver cancer and application of serum tsRNA marker and probe | |
| CN113249479B (en) | Pancreatic cancer related lncRNA marker, probe and application of detection kit in pancreatic cancer diagnosis | |
| CN112609002B (en) | Peripheral blood miRNA colon cancer diagnosis marker combination and detection kit thereof | |
| CN111154880B (en) | Bladder cancer body fluid biopsy biomarker and application thereof | |
| CN114410795A (en) | Liver cancer early detection based on miRNA (micro ribonucleic acid) feature marker | |
| WO2019095541A1 (en) | Composition and method for diagnosing and predicting breast cancer bone metastases | |
| CN108504740A (en) | A kind of UCR sequences, detection kit and the detection method of specificity overexpression in non-small cell lung cancer | |
| CN113373229B (en) | Gastric cancer related biomarker and application thereof | |
| CN111455057B (en) | Kit, device and method for lung cancer diagnosis | |
| CN112176060B (en) | Plasma non-coding RNA and primer set for detecting expression level thereof and colorectal cancer detection kit | |
| CN116732171B (en) | Primer probe combination for screening colorectal cancer methylation double sites and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |