CN118127151A - Composition for detecting bladder cancer, kit and application thereof - Google Patents
Composition for detecting bladder cancer, kit and application thereof Download PDFInfo
- Publication number
- CN118127151A CN118127151A CN202211500585.4A CN202211500585A CN118127151A CN 118127151 A CN118127151 A CN 118127151A CN 202211500585 A CN202211500585 A CN 202211500585A CN 118127151 A CN118127151 A CN 118127151A
- Authority
- CN
- China
- Prior art keywords
- bladder cancer
- detection
- seq
- composition
- methylation
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
- 206010005003 Bladder cancer Diseases 0.000 title claims abstract description 60
- 208000007097 Urinary Bladder Neoplasms Diseases 0.000 title claims abstract description 56
- 201000005112 urinary bladder cancer Diseases 0.000 title claims abstract description 54
- 239000000203 mixture Substances 0.000 title claims abstract description 30
- 238000001514 detection method Methods 0.000 claims abstract description 73
- 230000011987 methylation Effects 0.000 claims abstract description 45
- 238000007069 methylation reaction Methods 0.000 claims abstract description 45
- 239000003153 chemical reaction reagent Substances 0.000 claims abstract description 33
- 101000584392 Homo sapiens Homeobox protein OTX1 Proteins 0.000 claims abstract description 13
- 101000601048 Homo sapiens Nidogen-2 Proteins 0.000 claims abstract description 13
- 101150018417 VIM gene Proteins 0.000 claims abstract description 4
- 239000000523 sample Substances 0.000 claims description 42
- 108020004707 nucleic acids Proteins 0.000 claims description 20
- 150000007523 nucleic acids Chemical class 0.000 claims description 20
- 102000039446 nucleic acids Human genes 0.000 claims description 20
- 238000003753 real-time PCR Methods 0.000 claims description 9
- 108091008146 restriction endonucleases Proteins 0.000 claims description 7
- 238000012163 sequencing technique Methods 0.000 claims description 7
- 108020004711 Nucleic Acid Probes Proteins 0.000 claims description 5
- 238000012544 monitoring process Methods 0.000 claims description 5
- 239000002853 nucleic acid probe Substances 0.000 claims description 5
- 108090000790 Enzymes Proteins 0.000 claims description 2
- 102000004190 Enzymes Human genes 0.000 claims description 2
- 238000004519 manufacturing process Methods 0.000 claims description 2
- 239000000872 buffer Substances 0.000 claims 1
- 238000011144 upstream manufacturing Methods 0.000 claims 1
- 230000035945 sensitivity Effects 0.000 abstract description 20
- 210000001519 tissue Anatomy 0.000 description 28
- 210000002700 urine Anatomy 0.000 description 28
- 206010028980 Neoplasm Diseases 0.000 description 20
- 108090000623 proteins and genes Proteins 0.000 description 20
- 108020004414 DNA Proteins 0.000 description 18
- 238000006243 chemical reaction Methods 0.000 description 16
- 102100030636 Homeobox protein OTX1 Human genes 0.000 description 9
- 101000803403 Homo sapiens Vimentin Proteins 0.000 description 9
- 102100037371 Nidogen-2 Human genes 0.000 description 9
- 102100035071 Vimentin Human genes 0.000 description 9
- 238000012216 screening Methods 0.000 description 9
- 201000011510 cancer Diseases 0.000 description 8
- 108091029523 CpG island Proteins 0.000 description 7
- 238000004458 analytical method Methods 0.000 description 7
- 108010085238 Actins Proteins 0.000 description 6
- 238000000034 method Methods 0.000 description 6
- 230000002980 postoperative effect Effects 0.000 description 6
- 230000007067 DNA methylation Effects 0.000 description 5
- 239000012634 fragment Substances 0.000 description 5
- 239000012188 paraffin wax Substances 0.000 description 5
- 238000007400 DNA extraction Methods 0.000 description 4
- 230000003321 amplification Effects 0.000 description 4
- 238000003745 diagnosis Methods 0.000 description 4
- 239000003550 marker Substances 0.000 description 4
- 210000003205 muscle Anatomy 0.000 description 4
- 238000003199 nucleic acid amplification method Methods 0.000 description 4
- LSNNMFCWUKXFEE-UHFFFAOYSA-M Bisulfite Chemical compound OS([O-])=O LSNNMFCWUKXFEE-UHFFFAOYSA-M 0.000 description 3
- 238000012408 PCR amplification Methods 0.000 description 3
- 210000004369 blood Anatomy 0.000 description 3
- 239000008280 blood Substances 0.000 description 3
- 210000004027 cell Anatomy 0.000 description 3
- 238000003776 cleavage reaction Methods 0.000 description 3
- OPTASPLRGRRNAP-UHFFFAOYSA-N cytosine Chemical group NC=1C=CNC(=O)N=1 OPTASPLRGRRNAP-UHFFFAOYSA-N 0.000 description 3
- 238000011161 development Methods 0.000 description 3
- 230000018109 developmental process Effects 0.000 description 3
- 238000000605 extraction Methods 0.000 description 3
- 230000007017 scission Effects 0.000 description 3
- 238000012360 testing method Methods 0.000 description 3
- 108700039691 Genetic Promoter Regions Proteins 0.000 description 2
- 230000000052 comparative effect Effects 0.000 description 2
- 230000000875 corresponding effect Effects 0.000 description 2
- 238000002574 cystoscopy Methods 0.000 description 2
- 238000005516 engineering process Methods 0.000 description 2
- 230000014509 gene expression Effects 0.000 description 2
- 238000003384 imaging method Methods 0.000 description 2
- 238000011528 liquid biopsy Methods 0.000 description 2
- 238000002493 microarray Methods 0.000 description 2
- 210000002381 plasma Anatomy 0.000 description 2
- 238000002271 resection Methods 0.000 description 2
- 241000894007 species Species 0.000 description 2
- 206010041823 squamous cell carcinoma Diseases 0.000 description 2
- 208000017572 squamous cell neoplasm Diseases 0.000 description 2
- 206010044412 transitional cell carcinoma Diseases 0.000 description 2
- 239000000439 tumor marker Substances 0.000 description 2
- 230000002485 urinary effect Effects 0.000 description 2
- 101150028074 2 gene Proteins 0.000 description 1
- WVYWICLMDOOCFB-UHFFFAOYSA-N 4-methyl-2-pentanol Chemical compound CC(C)CC(C)O WVYWICLMDOOCFB-UHFFFAOYSA-N 0.000 description 1
- 102100022900 Actin, cytoplasmic 1 Human genes 0.000 description 1
- 206010004992 Bladder adenocarcinoma stage unspecified Diseases 0.000 description 1
- 208000009458 Carcinoma in Situ Diseases 0.000 description 1
- 108700039887 Essential Genes Proteins 0.000 description 1
- 101001099423 Homo sapiens Proenkephalin-A Proteins 0.000 description 1
- 101000964613 Homo sapiens Zinc finger protein 154 Proteins 0.000 description 1
- 206010064912 Malignant transformation Diseases 0.000 description 1
- 108700019961 Neoplasm Genes Proteins 0.000 description 1
- 102000048850 Neoplasm Genes Human genes 0.000 description 1
- 206010061309 Neoplasm progression Diseases 0.000 description 1
- 102100036961 Nuclear mitotic apparatus protein 1 Human genes 0.000 description 1
- 229910019142 PO4 Inorganic materials 0.000 description 1
- 208000002193 Pain Diseases 0.000 description 1
- 208000037273 Pathologic Processes Diseases 0.000 description 1
- 102100038931 Proenkephalin-A Human genes 0.000 description 1
- LSNNMFCWUKXFEE-UHFFFAOYSA-N Sulfurous acid Chemical compound OS(O)=O LSNNMFCWUKXFEE-UHFFFAOYSA-N 0.000 description 1
- 102000044209 Tumor Suppressor Genes Human genes 0.000 description 1
- 108700025716 Tumor Suppressor Genes Proteins 0.000 description 1
- 102100040784 Zinc finger protein 154 Human genes 0.000 description 1
- 230000006578 abscission Effects 0.000 description 1
- 208000009956 adenocarcinoma Diseases 0.000 description 1
- 239000000427 antigen Substances 0.000 description 1
- 108091007433 antigens Proteins 0.000 description 1
- 102000036639 antigens Human genes 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- 230000004791 biological behavior Effects 0.000 description 1
- 239000012472 biological sample Substances 0.000 description 1
- 238000001574 biopsy Methods 0.000 description 1
- 201000006587 bladder adenocarcinoma Diseases 0.000 description 1
- 201000000545 bladder carcinoma in situ Diseases 0.000 description 1
- 210000000601 blood cell Anatomy 0.000 description 1
- 210000001124 body fluid Anatomy 0.000 description 1
- 239000010839 body fluid Substances 0.000 description 1
- 239000007853 buffer solution Substances 0.000 description 1
- 230000008859 change Effects 0.000 description 1
- 239000012295 chemical reaction liquid Substances 0.000 description 1
- 239000003795 chemical substances by application Substances 0.000 description 1
- 238000002512 chemotherapy Methods 0.000 description 1
- 230000000112 colonic effect Effects 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 229940104302 cytosine Drugs 0.000 description 1
- 230000007547 defect Effects 0.000 description 1
- 239000012502 diagnostic product Substances 0.000 description 1
- 238000013399 early diagnosis Methods 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 230000007613 environmental effect Effects 0.000 description 1
- 230000006862 enzymatic digestion Effects 0.000 description 1
- 210000000416 exudates and transudate Anatomy 0.000 description 1
- 238000001917 fluorescence detection Methods 0.000 description 1
- 239000007850 fluorescent dye Substances 0.000 description 1
- 238000009472 formulation Methods 0.000 description 1
- 230000002068 genetic effect Effects 0.000 description 1
- PCHJSUWPFVWCPO-UHFFFAOYSA-N gold Chemical compound [Au] PCHJSUWPFVWCPO-UHFFFAOYSA-N 0.000 description 1
- 201000004933 in situ carcinoma Diseases 0.000 description 1
- 238000007901 in situ hybridization Methods 0.000 description 1
- 230000036212 malign transformation Effects 0.000 description 1
- 210000004877 mucosa Anatomy 0.000 description 1
- 210000004400 mucous membrane Anatomy 0.000 description 1
- 230000002632 myometrial effect Effects 0.000 description 1
- 108010036112 nuclear matrix protein 22 Proteins 0.000 description 1
- 210000000056 organ Anatomy 0.000 description 1
- 230000036407 pain Effects 0.000 description 1
- 230000009054 pathological process Effects 0.000 description 1
- 239000013610 patient sample Substances 0.000 description 1
- 230000010412 perfusion Effects 0.000 description 1
- 239000010452 phosphate Substances 0.000 description 1
- 230000008569 process Effects 0.000 description 1
- 238000004393 prognosis Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 150000003254 radicals Chemical class 0.000 description 1
- 238000011160 research Methods 0.000 description 1
- 238000012552 review Methods 0.000 description 1
- 210000002966 serum Anatomy 0.000 description 1
- 239000000243 solution Substances 0.000 description 1
- 238000011895 specific detection Methods 0.000 description 1
- 238000001356 surgical procedure Methods 0.000 description 1
- 230000004083 survival effect Effects 0.000 description 1
- 230000009466 transformation Effects 0.000 description 1
- 230000000472 traumatic effect Effects 0.000 description 1
- 230000005751 tumor progression Effects 0.000 description 1
- 238000002604 ultrasonography Methods 0.000 description 1
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to the field of molecular biology detection, and more particularly to the field of bladder cancer detection. The present invention provides a composition for detecting bladder cancer comprising a detection reagent for detecting the methylation level of: the OTX1 gene has a region shown as SEQ ID NO. 1; the region of the VIM gene shown in SEQ ID NO. 2; and the region of the NID2 gene shown in SEQ ID NO. 3. Also provided are kits comprising the compositions, uses of the compositions. Can detect bladder cancer clinically with high sensitivity and good specificity; clinically, it can be sensitively and specifically detected at an early stage of bladder cancer.
Description
Technical Field
The invention belongs to the field of molecular biology detection, in particular to the field of bladder cancer detection, and more particularly relates to detection of methylation level of bladder cancer gene markers.
Background
Bladder cancer is one of the most common malignant tumors of the urinary system. The occurrence and development of bladder cancer are complex, multi-factor and multi-step pathological processes, and researches show that the inherent genetic factors and the external environmental factors play an important role in the occurrence and development of tumors. Bladder cancer mainly includes urothelial (transitional cell) cancer, squamous cell cancer, and adenocarcinoma, wherein the urothelial cancer of the bladder accounts for more than 90% of the bladder cancer, and the squamous cell cancer of the bladder accounts for about 3% -7%; bladder adenocarcinoma ratio <2%. According to whether the tumor infiltrates into the bladder muscle layer, the tumor is divided into Non-muscle layer invasive bladder cancer (Non-muscle invasive bladder cancer, NMIBC) and muscle layer invasive bladder cancer (Muscle invasive bladder cancer, MIBC), and the biological behaviors, treatment modes and prognosis of the tumor are obviously different. About 70% of patients with bladder cancer at the first diagnosis are non-muscle invasive bladder cancer, the tumor is limited to the mucosa lamina propria, transurethral bladder tumor resection (TURBT) and postoperative bladder perfusion chemotherapy are adopted, and the survival rate of more than 80% in 5 years can be achieved. However, for myometrial invasive bladder cancer, radical total bladder resection and urinary diversion surgery are required, with high surgical complications (about 40% -50%), which are traumatic to the patient and poor post-operative quality of life. In addition, the recurrence rate after bladder cancer operation is high, and 3-4 cystoscopic reviews are needed each year. Thus, early screening and post-operative monitoring of bladder cancer are of great clinical importance.
At present, the diagnosis and postoperative monitoring method of bladder cancer comprises the following steps: urine shed cytology, tumor marker detection, conventional imaging, and cystoscopy. Urine abscission cytology has the advantages of no wound, non-invasiveness and high specificity, but the sensitivity is positively correlated with tumor grading, the positive rate of G3 and high-grade urothelial cancers and carcinoma in situ can reach 84 percent, and the sensitivity in G1 and low-grade tumors is only 16 percent. Thus, urine cytology fails to detect the occurrence of early bladder cancer. Tumor marker detection comprises nuclear matrix protein 22 (NMT 22), bladder tumor antigen related (BTAstat and BTAtrak), fluorescence In Situ Hybridization (FISH) of urine and the like, has the sensitivity of only 39-51 percent for low-grade and Ta-stage tumors and the specificity of 53-95 percent, and has the defect of unsatisfactory diagnostic performance, so the methods have not been widely applied clinically. Conventional imaging (ultrasound, CT, MRI) has limited ability to diagnose bladder carcinoma in situ and smaller tumors (< 5 mm), and is not generally used for early screening of bladder cancer and postoperative recurrence monitoring. Cystoscopy is a gold standard for bladder cancer diagnosis, and is also one of the primary means of postoperative recurrence monitoring. Cystoscope belongs to invasive examination, has the characteristics of causing pains of patients, having high medical cost and the like, is limited in clinical work, and is not suitable for early screening of bladder cancer. Therefore, development of an effective early screening technology is needed to realize painless and noninvasive screening of bladder cancer, and is economical, convenient, accurate and efficient.
In recent years, based on the diagnosis technology of PCR, NGS and the like, liquid biopsy is continuously developed and broken through, and the liquid biopsy is a powerful weapon for accurate early screening of cancers. ctDNA methylation is a desirable detection marker from the standpoint of signal abundance and signal intensity of the marker. Studies have shown that elevated levels of cancer suppressor gene methylation often occur in the early stages of cancer and are a hallmark change in early tumor progression; in the CpG island of human genome, 60-80% of cytosine residues are methylation modified, and DNA methylation has become a common and abundant signal source in early screening of cancers; in addition, different cancer types have unique DNA methylation patterns, the organ specificity is strong, and the tissue tracing can be realized. Therefore, ctDNA methylation is a mainstream detection index adopted by early screening enterprises at home and abroad.
There is a need in the art for a more effective bladder cancer diagnostic product that allows for early diagnosis of bladder cancer with high sensitivity and specificity, yet is non-invasive and rapid.
Disclosure of Invention
In view of this, the present invention provides a composition for detecting bladder cancer, the composition comprising a detection reagent for detecting the methylation level of:
the OTX1 gene has a region shown as SEQ ID NO. 1;
The region of the VIM gene shown in SEQ ID NO. 2; and
The region of the NID2 gene shown in SEQ ID NO. 3.
The region shown as SEQ ID NO.1 in the OTX1 gene, the region shown as SEQ ID NO. 2 in the VIM gene and the region shown as SEQ ID NO. 3 in the NID2 gene are a sequence of CpG islands of the promoter regions in the respective genes.
Specifically, the SEQ ID NO:1 region of the OTX1 (Genbank accession number: NM-001199770.2) gene is shown below:
TCCAAATCAAAACCACTAAGAGTTCCTCCCGCGCAGACTGCTGCCCCTTC
AGCTGCCCTCGATTTTGCTCCACGCCTGCCGGCCAGAGCCTCCCGGCGTT
TCTTCCGCCCCAGCGGAGTGCGCTGGGGCGCGCCAGGGCTAGGCCCGCC
GGAGGAGCGCGTCCCCAGCCTTCCGCGCACAGAGCCGCATCCCGCCCCG
CCCTGCGCTGGACTGGTTCAAGCTTCCGCCTCGGCGGGAACGCTGTACAT
AGTCAGGTCCGTTCCAGGGACCACTTAAACTTTTTAGTTGCTGTTGGTTGGTTGAACTGAACATATCTTGTCTTAGCACCCAGGAAACAGAA；
the SEQ ID NO:2 region of the VIM (Genbank accession number: NG_ 012413.1) gene is shown below:
CCCACCCCACCCGCCCACCCTCCCCGCTTCTCGCTAGGTCCCTATTGGCTG
GCGCGCTCCGCGGCTGGGATGGCAGTGGGAGGGGACCCTCTTTCCTAACG
GGGTTATAAAAACAGCGCCCTCGGCGGGGTCCAGTCCTCTGCCACTCTCG
CTCCGAGGTCCCCGCGCCAGAGACGCAGCCGCGCTCCCACCACCCACAC
CCACCGCGCCCTCGTTCGCCTCTTCTCCGGGAGCCAGTCCGCGCCACCGC
CGCCGCCCAGGCCATCGCCACCCTCCGCAGCCATGTCCACCAGGTCCGTGTCCTCGTCCTCCTACCGCAGGATGTTCGGCGGCCCGGG；
the region of SEQ ID NO:3 of the NID2 (Genbank accession number: AL 118557.5) gene is shown below ：CCTGGCCAGGAGCTTTTACCCCGCCAGCCCCGCTGCTCCAGCGGCCGCTGCCTTAGAAAAGTTAACGAGAACCAGATGTGGTGGCCACTGCCGAACTTTCTCAGAGCCGGTGATTGGTCCCCAGCCGAGGGCCTCAGCCAATTAGCTTGCTGGGTGGGCCTGGAGTCCCGCCCCGCCCAGGCGCCCGCGGAGATCCAGGTTCGAGGCTGGCGCGGCGCGGAGAGTGGGCTGGAGGCCGGGGCGGGACGCGTTGTGCAGCGGGTAAGCGCACGGCCGAGCGAGCATGGAGGGGGACCGGGTGGCCGGGCGGCCGGTGCTGTCGTCGTTACCAGTGCTACTGCTGCTGCCGTTGCTAATGTTGCGGGCCGCGGCGCTGCACCCAGACGAGCTCTTCCCACACGGGGAGTCGTGGGGGGACCA.
The composition can detect bladder cancer tissue samples clinically with 100% sensitivity; clinically, it can be sensitively and specifically detected at an early stage of bladder cancer malignant transformation.
In the present invention, "CpG island" is an abbreviation of cytosine (C) -phosphate (p) -guanine (G), and refers to a promoter and an exon region located in a gene, and is a region rich in CpG dinucleotides, and the length of the region is 300-3000 bp.
In some embodiments, the methylation level of a CpG island or a sequence on a CpG island on a corresponding gene present in a sample can be detected using the detection reagents of the invention.
In the present invention, a "sample" is a biological sample selected from an individual. Specifically, for example, selected from cell lines, histological sections, tissue biopsies/paraffin-embedded tissues, body fluids, stool, colonic exudates, urine, serum, whole blood, isolated blood cells, cells isolated from blood, or combinations thereof.
Preferably, the "sample" of the present invention is urine, i.e. free DNA in urine.
Free DNA in urine can be used for detecting tumors, and has the characteristics of small harm to patients, good specificity and the like. However, since the content of the fluorescent dye in urine is extremely low, there is a problem of low sensitivity. The detection reagent of the present invention can use free DNA in urine as a sample, and can detect clinically with a sensitivity of 86.44% and a specificity of 94.29%.
In the present invention, the "detection reagent" refers to a reagent for detecting the methylation level of a gene in a sample. Wherein the methylation level is measured by means of amplification-sequencing, chip, methylation fluorescent quantitative PCR.
In some specific embodiments, detection reagents include, but are not limited to, nucleic acid primers, sequencing Tag sequences, for measuring methylation levels by amplification-sequencing.
In some specific embodiments, the detection reagent includes, but is not limited to, a chip that is a methylation chip having probes that specifically bind to a methylation region. The chip may be Human DNA Methylation 2.1.1M Deluxe Promoter Array, human DNA Methylation Array, including, but not limited to, for example, agilent's Human CPG ISLAND Microarrays and Human DNAMethylation Microarrays, illumina's Infinium HumanMethylation BeadChip, infinium HumanMethylation450 BeadChip and GoldenGate Methylation Assay, and Roche NimbleGen, etc., for measuring methylation levels by chip.
In some specific embodiments, detection reagents include, but are not limited to, nucleic acid primers and nucleic acid probes for measuring methylation levels by methylation fluorescent quantitative PCR.
Further, the detection reagent also comprises an internal standard primer and an internal standard probe.
In a specific embodiment, the target of the internal primers and probes is the beta-actin gene.
In a preferred embodiment, the target of the internal primers and probes is the region of the beta-actin gene shown in SEQ ID NO. 4.
The region of SEQ ID NO:4 of the beta-actin Gene (Gene bank accession number: NG_ 007992.1) is shown below:
CCCCCAAAGTTCACAATGTGGCCGAGGACTTTGATTGCACATTGTTGTTTT
TTTAATAGTCATTCCAAATATGAGATGCGTTGTTACAGGAAGTCCCTTGCC
ATCCTAAAAGCCACCCCACTTCTCTCTAAGGAGAATGGCCCAGTCCTCTC
CCAAGTCCACACAGGGGAGGTGATAGCATTGCTTTCGTGTAAATTATGTAA
TGCAAAATTTTTTTAATCTTCGCCTTAATACTTTTTTATTTTGTTTTATTTTGAA。
When the detection reagent includes a nucleic acid primer and a nucleic acid probe, the detection reagent detects the methylation level of the nucleic acid in the sample by methylation fluorescent quantitative PCR.
In the invention, the expression "methylation fluorescent quantitative PCR" refers to that a region to be detected is subjected to enzymatic digestion by sulfite conversion or methylation-sensitive restriction enzyme, and then a primer and a probe specifically designed for a detection target are used for fluorescent quantitative PCR detection, so that the methylation level of the region to be detected is obtained.
Further, the above composition may further include the remaining reagents, specifically, for example, various reagents required for pretreatment or pretreatment of the sample. For example, a nucleic acid releasing agent for extracting a sample nucleic acid, a bisulfite or bisulfite used for transformation, or the like.
In some specific embodiments, the detection reagent is as shown in table 1:
TABLE 1
| Numbering device | Primer/probe | Sequence (5 '-3') |
| SEQ ID NO:5 | BC-OTX1-F | TAGGCCCGCCGGAGGAGC |
| SEQ ID NO:6 | BC-OTX1-R | TACAGCGTTCCCGCCGAGG |
| SEQ ID NO:7 | BC-OTX1-P | TTCCGCGCACAGAGCCGCATCC |
| SEQ ID NO:8 | BC-VIM-F | CCAGTCCTCTGCCACTCTCGC |
| SEQ ID NO:9 | BC-VIM-R | GGTGGACATGGCTGCGGA |
| SEQ ID NO:10 | BC-VIM-P | ACTGGCTCCCGGAGAAGAGGCGA |
| SEQ ID NO:11 | BC-NID2-F | CAGCCAATTAGCTTGCTGGGTG |
| SEQ ID NO:12 | BC-NID2-R | CCCCCTCCATGCTCGCTC |
| SEQ ID NO:13 | BC-NID2-P | CCCCGGCCTCCAGCCCACT |
| SEQ ID NO:14 | ME-Actin-F | GTTGTTACAGGAAGTCCCTTGCC |
| SEQ ID NO:15 | ME-Actin-R | GCAATGCTATCACCTCCCCTGTG |
| SEQ ID NO:16 | ME-Actin-P | CTTGGGAGAGGACTGGGCCATTCTCC |
In some specific embodiments, the 4 fluorescence channels adopted in the present invention are FAM, ROX, HEX and CY5 channels, respectively, but the present invention is not limited to this in practice, and any other combination of fluorescence channels can be adopted; meanwhile, different targets can also correspond to different fluorescent channels, for example, any fluorescent channel can be used as an internal standard detection channel.
With the preferred embodiment, the sensitivity and specificity of detection are improved by about 10% respectively compared with the compositions using the rest of the primers and probes, so that the early bladder cancer can be detected clinically with higher sensitivity and better specificity by using the preferred composition, and the detection accuracy of the early bladder cancer is further improved.
In a second aspect, the present invention provides the use of a composition as described above in the manufacture of a kit for detecting bladder cancer.
Further, the invention provides the use of the reagent combination in preparing a kit for detecting bladder cancer by using free DNA of urine.
In a third aspect, the present invention provides a kit for detecting bladder cancer, the kit comprising a composition as described above.
Further, the kit further includes, but is not limited to, at least one of a reagent for extracting nucleic acid, a reagent for purifying nucleic acid, and bisulfite.
Further, the kit further comprises a negative sample.
Specifically, the negative sample is human genomic DNA that was verified by sequencing to be free of methylation of the target gene.
Further, the reagent for extracting nucleic acid is a reagent for extracting tissue DNA and a reagent for urine free DNA.
Further, the reagent for extracting nucleic acid is a reagent for extracting free DNA of urine.
Further, the kit further comprises at least one of dNTPs, mg 2+, methylation sensitive restriction enzymes, PCR buffer solution and hot start enzymes.
Further, the methylation sensitive restriction enzyme comprises at least one of HpaII and HinP 1I.
Further, the ranges of the final concentrations of the components are as follows: mg 2+ -6 mM, dNTPs 1-80 mM, methylation sensitive restriction enzyme 0.01-30U, primer 0.1-40 mu M, probe 0.1-20 mu M.
Drawings
FIG. 1 is a graph showing the detection of methylation in 0.05 ng/reaction of a composition of the invention;
FIG. 2 is a graph showing the detection of the absence of non-specific amplification of the composition of the invention in 20 ng/reaction of non-methylated DNA;
FIG. 3 shows the results of detection of bladder cancer tissue and paracancerous tissue by the composition of the present invention.
Detailed Description
The advantages and various effects of the present invention will be more clearly apparent from the following detailed description and examples. It will be understood by those skilled in the art that these specific embodiments and examples are intended to illustrate the invention, not to limit the invention.
Example 1, primers and probes used in the present invention
The present invention collects tumor methylation detection data from the TCGA dataset (https:// TCGA. Xenahub. Net) of the UCSC Xena website and the GEO database of the National Center for Biotechnology Information (NCBI). Performing differential analysis on bladder cancer and control data, annotating physical positions and gene information on differential sites, and in order to ensure that the screened fragments have consistent methylation levels, the screening of methylated gene fragments is required to simultaneously meet the following requirements: 1) Requiring that the selected gene fragment have a methylation level that is more consistent at not less than 2 sites; 2) Performing differential analysis on bladder cancer and a paracancerous tissue or a normal control tissue, and selecting methylated gene fragments which have high consistency and high difference with the paracancerous tissue or the normal tissue in a bladder cancer sample; 3) Performing differential analysis by using the methylation detection data of the bladder cancer and the whole blood of the healthy sample, and selecting gene fragments with high methylation of the bladder cancer differential; 4) And finally, analyzing the methylation sites one by one, thereby obtaining candidate methylation sites.
Finally, the detection target of the optimal combination of three gene promoter regions CpG islands of OTX1, VIM and NID2 is determined, and the beta-actin gene is used as an internal detection standard. The compositions used in the present invention are shown in tables 1 and 5.
Example 2 Gene methylation level detection in clinical samples
Positive samples: the standard methylated human genome DNA and the target gene unmethylated human genome DNA are mixed and prepared, and the concentration is 1 ng/mu L and the standard methylated human genome DNA contains 10 percent; 1% standard methylated human genomic DNA at a concentration of 1 ng/. Mu.L; at a concentration of 1 ng/. Mu.L containing 0.5% of standard methylated human genomic DNA;
negative samples: sequencing to verify that the human genome DNA without target gene methylation is 2 ng/. Mu.L;
methylation sensitive restriction enzymes: including HpaII, hinP1I;
The detection process comprises the following steps:
and (3) configuring a PCR system: PCR reaction solutions were prepared according to the reagent formulations shown in Table 2 below
TABLE 2
The sample is added into a PCR reaction tube according to 10 mu L/reaction, then 40 mu L of PCR reaction liquid is added in sequence, a PCR tube cover is covered, and after shaking and mixing, the sample is centrifuged for 5 seconds instantaneously.
Fluorescent PCR reaction and result analysis
1) And placing the PCR reaction tube into a sample tank of an amplification instrument, and setting the names of samples to be detected according to the corresponding sequence.
2) Fluorescence detection channel selection: selecting a FAM channel (Reportere: FAM, quantiser: none) to detect OTX1; selecting a ROX channel (Reportere: ROX, quantiser: none) to detect VIM; selecting a HEX channel (Reportere: HEX, quantiser: none) to detect NID2; CY5 channel (Reportere: CY5, quantiser: none) is selected as an internal standard to detect housekeeping gene beta-actin;
3) The fluorescent quantitative PCR reaction conditions were table 3:
TABLE 3 Table 3
4) Analysis of results
After the reaction is finished, the instrument automatically stores the result, and the automatic analysis can be performed by using software of the instrument (the analysis can be performed by manually adjusting the starting value, the ending value and the threshold line value of the base line), and the intersection point of the amplification curve and the threshold line is called Ct (cycle threshold, which is the cycle number undergone when the fluorescent signal in the PCR reaction tube reaches the set threshold). As shown in FIGS. 1-2, the sensitivity of the detection reagent provided by the invention can reach 0.05 ng/reaction (FIG. 1), and the detection reagent has no non-specific amplification in 20 ng/reaction of non-methylated DNA (FIG. 2).
Example 3 detection of bladder cancer tissue and paracancerous tissue
Samples of paraffin sections of 20 bladder cancer tissues and 20 paracancerous tissues were collected.
Extracting a paraffin tissue sample by adopting a St.Hunan organism S1008 nucleic acid extraction kit; according to the procedure of the first embodiment, the nucleic acid sample cleavage treatment and the PCR amplification detection are performed in the same reaction tube. The interpretation of clinical outcome was performed as follows: judging whether the experimental result meets the quality control requirement according to the Ct value of the internal standard gene beta-actin, if the Ct value is more than 27, not including result statistics; and setting the positive judging Ct value of the three target genes of OTX1, VIM and NID2 to be 32 according to the lowest detection limit of the detection reagent. Table 4 shows Ct values of 40 cases of sample fluorescence quantitative PCR detection results, 20 cases of bladder cancer tissue samples (T001-T020) are positive, and 20 cases of paracancerous tissue samples (P001-P020) are negative, which indicates that the gene expression level of three target genes of OTX1, VIM and NID2 in bladder cancer tissues is higher than that of the paracancerous tissues (figure 3).
Table 4, 40 samples fluorescence quantitative PCR detection results Ct value
EXAMPLE 4 results of testing clinical samples with the compositions of the invention
Collecting 129 clinical urine samples, wherein 59 urine samples of patients with bladder cancer, 30 urine samples of healthy people and 40 urine samples of other patients with cancer; at the same time, 81 samples of paraffin sections of cancer tissue from patients with bladder cancer were also collected.
Extracting urine free DNA by adopting a blood plasma free DNA extraction kit (the same is applicable to urine free DNA extraction); according to the second embodiment, a Saint Hunan S1008 nucleic acid extraction kit is used for extracting the paraffin tissue sample; according to the procedure of the first embodiment, the nucleic acid sample cleavage treatment and the PCR amplification detection are performed in the same reaction tube. And performing interpretation according to the interpretation mode of the second embodiment. The detection sensitivity and the specificity of the kit in a urine sample are 86.44% and 94.29%, respectively, and the detection sensitivity in a tissue sample is 93.83%, specifically shown in the following table 5.
TABLE 5
Tissue sample detection sensitivity (%) =number of positive detections/total number of positive cases =100% =93.83%;
urine sample detection sensitivity (%) =number of positive detections/total number of positive cases =100% =86.44%;
urine sample detection specificity (%) = total number of negative detections/total number of negative samples =100% = 94.29%;
Cancer species specificity (%) = number of negative detections of non-bladder cancer patients/total number of non-bladder cancer patients =100% = 95%,
Wherein the negative samples are pooled from all non-bladder cancer patient samples.
In conclusion, the sensitivity of the detection of the three target combined markers OTX1, VIM and NID2 on the bladder cancer tissue sample is 93.83%, which indicates that the three detection targets are bladder cancer tissue specific methylation genes and are closely related to bladder cancer; the target combination marker is adopted to detect urine samples of patients with non-bladder cancer, the specificity reaches 95%, which indicates that the detection system has good cancer species specificity; the detection sensitivity of the target combination marker to urine samples of patients with bladder cancer reaches 86.44%, and the specificity reaches 94.29%.
Example 5 results of testing clinical samples with comparative example compositions of the invention
According to the clinical samples collected in example 4, urine free DNA was extracted using a plasma free DNA extraction kit (the same applies to urine free DNA extraction); extracting a paraffin tissue sample by adopting a St.Hunan organism S1008 nucleic acid extraction kit; nucleic acid sample cleavage treatment and PCR amplification detection were performed in the same reaction tube using the compositions shown in Table 6 according to the procedure of example 2. The detection sensitivity and specificity of the urine sample of the comparative example composition of the invention are 71.19% and 74.29%, respectively, and the detection sensitivity of the tissue sample is 80.25%, and the specific detection results are shown in the following table 6.
TABLE 6
| Numbering device | Primer/probe | Sequence (5 '-3') |
| SEQ ID NO:17 | ME-OTX1-F” | GAGTACACCAGCTGCCTCATCTATCT |
| SEQ ID NO:18 | ME-OTX1-R” | AGCTACGGAGCGCTGCATACAC |
| SEQ ID NO:19 | ME-OTX1-P” | CCTCCATCTCGCCAGGCTCAGC |
| SEQ ID NO:20 | ME-VIM-F” | TGACCGCAGCCCCGAGA |
| SEQ ID NO:21 | ME-VIM-R” | GGTGCTGAAAAAGGCGGGGT |
| SEQ ID NO:22 | ME-VIM-P” | CACCTCCTCCCACGCCCCTTTG |
| SEQ ID NO:23 | ME-NID2-F” | CTCATCTCCTGCAACGCCGC |
| SEQ ID NO:24 | ME-NID2-R” | TCCACTCCGCCCCCAGG |
| SEQ ID NO:25 | ME-NID2-P” | CGGCCCCCAAGGAGCCCCA |
The OTX1 detection sequence (region shown as SEQ ID NO: 26) is as follows ：CTCTAGCTCGGCGTCCAGCTCTTCCGCCAACCCAGCGGCTGCAGCGGCTGCGGGACTAGGTGGGAACCCGGTGGCGGCCGCGTCGTCGCTGAGTACACCAGCTGCCTCATCTATCTGGAGCCCGGCCTCCATCTCGCCAGGCTCAGCGCCCGCGTCCGTGTCGGTGCCGGAGCCATTGGCCGCGCCTAGCAACACCTCGTGTATGCAGCGCTCCGTAGCTGCAGGCGCCGCCACCGCAGCAGCCTCTTATCCCATGTCCTACGGCCAGGGCGGCAGCTACGGCCAAGGCTACCCTACGCCCTCCTCTTCCTACTTTGGCGGCGTGGACTGCAGCTCATACCTAGCGCCCA;
VIM detection sequence (region shown as SEQ ID NO: 27) is as follows ：CGCGTTCCAATCTCAGGCGCTCTTTGTTTCTTTCTCCGCGACTTCAGATCTGAGGGATTCCTTACTCTTTCCTCTTCCCGCTCCTTTGCCCGCGGGTCTCCCCGCCTGACCGCAGCCCCGAGACCGCCGCGCACCTCCTCCCACGCCCCTTTGGCGTGGTGCCACCGGACCCCTCTGGTTCAGTCCCAGGCGGACCCCCCCCTCACCGCGCGACCCCGCCTTTTTCAGCACCCCAGGGTGAGCCCAGCTCAGACTATCATCCGGAAAGCCCCCAAAAGTCCCAGCCCAGCGCTGAAGTAACGGGACCATGCCCAGTCCCAGGCCCCGGAGCAGGAAGGCTCGAGGGCGCC;
The NID2 detection sequence (region shown as SEQ ID NO: 28) is as follows:
TGCCAGCCTGTTGGGGCCACAGCGCGCAGGCCAGCAGCCGCACTCGCCGCTGCGGGGTTCCCTTTGCGCTGAGCTCATCTCCTGCAACGCCGCTGCCCCAAACCTTGCGGGCCATTTGGTCCCGGGGGTGGGGCTCCTTGGGGGCCGCGGGGCAGCCCGGATGAGAGGATGACCCGGGAGCTCCCTGGGGGCGGAGTGGAAGGGGCAGCTCCAGGCAGCCCTGGCCAGGAGCTTTTACCCCGCCAGCCCCGCTGCTCCAGCGGCCGCTGCCTTAGAAAAGTTAACGAGAA;
TABLE 7
Example 6 results of remaining Gene detection samples
Three-target combined detection systems are respectively constructed for the five targets OTX1, VIM, PENK, NID2 and ZNF154, sensitivity and specificity tests are carried out through clinical urine samples (table 8), and finally the optimal detection systems of OTX1, VIM and NID2 are screened out.
TABLE 8
/>
Claims (10)
1. A composition for detecting bladder cancer, comprising a detection reagent for detecting the methylation level of:
the OTX1 gene has a region shown as SEQ ID NO. 1;
The region of the VIM gene shown in SEQ ID NO. 2; and
The region of the NID2 gene shown in SEQ ID NO. 3.
2. The composition of claim 1, wherein the detection reagent is an amplification-sequencing, chip, or detection reagent used in methylation level detection by methylation fluorescent quantitative PCR.
3. The composition of claim 2, wherein the detection reagent is any one or more of a nucleic acid primer, a sequencing Tag sequence, a methylation chip, and a nucleic acid probe.
4. The composition of claim 3, wherein the detection reagents are nucleic acid primers and nucleic acid probes.
5. The composition of claim 4, wherein the nucleic acid primer and nucleic acid probe are:
nucleic acid primers and probes shown in SEQ ID NOS 5-13.
6. The composition of claim 5, wherein the detection reagent further comprises an internal standard upstream primer, an internal standard downstream primer, and an internal standard probe for monitoring.
7. Use of a composition according to any one of claims 1 to 6 in the manufacture of a kit for detecting bladder cancer.
8. A kit for detecting bladder cancer, comprising the composition of any one of claims 1-6.
9. The kit of claim 8, further comprising at least one of dNTPs, mg 2+, methylation sensitive restriction enzymes, PCR buffers, hot start enzymes.
10. The kit of claim 9, wherein the methylation sensitive restriction enzyme comprises at least one of HpaII and HinP 1I.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211500585.4A CN118127151A (en) | 2022-11-28 | 2022-11-28 | Composition for detecting bladder cancer, kit and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202211500585.4A CN118127151A (en) | 2022-11-28 | 2022-11-28 | Composition for detecting bladder cancer, kit and application thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN118127151A true CN118127151A (en) | 2024-06-04 |
Family
ID=91239401
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202211500585.4A Pending CN118127151A (en) | 2022-11-28 | 2022-11-28 | Composition for detecting bladder cancer, kit and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN118127151A (en) |
-
2022
- 2022-11-28 CN CN202211500585.4A patent/CN118127151A/en active Pending
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111676292B (en) | Composition for detecting liver cancer, kit and application thereof | |
| CN109825586B (en) | DNA methylation qPCR kit for lung cancer detection and use method | |
| CN113755603B (en) | Marker, primer probe and kit for early screening and diagnosis of endometrial cancer | |
| CN109112216B (en) | Triple qPCR (quantitative polymerase chain reaction) detection kit and method for DNA methylation | |
| CN109504780B (en) | DNA methylation qPCR kit for lung cancer detection and use method thereof | |
| US20220307091A1 (en) | Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
| US20120135877A1 (en) | DNA Methylation Markers For Prostate Cancer Field Defect | |
| CN111560435A (en) | DNA methylation kit for colorectal cancer detection, and use method and application thereof | |
| US20210404018A1 (en) | Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
| CN110964823A (en) | DNA methylation kit for colorectal cancer detection and detection method | |
| CN110923322A (en) | Bladder cancer-associated DNA methylation biomarker combination and detection kit | |
| CN112410425A (en) | Gene methylation digital PCR kit for early screening of liver cancer and application thereof | |
| CN115961038A (en) | Composition for detecting gastric cancer, kit and application thereof | |
| CN117165688A (en) | Marker for urothelial cancer and application thereof | |
| CN111826446A (en) | Primer, probe and kit for early screening and auxiliary diagnosis of bladder cancer | |
| CN116064786A (en) | Composition for detecting gastric cancer, kit and application thereof | |
| CN116254344A (en) | Composition for detecting bladder cancer, kit and application thereof | |
| KR20190121578A (en) | Biomarkers for diagnosis of prostate cancer and uses thereof | |
| US11542559B2 (en) | Methylation-based biomarkers in breast cancer screening, diagnosis, or prognosis | |
| CN114480655A (en) | DNA methylation marker combination and application thereof, ovarian cancer early detection primer probe and kit | |
| CN118127151A (en) | Composition for detecting bladder cancer, kit and application thereof | |
| EA010571B1 (en) | Method for diagnosis of non-small cell carcinoma of lung and a kit therefor | |
| EP2978861B1 (en) | Unbiased dna methylation markers define an extensive field defect in histologically normal prostate tissues associated with prostate cancer: new biomarkers for men with prostate cancer | |
| WO2024001602A1 (en) | Composition for detecting gastric cancer, kit, and use thereof | |
| CN116769920A (en) | Composition for detecting prostate cancer, kit and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination |