CN113943782B

CN113943782B - Method for evaluating concentration of 2-methyl isoborneol in water body

Info

Publication number: CN113943782B
Application number: CN202111291151.3A
Authority: CN
Inventors: 苏命; 曹腾心; 朱宜平; 陆金平; 杨敏
Original assignee: SHANGHAI CHENGTOU RAW WATER CO Ltd; Research Center for Eco Environmental Sciences of CAS
Current assignee: SHANGHAI CHENGTOU RAW WATER CO Ltd; Research Center for Eco Environmental Sciences of CAS
Priority date: 2021-11-02
Filing date: 2021-11-02
Publication date: 2023-10-27
Anticipated expiration: 2041-11-02
Also published as: CN113943782A

Abstract

The invention discloses a method for evaluating the concentration of 2-methyl isoborneol MIB in a water body, which comprises the steps of filtering the water body, collecting blue algae cells, extracting blue algae DNA, carrying out real-time fluorescence quantitative PCR (polymerase chain reaction) by taking the blue algae DNA as a template to obtain a Cq value of the water body, and then carrying the Cq value into a standard curve A of the copy number concentration of a mic gene and the Cq value of the real-time fluorescence quantitative PCR to calculate and obtain the concentration N of the mic gene in the water body; and then carrying the mic gene concentration in the water body into a standard curve B of the MIB concentration and the mic gene copy number concentration in the sample to obtain the MIB concentration in the water body to be evaluated. The method overcomes the technical defects that the existing method for monitoring the water body MIB concentration needs large-scale detection equipment and has long detection time, and has the advantages of high sensitivity, low detection limit, short detection time and high flux, and can realize rapid and accurate quantitative detection of the MIB.

Description

Method for evaluating concentration of 2-methyl isoborneol in water body

Technical Field

The invention relates to an evaluation method of smelling substances, in particular to a qualitative and quantitative evaluation method of the smelling substances generating soil mildew in a water source, and belongs to the technical field of biology.

Background

The safety of drinking water is directly in human health, and the smell of drinking water is the water quality index which is most easily perceived by consumers and is also an important factor for directly judging water quality by consumers. The problem of smell of drinking water widely exists in China, 80% of water samples of water sources have the problem of smell according to the general investigation result of water special for key cities in China, wherein the problem of soil mildew accounts for a large proportion, and 2-Methyl Isoborneol (MIB) is a main smell-causing substance for generating soil mildew in water sources of lakes and reservoirs, and the detection rate of the water sources in water sources is up to 75%. The problem of smell exists in a plurality of cities in China, and MIB is detected in Beijing, tianjin, shanghai, zhuhai, shenzhen, dalian and the like. MIB is difficult to achieve an ideal removal effect under conventional water treatment process conditions, and the advanced treatment process increases cost and has a limit, so that there is still a problem of smell in factory water.

In a lake and reservoir type water source, MIB is a volatile terpenoid mainly produced by the metabolism of filamentous blue algae, and the olfactory threshold is only 5-10ng/L. The method is time-consuming and labor-consuming, has low accuracy, has certain error and can not morphologically distinguish the olfactory and non-olfactory filamentous cyanobacteria. Conventional detection methods for MIB can be classified into sensory analysis, instrumental analysis, and a combination of both. Sensory analysis included smell evaluation (Flavor Rating Scale, FRS), smell threshold (Threshold Odor Number, TON) and smell profiling (Flavor Profile Analysis, FPA). The sensory analysis method has the advantage of comprehensively sensing substances in water. Common instrumental analysis methods are electronic nose measurement, gas chromatography and gas chromatography, and the most widely used method is gas chromatography. With the development of high sensitivity and high accuracy chromatographic methods, GC-MS is commonly used to identify and detect odorants.

Because the concentration of the odor substances in the environment is extremely low, a pretreatment technology is usually adopted before instrument analysis, and the accuracy and the sensitivity of qualitative and quantitative analysis are improved. The pretreatment technology mainly comprises closed-circuit gas extraction analysis (CLSA), resin Adsorption (RA), liquid-liquid extraction (LLE), solid Phase Extraction (SPE), solid Phase Microextraction (SPME), stirring rod adsorption extraction (SBSE), liquid Phase Microextraction (LPME), purge-and-trap (P & T), and distillation extraction (SDE). SPME-GC-MS is a smell substance detection method widely adopted at present, and the pretreatment method is simple and rapid, the sample injection time is short, and the detection limit is low.

From the traditional detection method of MIB, the sensory analysis method has stronger subjectivity, larger error exists when the odor evaluation is carried out, the instrument analysis method has the problems of fewer measurable odor substances and higher difficulty in structural analysis determination, and a large instrument is needed, so that the field detection and the tracing of the odor substances are difficult to achieve.

In recent years, molecular biological detection methods of MIB are rapidly developed, and researches on the variety, origin and diversity of genes related to MIB synthesis in blue algae lead to the application of PCR and real-time fluorescence quantitative PCR (qPCR) in the detection of odor problems, thereby realizing high-throughput, rapid and accurate detection.

The biological synthesis path of MIB and related gene research are started from actinomycetes, and then are researched and discovered in blue algae. The precursor of MIB is isoprene pyrophosphate (isopentenyl diphosphate, IPP), which can produce geranyl pyrophosphate (geranyl diphosphate, GPP), which produces MIB by a two-step reaction. First, geranyl pyrophosphate is subjected to GPP (methyl-GPP) production by GPP methyltransferase (GPPMT), and then the methylated GPP is subjected to cyclization by MIB synthase (MIBsynthase, MIBS) to finally produce MIB. Gene operons related to MIB synthesis in cyanobacteria include cyclic nucleotide binding protein gene (cnb), methyltransferase gene (mtf), MIB cyclase gene (mic).

According to the invention, a real-time fluorescence quantitative RCR (qPCR) detection method is established by designing a specific primer for a blue algae MIB cyclase gene (mic), and verification is performed in a plurality of water sources. The method is rapid and accurate, has high sensitivity and good specificity, and can realize evaluation of the potential and risk of generating smell substances in source water.

Disclosure of Invention

The invention aims to provide a method for evaluating the MIB content, in particular to a method for evaluating the MIB content of a water source site, aiming at the technical problems that a large-scale detection instrument is needed in the existing MIB detection process, and the detection flow is long, the sensitivity and the detection limit are poor when the instrument is adopted to detect and analyze MIB.

To achieve the object of the present invention, in one aspect, the present invention provides a method for evaluating the concentration of 2-Methylisocyanol (MIB) in a water body, comprising the steps of:

firstly, collecting a water sample of a water body to be evaluated, filtering the water sample, and collecting a sample on a filter membrane after filtering to obtain the sample to be evaluated;

then extracting DNA of the sample to be evaluated by using a DNA extraction kit to obtain DNA of the sample to be evaluated;

then, taking the DNA of the sample to be evaluated as a template, and carrying out real-time fluorescence quantitative PCR to obtain the Cq value of the water to be evaluated;

and then calculating according to a standard curve A of the mic gene copy number concentration and the Cq value of the real-time fluorescence quantitative PCR to obtain the mic gene concentration N in the water body to be evaluated, wherein the standard curve A is shown in a formula (1):

log10(N)＝k×Cq+b (1)

in formula (1): cq value: the Cq value of the real-time fluorescence quantitative PCR for the water body to be evaluated; n: the concentration of the copy number of the mic gene in the water body to be evaluated; log10 (N): the logarithmic value of the mic gene copy number concentration in the water body to be evaluated; k is the slope of the standard curve a, k= -0.290; b is the intercept of the standard curve, b=11.92;

and then calculating according to a standard curve B of the MIB concentration and the mic gene copy number concentration to obtain the MIB concentration in the water body to be evaluated, wherein the standard curve B is shown in a formula (2):

log10(Y)＝k1×log10(N)-b1 (2)

In the formula (2): n: mic gene copy number concentration, copies L in water to be evaluated ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Y: MIB concentration, ng L of water body to be evaluated ^-1 The method comprises the steps of carrying out a first treatment on the surface of the k1: slope of standard curve B, k1 is 0.357; b1: the intercept of standard curve B, B1, is 0.349.

Wherein the filter membrane used in the filtration is a 1.2 μm filter membrane; RTTP04700,1.2 μm polycarbonate film.

In the real-time fluorescence quantitative PCR process, the primer is MIBQSF/MIBQSR, wherein MIBQSF: SEQ ID NO.2: MIBQSR: SEQ ID NO.3.

In particular, the primer MIBQSF:5'-GACAGCTTCTACACCTCCATGA-3'; the primer is MIBQSR:5'-CAATCTGTAGCACCATGTTGAC-3'.

In particular, the primers were designed using Primer Premier v6.24 software.

In particular, the reaction system of the real-time fluorescence quantitative PCR is as follows: TB Green ^TM Premix Ex Taq ^TM 12.5. Mu.L of each specific upstream and downstream primer (MIBQSF/MIBQSR) 0.8. Mu.L of each template DNA 2.0. Mu.L, ddH ₂ O8.9 μl; the real-time fluorescent quantitative PCR amplification procedure was: the activation stage is 94 ℃ for 10min; high temperature denaturation at 95 ℃ for 20s; annealing at a low temperature of 50 ℃ for 20s; the extension stage is 72 ℃ for 20s; the reaction is carried out for 50 cycles; the annealing stage was 95℃for 10s,65℃for 60s,97℃for 1s.

Wherein, the standard curve A is drawn according to the following method:

a1 Introducing a blue-green algae mic gene sequence fragment into a vector through a gene cloning technology, constructing a standard mic plasmid, and determining the nucleic acid mass concentration of the constructed standard mic plasmid;

a2 A specific primer pair MIBQSF/MIBQSR, wherein MIBQSF: SEQ ID NO.2; MIBQSR: SEQ ID NO.3:

a3 Carrying out ten-fold gradient dilution on the standard mic plasmid constructed in the step A1) to prepare a standard mic plasmid diluent; calculating the mic gene copy number concentration N of the standard mic plasmid diluent according to the formula (3);

N＝(NA×c)/(L×M) (3)

in formula (3): n: mic gene copy number concentration, copies. Mu.L of standard mic plasmid dilutions ^-1 The method comprises the steps of carrying out a first treatment on the surface of the NA: avogalileo constant, 6.02X10 ²³ mol ^-1 The method comprises the steps of carrying out a first treatment on the surface of the c: nucleic acid mass concentration, g.mu.L, of standard mic plasmid dilution ^-1 The method comprises the steps of carrying out a first treatment on the surface of the L: the base length of the constructed standard mic plasmid is bp (the base length is the target gene length plus the vector gene length), and L=2936 bp; m: average molar mass per unit base of 660 g.mol ^-1 ·bp ^-1 ；

A4 Taking the mic plasmid in the standard mic plasmid diluent prepared in the step A3) as a template DNA, and taking the specific primer designed in the step A2) as a primer to perform real-time fluorescence quantitative PCR to obtain a Cq value corresponding to the standard mic plasmid diluent; and then, taking the logarithmic value of the mic gene copy number concentration N of the standard mic plasmid diluent obtained by the calculation in the step A3) as an ordinate, taking the Cq value measured by the real-time fluorescence quantitative PCR as an abscissa, and drawing a standard curve A of the mic gene copy number concentration of the standard mic plasmid and the Cq value of the real-time fluorescence quantitative PCR.

Wherein, the blue algae mic gene sequence fragment SEQ ID NO.1 in the step A1); the vector is pUC57 vector.

In particular, the micgene sequence fragment 226bp of the blue algae; the pUC57 vector 2710bp; the base length L of the constructed standard mic plasmid is 2936bp.

Wherein the nucleic acid mass concentration of the standard mic plasmid is measured by a micro nucleic acid meter (such as NanoDrop 1000).

In particular, in step A3) the nucleic acid mass concentration c of the standard mic plasmid dilution is determined using a micro-nucleic acid meter (e.g.NanoDrop 1000).

Wherein, the standard curve B is drawn according to the following method:

b1 Collecting at least 30 different environmental water samples, filtering and collecting samples on the filter membrane to obtain environmental samples;

b2 Respectively extracting the DNA of the environmental sample by using a DNA extraction kit to obtain the DNA of the environmental sample;

b3 Respectively taking the DNA of the environmental sample as a template, and carrying out real-time fluorescent quantitative PCR to obtain the Cq value of the environmental water sample;

b4 Respectively bringing Cq values of the environmental water sample into the standard curve A, and calculating to obtain the copy number concentration N of the mic genes in the environmental water sample;

b5 Performing GC-MS measurement on the environmental water sample in the step B1) respectively to obtain MIB concentration Y of the environmental water sample;

b6 Taking the logarithmic value of the mic gene copy number concentration N of the environmental water sample obtained by calculation through the standard curve A in the step B4) as an abscissa, taking the logarithmic value of the MIB concentration Y of the environmental water sample measured in the step B5) as an ordinate, and drawing a standard curve B for obtaining the MIB concentration and the mic gene copy number concentration in the environmental water sample.

In particular, the line GC-MS measurement conditions in step B5) are as follows:

the column was selected from HP-5ms (30 m. Times.0.25 mm. Times.0.25 μm); the sample injection flow is set to be 1.0 mL.min ^-1 The method comprises the steps of carrying out a first treatment on the surface of the The electron energy is 70eV; the electron multiplication voltage is 824V; the column head pressure is 50kPa; the temperature of the transmission line is 280 ℃; the ion source temperature is 230 ℃; the sample inlet temperature was 240℃at the time of quantification.

Heating program: t0=50 ℃, hold for 2min, at 8 ℃ min ^-1 The temperature is raised to 160 ℃ and then 20 ℃ for min ^-1 The temperature is raised to 280 ℃ and the temperature is kept at 280 ℃ for 5min.

Quantitative analysis, full SCAN (SCAN) scanning quality range is 35 u-350 u. The sample inlet temperature is 260 ℃ during full scanning. The sample injection mode is non-split sample injection;

heating program: t0=40 ℃, hold for 3min at 4 ℃ min ^-1 Heating to 200deg.C, keeping the temperature at 200deg.C for 2min, and heating to 15deg.C for 15 min ^-1 The temperature is raised to 260 ℃ at a constant temperature of 260 ℃ for 2min.

In particular, k= -0.290 in the standard curve a; b=11.92.

In particular, k1 in the standard curve B is 0.357; b1 is 0.349.

In another aspect, the invention provides a method for evaluating the concentration of 2-methyl isoborneol in a water body, comprising the following steps:

1. construction of a Standard mic plasmid

Introducing blue-green algae mic gene sequence fragments into a vector through a gene cloning technology, constructing a standard mic plasmid, and determining the nucleic acid mass concentration of the standard mic plasmid;

2) Design of specific primers

Specific primers are designed according to the mic genes, wherein the specific primer pairs are MIBQSF/MIBQSR, and MIBQSF: SEQ ID NO.2; MIBQSR: SEQ ID NO.3;

3) Preparing standard mic plasmid diluent

Carrying out ten-fold gradient dilution on the standard mic plasmid constructed in the step 1) to prepare a standard mic plasmid diluent; calculating the mic gene copy number concentration of the standard mic plasmid diluent according to the formula (3);

N＝(NA×c)/(L×M) (3)

in formula (3): n: standard mic plasmidThe copy number concentration of the mic gene of the released liquid, copies. Mu.L ^-1 The method comprises the steps of carrying out a first treatment on the surface of the NA: avogalileo constant, 6.02X10 ²³ mol ^-1 The method comprises the steps of carrying out a first treatment on the surface of the c: nucleic acid mass concentration, g.mu.L, of standard mic plasmid dilution ^-1 The method comprises the steps of carrying out a first treatment on the surface of the L: the base length of the constructed standard mic plasmid is bp (the base length is the length of a target gene plus the length of a vector), and L=2936; m: average molar mass per unit base of 660 g.mol ^-1 ·bp ^-1 ；

4) Drawing a standard curve A

Performing real-time fluorescent quantitative PCR by taking the mic plasmid in the standard mic plasmid diluent as a template DNA and the specific primer designed in the step 2) as a primer to obtain a Cq value corresponding to the standard mic plasmid diluent; and then, taking the logarithmic value of the mic gene copy number concentration N of the standard mic plasmid diluent obtained by the calculation in the step 3) as an ordinate, taking the Cq value measured by the real-time fluorescence quantitative PCR as an abscissa, and drawing a standard curve A of the mic gene copy number concentration of the standard mic plasmid and the Cq value of the real-time fluorescence quantitative PCR, wherein the standard curve A is shown in a formula (1):

log10(N)＝k×Cq+b (1)

In the formula (1): cq value: the Cq value of the real-time fluorescence quantitative PCR for the standard mic plasmid diluent subjected to gradient dilution; n: the concentration of the copy number of the mic gene in the standard mic plasmid diluent is shown; log10 (N): logarithmic value of mic gene copy number concentration in standard mic plasmid diluent; k is the slope of the standard curve a, k= -0.290; b is the intercept of the standard curve, b=11.92;

5) Determination of the copy number concentration of the mic Gene in environmental samples

Collecting at least 30 different environmental water samples, filtering the environmental water samples respectively, and collecting the environmental samples on the filtered filter membrane respectively; then, respectively extracting the DNA of the environmental sample by using a DNA extraction kit to obtain the DNA of the environmental sample; then, carrying out real-time fluorescence quantitative PCR by taking the specific primer designed in the step 2) as a primer and taking the extracted environmental sample DNA as a template to obtain a corresponding environmental water sample Cq value; then, the measured Cq value of the environmental water sample is brought into a standard curve A, and the copy number concentration N of the mic gene in the environmental water sample is calculated and obtained;

6) Determination of MIB concentration in environmental Water sample

Taking the environmental water sample in the step 5), carrying out GC-MS measurement, and measuring the MIB concentration Y in the environmental water sample;

7) Drawing a standard curve B

Establishing a standard curve B of the MIB concentration and the mic gene copy number concentration in the environmental water sample by taking the logarithmic value of the mic gene copy number concentration N of the environmental water sample obtained by calculating the standard curve A in the step 5) as an abscissa and taking the logarithmic value of the MIB concentration Y of the environmental water sample measured in the step 6) as an ordinate, wherein the standard curve B is shown in a formula (2):

logl0(Y)＝k1×log10(N)-b1 (2)

In formula (2): n: copy number concentration of mic gene and copies L in environmental water sample ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Y: MIB concentration, ng L of environmental water sample ^-1 The method comprises the steps of carrying out a first treatment on the surface of the k1: slope of standard curve B, k1 is 0.357; b1 is the intercept of standard curve B, B1 is 0.349;

8) Collecting and filtering a water sample of a water body to be evaluated, and collecting the filtered sample to be evaluated on the filter membrane; then extracting DNA of the sample to be evaluated by using a DNA extraction kit to obtain DNA of the sample to be evaluated; then, carrying out real-time fluorescence quantitative PCR by taking the specific primer designed in the step 2) as a primer and taking the extracted DNA of the sample to be evaluated as a template to obtain a Cq value of the water body to be evaluated; then, the Cq value is brought into a standard curve A, and the mic gene concentration N in the water body to be evaluated is calculated; and then carrying the calculated mic gene concentration N in the water body to be evaluated into a standard curve B, and calculating to obtain the MIB concentration in the water body to be evaluated.

Wherein, the blue algae mic gene sequence in the step 1) is a mic gene sequence of blue algae searched in NCBI database.

In particular, the standard mic plasmid constructed is a circular DNA molecule.

In particular, according to the retrieved mic gene sequence, selecting part of the gene fragments for gene cloning, wherein the selected mic gene fragment sequence is as follows: SEQ ID NO.1.

SEQ ID NO.1：gctgcgcgacagcacgacagcttctacacctccatgacgctaatcgaccccatcggagggtacgtcctccc agcagatcttttcttcgaaccgcgcgtccgtcacgcagcgttcttggccgggacggccgtcgttctggtcaacgatctcctttcggtcgcc aaagatctggcagacgagcagccaccggtcaacatggtgctacagattgcggcggatcggggct

Wherein, the vector in step 1) selects pUC57 vector.

In particular, it also includes measuring the nucleic acid quality of the constructed standard mic plasmid.

In particular, it also includes the use of a micro nucleic acid meter (e.g., nanoDrop 1000) to determine the concentration of nucleic acid mass of the standard constructed mic plasmid.

In the step 2), primer Premier v6.24 software is adopted for specific Primer design.

In particular, the upstream primer, MIBQSF (SEQ ID NO. 2): 5'-GACAGCTTCTACACCTCCATG A-3'; downstream primer, MIBQSR (SEQ ID NO. 3): 5'-CAATCTGTAGCACCATGTTGAC-3'.

The method also comprises the step of carrying out PCR amplification verification on the specific primer designed in the step 2), and comprises the following specific steps:

2A) Selecting at least 10 blue algae culture solutions, respectively filtering, respectively collecting blue algae cells, and respectively extracting blue algae cell DNA by using a DNA extraction kit;

2B) Performing PCR amplification by taking designed specific primer pair MIBQSF/MIBQSR as a primer and taking extracted cyanobacteria cell DNA as a template, and performing 1% agarose gel electrophoresis on an amplification product;

2C) Judging the amplification conditions of different blue algae DNA according to gel electrophoresis, wherein the occurrence of a band at a 200bp position is the amplification;

2D) Taking the blue algae culture solution in the step 2A), carrying out GC-MS measurement, and measuring the content of MIB in the culture solution;

2E) Blue algae capable of amplifying 200bp bands are consistent with blue algae which produce MIB measured in the step 2D), which shows that the designed specific primer can specifically amplify blue algae which produce MIB.

In particular, the filtration membrane used in step 2A) is a 1.2 μm, RTTP04700,1.2 μm polycarbonate membrane.

Wherein, the PCR amplification conditions in step 2B) are as follows:

the PCR reaction system is as follows: 2X PCR Taq MasterMix with dye 12.5.5. Mu.L, 12.5. Mu.L, and upstream and downstream primers (i.e., specific for the designSex primer) 0.8. Mu.L each, 2.0. Mu.L template DNA, ddH ₂ O 8.9μL；

The PCR amplification procedure was: the activation stage is 94 ℃ for 5min; high temperature denaturation at 94℃for 30s; low-temperature annealing at 56 ℃ for 30s; the extension stage is 72 ℃ for 30s; the reaction was completed for 30 cycles.

Wherein, 1. Mu.L of the standard plasmid constructed in the step 1) is taken in the step 3), and ddH is used ₂ O standard mic plasmid dilutions were obtained according to a ten-fold gradient dilution method with at least 8 concentration gradients.

In particular, the ten-fold gradient dilution method is to add 9. Mu.L ddH to 1. Mu.L standard plasmid ₂ O was used as the first concentration gradient, and 9. Mu.L of ddH was added to 1. Mu.L of the solution from the first concentration gradient ₂ 0 as a second concentration gradient, eight concentration gradients were established in sequence, each concentration gradient being repeated 3 times technically.

ddH ₂ O refers to: sterilizing ultrapure water at 121deg.C by high temperature high pressure sterilizing pot.

Wherein, k= -0.290 in the standard curve a in step 4); b=11.92.

In particular, the reaction system of the real-time fluorescent quantitative PCR in the steps 4), 5) and 8) is as follows: TB Green ^TM Premix Ex Taq ^TM 12.5. Mu.L of each specific upstream and downstream primer (MIBQSF/MIBQSR) 0.8. Mu.L of each template DNA 2.0. Mu.L, ddH ₂ O 8.9μL。

In particular, the real-time fluorescent quantitative PCR amplification procedure is: the activation stage is 94 ℃ for 10min; high temperature denaturation at 95℃for 20s; annealing at a low temperature of 50 ℃ for 20s; the extension stage is 72 ℃ for 20s; the reaction is carried out for 50 cycles; the annealing stage was 95℃for 10s,65℃for 60s,97℃for 1s.

Wherein the number of environmental samples in step 5) is preferably 50.

In particular, the filter is a 1.2 μm filter (RTTP 04700,1.2 μm polycarbonate membrane).

In particular, the concentration and quality of the extracted environmental sample DNA was measured by a NanoDrop1000 micro nucleic acid meter. The absorbance D260/D280 value of the DNA of the extracted environmental sample is between 1.8 and 2.2, which is regarded as the extraction qualification, and if the extraction quality is not qualified, the extraction needs to be re-extracted.

Wherein, the GC-MS measurement conditions in the step 6) are as follows:

In particular, 10mL of sample is taken from an environmental water sample, the sample is respectively placed in 15mL extraction bottles, 4.0g of high-grade pure NaCl which is dried for 4 hours at 450 ℃ is added into each extraction bottle, and after the sample is uniformly dissolved, the gas chromatography-mass spectrometry (GC-MS) measurement is carried out.

The method of the invention has the following advantages and benefits:

1. the specific primers (MIBQSF: 5'-GACAGCTTCTACACCTCCATGA-3' and MIBQSR: 5'-CAATCTGTAGCACCATGTTGAC-3') designed by the invention can specifically amplify 45 known strains of olfactory blue algae, and have the highest coverage in all the mic gene primers published at present.

2. The specificity primer has high specificity, can specifically amplify the MIB-producing blue algae only and cannot amplify the non-MIB-producing blue algae.

3. The method is applied to 50 environmental samples of 9 reservoirs/lakes in China, and a linear equation of the MIB concentration and the mic gene abundance of the environmental samples is established. The molecular biological detection method of the mic gene has better consistency with a MIB instrument analysis method (GC-MS), and can be used for evaluating and early warning the MIB concentration in the water body.

4. Compared with the traditional detection method of MIB, the real-time fluorescence quantitative PCR method based on the mic gene can realize high-flux detection, is quick and sensitive, and can be used for in-situ smell detection and early warning.

The invention designs a specific primer based on a mic gene based on 43 strain MIB olfactory algae production, and optimizes the amplification conditions of qPCR. And the verification of the method is carried out in 17 pure algae and 50 reservoir samples, and the method can be used for evaluating and early warning the MIB concentration in the water body.

Drawings

FIG. 1A is a sequence of amplification bands of the mic genes of cyanobacteria numbered 2-6 in example 3;

FIG. 1B is a sequence of amplification bands of the mic genes of cyanobacteria numbered 7-9 in example 3;

FIG. 1c is the mic gene amplification band of cyanobacteria numbered 10-16 in example 3;

FIG. 1D is the mic gene amplification band of cyanobacteria numbered 17-18 in example 3;

FIG. 2 is a standard curve A of the gene copy number concentration of the mic gene and the Cq value of real-time fluorescent quantitative PCR;

fig. 3 is a linear equation standard curve B of MIB concentration and its mic gene copy concentration in a water sample.

Detailed Description

The invention will be further described with reference to specific embodiments, and advantages and features of the invention will become apparent from the description. These examples are merely exemplary and do not limit the scope of the invention in any way. It will be understood by those skilled in the art that various changes and substitutions of details and forms of the technical solution of the present invention may be made without departing from the spirit and scope of the present invention, but these changes and substitutions fall within the scope of the present invention.

EXAMPLE 1 construction of Standard plasmid

Searching a blue algae mic gene sequence in NCBI database, selecting a anabaena micellar gene sequence fragment (SEQ ID NO. 1), introducing the micellar gene fragment into a pUC57 vector through a gene cloning technology, and constructing and obtaining a standard micplasmid (SEQ ID NO. 4), wherein the anabaena micellar gene sequence fragment (SEQ ID NO. 1) is as follows:

gctgcgcgacagcacgacagcttctacacctccatgacgctaatcgaccccatcggagggtacgtcctcccagcagatcttttct tcgaaccgcgcgtccgtcacgcagcgttcttggccgggacggccgtcgttctggtcaacgatctcctttcggtcgccaaagatctggca gacgagcagccaccggtcaacatggtgctacagattgcggcggatcggggct。

the original standard mic plasmid constructed by the invention is synthesized by Shanghai Biotechnology Inc., and the mass concentration of plasmid nucleic acid is measured by a trace nucleic acid measuring instrument (such as NanoDrop 1000); the base length is 2936bp (226 bases of the mic gene sequence fragment and 2710 bases of the PUC57 vector).

In the invention, the mic gene sequence of the standard mic plasmid is exemplified by the mic gene sequence of the anabaena, and the mic gene sequences of other blue algae are applicable to the invention.

EXAMPLE 2 extraction of blue algae DNA

Filtering 17 blue algae culture solutions (shown in Table 1) purchased from a fresh water algae seed pool of China academy of sciences respectively by using a filter membrane (1.2 mu m, RTTP04700,1.2 mu m polycarbonate membrane, isopore (TM), U.S.), and enriching blue algae cells on the filter membrane to obtain 17 blue algae cells respectively;

using DNA extraction kit (FastDNA)Kit for oil Kit (6560-200, MPBio, U.S.) respectively extracts DNA of 17 blue algae standard samples enriched on the filter membrane, and then respectively detects the concentration and quality of the extracted 17 blue algae standard sample DNA by a Nanodrop 1000 micro nucleic acid analyzer, wherein: the concentration of DNA is the value of ng/. Mu.L shown by NanoDrop 1000, and ddH is usually used in real-time fluorescent quantitative PCR ₂ Diluting O to 20 ng/. Mu.L; the quality of blue algae DNA extraction is tested by a Nanodrop 1000 micro nucleic acid tester, and the absorbance D260/D280 value is 1.8-2.2, which is regarded as the extraction qualification. The DNA with qualified quality is used as template DNA for standby.

EXAMPLE 2A MIB-producing cyanobacteria assay

The MIB detection method comprises the following steps: respectively accurately measuring 10mL of blue algae culture solution of 17 blue algae strains, respectively placing the blue algae culture solutions in respective corresponding 15mL extraction bottles, respectively adding 450 ℃ and 4 hours of high-grade pure NaCl (4.0 g) into each extraction bottle, and carrying out gas chromatography-mass spectrometry (GC-MS) measurement after the blue algae culture solutions are uniformly dissolved; measuring the MIB content in the blue algae sample; wherein, the GC-MS measurement conditions are as follows:

Heating program: T0=50deg.C, holding for 2min, increasing to 160deg.C at 8 deg.C min-1 rate, and then at 20 deg.C min ^-1 The temperature is raised to 280 ℃ and the temperature is kept at 280 ℃ for 5min.

Quantitative analysis, full SCAN (SCAN) scanning quality range is 35 u-350 u. The sample inlet temperature is 260 ℃ during full scanning.

The sample injection mode is non-split sample injection;

The measurement results are shown in Table 1, wherein 12 blue algae strains produce MIB blue algae; 5 blue algae do not produce MIB.

Example 3 design of specific primers

1. Primer design

According to the mic gene sequence of MIB blue algae generated in NCBI database, adopting Primer Premier v6.24 software to design specific primers for the mic gene; the specific primers designed were as follows:

an upstream primer, MIBQSF (SEQ ID NO. 2): 5'-GACAGCTTCTACACCTCCATGA-3';

Downstream primer, MIBQSR (SEQ ID NO. 3): 5'-CAATCTGTAGCACCATGTTGAC-3';

2. PCR amplification verification

The DNA of 17 cyanobacteria strains extracted in example 2 was used as a template, and the primers (MIBQSF; MIBQSR) is used for respectively carrying out PCR amplification on specific primers, and carrying out 1% agarose gel electrophoresis on common PCR amplification products to verify the specificity of the designed specific primers, wherein:

the common PCR reaction system is as follows: 2X PCR Taq MasterMixwith dye 12.5.5. Mu.L, 12.5. Mu.L, 0.8. Mu.L each of the upstream and downstream primers, 2.0. Mu.L of template DNA, ddH ₂ O 8.9μL。

The template DNA was 17 cyanobacteria DNA extracted in example 2, and the template DNA of negative control was ddH ₂ O；

The common PCR amplification procedure was: the activation stage is 94 ℃ for 5min; high temperature denaturation at 94℃for 30s; low-temperature annealing at 56 ℃ for 30s; the extension stage is 72 ℃ for 30s; the reaction was completed for 30 cycles.

The gel electrophoresis results of the conventional PCR amplification are shown in Table 1 and FIGS. 1A-D.

TABLE 1 production of blue algae MIB and existence of mic Gene

The gel electrophoresis result of the PCR amplification product of the DNA extracted from 17 blue algae is shown as figures 1A-1D, and the sequence length of the DNA marker in figures 1A-1D is 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom in sequence; 1 is a negative control; the numbers 2 to 18 are consistent with the blue algae indicated by the numbers in Table 1.

As can be seen from the detection results of fig. 1A to 1D: the amplification of blue algae DNA is carried out after the occurrence of a band at a position of 200 bp.

The gel electrophoresis diagram can obtain that the algae strains No. 2, 3, 4, 5, 6, 8, 9, 11, 12, 13, 17 and 18 can amplify the bands, which shows that the primer designed by the invention can specifically amplify the mic genes, and the blue algae can generate MIB as a result by measuring the MIB concentration by the GC-MS method.

The strain numbers 7, 10, 14, 15 and 16 cannot amplify bands, and the blue algae cannot generate MIB when the concentration of MIB is measured by a GC-MS method. Therefore, the primers designed by the invention can specifically amplify the blue algae producing MIB.

Example 4 calibration curve of the copy number of mic Gene

1. Real-time fluorescent quantitative PCR amplification

Ten-fold gradient dilutions were performed on the standard mic plasmid constructed in example 1 for construction of a standard curve.

1-1) 1. Mu.L of the original standard mic plasmid constructed in example 1 was taken and 9. Mu.L of ddH was added ₂ O was used as the first concentration gradient, 1. Mu.L was further extracted from the first concentration gradient, and 9. Mu.L of ddH was further added ₂ O was used as the second concentration gradient, 1. Mu.L was then removed from the second concentration gradient, and 9. Mu.L of ddH was then added ₂ O was used as the third concentration gradient, 10 concentration gradients were established sequentially according to this dilution method (as in Table 2) to obtain a standard mic plasmid solution of gradient dilution, each concentration gradient was repeated 3 times, wherein the first 8 dilution concentration gradients (10 ¹ ～10 ⁸ Fold) was used to construct a standard curve, the last 2 concentration gradients were set for the proof detection limit.

TABLE 2 verification of Gene copy number and detection Limit for Standard Curve

1-2) respectively taking ten-fold gradient diluted standard mic plasmid in the step 1-1) as template DNA, simultaneously carrying out real-time fluorescence quantitative PCR, and simultaneously setting negative control (the DNA template is ddH) ₂ O), the corresponding cq value is obtained.

The real-time fluorescent quantitative PCR reaction system is as follows: TB Green ^TM Premix E× Taq ^TM 12.5. Mu.L of each specific upstream and downstream primer (MIBQSF/MIBQSR) 0.8. Mu.L of each template DNA 2.0. Mu.L, ddH ₂ O 8.9μL。

Wherein: drawing a template DNA of a mic gene copy number standard curve, wherein the template DNA is DNA obtained by ten-time gradient dilution of a standard mic plasmid constructed in the embodiment 1; template DNA of negative control sample was expressed as ddH ₂ O is replaced;

the real-time fluorescent quantitative PCR amplification procedure was: the activation stage is 94 ℃ for 10min; high temperature denaturation at 95℃for 20s; annealing at a low temperature of 50 ℃ for 20s; the extension stage is 72 ℃ for 20s; the reaction is carried out for 50 cycles; the annealing stage was 95℃for 10s,65℃for 60s,97℃for 1s.

2. Calculation of Standard mic plasmid copy number concentration

Respectively calculating the copy number concentration of 10 standard mic plasmids subjected to gradient dilution in the step 1) according to a formula (1),

N＝(NA×c)/(L×M) (1)

in formula (1): n: mic gene copy number concentration, copies. Mu.L of standard mic plasmid dilutions ^-1 The method comprises the steps of carrying out a first treatment on the surface of the NA: avogalileo constant, 6.02X10 ²³ mol ^-1 The method comprises the steps of carrying out a first treatment on the surface of the c: nucleic acid mass concentration, g.mu.L, of standard mic plasmid dilution ^-1 The method comprises the steps of carrying out a first treatment on the surface of the L: the base length of the constructed standard mic plasmid is bp (the base length is the length of a target gene plus the length of a vector), and L=2936; m: average molar mass per unit base of 660 g.mol ^-1 ·bp ^-1 ；

The calculation results of the copy number concentration of 10 standard mic plasmids in gradient dilution are shown in Table 2.

3. Constructing a mic gene copy number standard curve A:

the first eight plasmids in the gradient dilution in the table 2 are respectively subjected to real-time fluorescence quantitative PCR to obtain corresponding Cq values;

establishing a standard curve by using the cq value of the plasmids subjected to gradient dilution in the first 8 steps in the table 2 and the logarithmic value of the corresponding standard mic plasmid copy number concentration (N) calculated in the step (2), drawing a standard curve A of the gene copy number concentration of the standard mic gene and the cq value of the real-time fluorescence quantitative PCR (quantitative PCR) by using the logarithmic value of the standard mic plasmid copy number concentration (N) as an ordinate and the cq value measured by the real-time fluorescence quantitative PCR as an abscissa, wherein the standard curve A is shown in a formula (2), and the curve is shown in fig. 2:

log10(N)＝k×Cq+b (2)

In formula (2): cq value: the Cq value of the real-time fluorescence quantitative PCR for the standard mic plasmid diluent subjected to gradient dilution; n: the concentration of the copy number of the mic gene in the standard mic plasmid diluent is shown; log10 (N): logarithmic value of mic gene copy number concentration in standard mic plasmid diluent; k is the slope of the standard curve a, k= -0.290; b is the intercept of the standard curve, b=11.92;

r of standard curve A ² ＝0.999，p＜0.0001。

4. Determination of PCR amplification efficiency (E)

Calculated according to formula (4): PCR amplification efficiency (E):

in formula (3): e: PCR amplification efficiency; k: slope of standard mic gene copy number standard curve a, k=0.290;

the PCR amplification efficiency of the method is 95%; the detection limit is 1.86×10 ⁴ copies·μL ^-1 (Table 2) meets the requirement of mic gene detection. Therefore, the copy number of the mic gene in the sample can be determined by the cq value of the sample to be detected and a standard curve.

Example 5 determination of the concentration of the mic Gene in environmental samples

50 environmental samples (i.e., reservoir water samples, 1000mL each) of 9 reservoirs/lakes (micellar reservoir, ocean river reservoir, bridge reservoir, grass sand reservoir, gold reservoir, eastern lake, thousand island lake, phoenix mountain reservoir, southern plain reservoir) were collected by the water sampler for determining the mic gene concentration. Wherein: the geographical location of the reservoir/lake and the number of samples are shown in Table 3.

1. Enrichment of cyanobacteria cells

Taking 500mL of each environmental sample (reservoir water sample), filtering by adopting a 1.2 μm filter membrane (RTTP 04700,1.2 μm polycarbonate membrane, isopore (TM), U.S.), and filtering and enriching blue algae cells in each environmental sample onto the 1.2 μm filter membrane;

in the present invention, the filtration and enrichment of cyanobacteria cells are described by taking RTTP04700,1.2 μm polycarbonate membrane as an example, and other 1.2 μm filter membranes are suitable for the present invention, such as PVDF (polyvinylidene fluoride) filter membrane.

2. Extraction of blue algae DNA

Using DNA extraction kit (FastDNA)The Kit for oil Kit (6560-200, MPBio, U.S.) performs DNA extraction on each enriched blue algae environmental sample respectively to obtain environmental sample DNA, and detects the concentration and quality of the extracted environmental sample DNA by a Nanodrop 1000 micro nucleic acid analyzer.

The absorbance D260/D280 value of the DNA of the extracted environmental sample is between 1.8 and 2.2, which is regarded as the extraction qualification, and if the extraction quality is not qualified, the extraction needs to be re-extracted.

3. Real-time fluorescent quantitative PCR

And carrying out real-time fluorescent quantitative PCR detection on the extracted environmental sample DNA to obtain a corresponding Cp value. Respectively taking blue algae DNA in the extracted environmental sample as a template, carrying out real-time fluorescence quantitative PCR, and setting a negative control (the DNA template is ddH) ₂ O), wherein:

the real-time fluorescent quantitative PCR reaction system is as follows: TB Green ^TM Premix E×Taq ^TM 12.5. Mu.L of each specific upstream and downstream primer (MIBQSF/MIBQSR) 0.8. Mu.L of each template DNA 2.0. Mu.L, ddH ₂ O 8.9μL。

4. Calculating the copy number of the mic gene in an environmental sample

And (3) bringing the Cq value measured by the real-time fluorescence quantitative PCR in the step (3) into a mic gene copy number standard curve A, and calculating to obtain the copy number concentration (N) of the mic gene in the environmental sample, wherein the calculation result is shown in Table 3.

The concentration of the mic gene in the 50 environmental samples was measured in a range of 1.25X10 ³ Up to 5.24X10 ⁸ copies L ^-1 . The copy number concentration of the mic gene in the environmental sample was determined as shown in Table 3.

TABLE 3 determination of sources, amounts, mic concentrations, MIB content of environmental samples

EXAMPLE 6 MIB content determination of environmental samples

Respectively accurately measuring 10mL of 50 environmental samples in the example 5, respectively placing the environmental samples in corresponding 15mL extraction bottles, adding 450 ℃ and 4 hours of high-grade pure NaCl (4.0 g) into each extraction bottle, and carrying out gas chromatography-mass spectrometry (GC-MS) measurement after the environmental samples are uniformly dissolved; determining the MIB content in the environmental sample; wherein the GC-MS measurement conditions are the same as those in example 2A; the measurement results are shown in Table 3.

EXAMPLE 7 establishment of linear equation of MIB concentration and mic Gene copy number of environmental sample

Taking the logarithmic value of the copy number of the mic genes of 50 environmental samples calculated by the standard curve a in example 5 as the abscissa and the logarithmic value of the MIB concentration of the corresponding 50 environmental samples measured in example 6 as the ordinate, a linear equation B (standard curve B) of the MIB concentration in the sample and the copy number concentration of the mic genes in the sample is established, the linear equation B being shown in formula (4), and the curve being shown in fig. 3.

As shown in fig. 3, a linear equation of MIB concentration and mic gene copy number concentration in an environmental sample is established with the logarithmic value of mic gene copy number concentration (N) in the environmental sample as an abscissa and the logarithmic value of MIB concentration (Y) in the environmental sample as an ordinate:

log10(Y)＝k1×log10(N)-b1 (3)

in formula (3): n: copy number of mic Gene of sample, copies L ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Y: MIB concentration of sample, ngL ^-1 The method comprises the steps of carrying out a first treatment on the surface of the k1: slope of standard curve B, k1 is 0.357; b1 is the intercept of standard curve B, B1 is 0.349; standard curveR of B ² ＝0.614，p＜0.001。

From the above analysis, it can be seen that: the molecular biological detection method of the mic gene has better consistency with a MIB instrument analysis method (GC-MS), and a linear equation of MIB concentration and mic gene concentration is established, so that the method can be used for evaluating the MIB concentration in the water body and early warning the MIB in the water body. The method for carrying out real-time fluorescence quantitative PCR on the environmental sample can be used for evaluating the MIB concentration of the environmental water sample.

Test example 1

Collecting a blue-green grass sand reservoir water sample, taking 1000mL of the water sample, filtering by adopting a 1.2 mu m filter membrane (RTTP 04700,1.2 mu m polycarbonate membrane, isopore (TM), U.S.), and filtering and enriching blue-green algae cells in the reservoir water sample onto the 1.2 mu m filter membrane; using DNA extraction kit (FastDNA)Kit for oil Kit (6560-200, MPBio, U.S.) to extract water sample DNA of the green grass sand reservoir; performing real-time fluorescent quantitative PCR detection on the extracted reservoir water sample DNA to obtain a reservoir water sample Cq value; according to standard curve A, the concentration (N) of the mic gene in the reservoir water sample is calculated to be 5.22 multiplied by 10 ⁵ copies L ^-1 The method comprises the steps of carrying out a first treatment on the surface of the And then calculating according to a linear equation B (namely a formula (4) and a standard curve B) to obtain the MIB concentration of 49.22ng/L in the reservoir water sample.

10mL of the water sample of the green grass sand reservoir is additionally taken, and GC-MS measurement is carried out according to the method of the example 6, so that the MIB concentration in the water sample of the green grass sand reservoir is 52.18ng/L.

The relative error between the MIB concentration measured by the method and the MIB concentration measured by the instrument method is 5.67%, which shows that the method can be used for measuring and evaluating the MIB concentration in the water body, and compared with the instrument analysis method, the method has the advantages of high sensitivity, short detection time, high flux and high sensitivity.

Primer amplification coverage verification for control

The specific primers designed by the method of the invention can amplify the existing 43 strain blue algae in NCBI database (45 strains of blue algae are shared in table 4, and 43 strains of blue algae can be amplified by the primers designed by the invention) (table 4), and compared with the primers published at present, the highest coverage is achieved, wherein the sequences of the primers A-G in the table 4 are obtained from published documents (see table 5), and the primers are synthesized by Shanghai Biotechnology Inc. for experiments.

Table 5 literature sources of primer pairs

Blue algae with serial numbers 1-12 in Table 4 are blue algae producing MIB in Table 1 (17 blue algae in Table 1, 12 blue algae producing MIB,5 blue algae producing no MIB), purchased from the fresh water algae seed pool of China academy of sciences, and the verification of the primers A-G is common PCR and gel electrophoresis.

The blue algae with the serial numbers of 13-45 in the table 4 are not available, so the primer amplification verification method adopts the following method:

respectively downloading the blue algae mic gene sequences with the sequence numbers of 13-45 in an NCBI database, comparing the primers A-G with the specific primers of the method with the downloaded blue algae mic gene sequences, and if the blue algae mic gene contains a primer sequence segment, considering that the primers can be used for amplification; if the corresponding primer series fragment is not contained in the mic gene, the primer is considered to be unavailable for amplification.

The primer sequences were aligned with the sequences of the mic genes downloaded in the NCBI database, and if the mic genes contained primer sequence fragments, amplification was considered possible.

Primer amplification coverage verification method for blue algae with sequence numbers 1-12 in table 4:

1. extraction of blue algae DNA

Using FastDNAThe Kit for oil Kit (6560-200, MPBio, U.S.) respectively carries out DNA extraction on 12 blue algae with the sequence number of 1-12 in table 4 to obtain a corresponding DNA sample of 12 blue algae;

2. PCR amplification

Respectively using the existing known primer pairs A-G, respectively using the blue algae DNA extracted in the step 1) as a template, performing conventional common PCR amplification, performing 1% agarose gel electrophoresis on the amplified products, wherein,

the common PCR reaction system is as follows: 2X PCR Taq MasterMix with dye 12.5.5. Mu.L, 0.8. Mu.L each of the upstream and downstream primers, 2.0. Mu.L of template DNA, ddH ₂ O 8.9μL。

Primer pairs A-G were each as follows:

primer pair a: MIB3313F/MIB4226R;

MIB3313F：5′-CTCTACTGCCCCATTACCGAGCGA-3′：

MIB4226R：5′-GCCATTCAAACCCGCCGCCCATCCA-3′；

the length of the amplified product of the primer pair A is 913bp, the primer can amplify 23 strains of the blue algae producing smell, but can not amplify certain anabaena pseudoanabaena, oscillatoria, sphingesii and Phaeophyta pseudofloat, and meanwhile, the primer has longer amplified length and is not suitable for real-time fluorescence quantitative PCR, and the detection result of gel electrophoresis is shown in Table 4.

Primer pair B: MIB3324F/MIB4050R

MIB3324F：5′-CATTACCGAGCGATTCAACGAGC-3′：

MIB4050R：5′-CCGCAATCTGTAGCACCATGTTGA-3′；

The length of the amplified product of the primer pair B is 726bp, the primer can amplify 26 strains of olfactory blue algae, but can not amplify certain anabaena and Sphingomonas gracilis, and meanwhile, the primer has longer amplified length and is not suitable for real-time fluorescent quantitative PCR, and the detection result of gel electrophoresis is shown in Table 4.

Primer pair c: MIBS02F/MIBS02R

MIBS02F：5′-ACCTGTTACGCCACCTTCT-3′；

MIBS02R：5′-CCGCAATCTGTAGCACCATG-3′：

The length of the amplified product of the primer pair c is 307bp, the primer can amplify 39 strains of the olfactory blue algae, but can not amplify certain anabaena pseudoanabaena, oscillatoria pseudostella and Phaeodactylum, and the detection result of gel electrophoresis is shown in Table 4.

Primer pair D: mibf/Mibr

Mibf：5′-ATGCCCCAAAMTATCACTGCC-3′；

Mibr：5′-GCCGCAATCTGTAGCACCAT-3′，

The length of the amplified product of the primer pair D is 864bp, the primer can amplify 33 strains of the blue algae producing smell, but can not amplify certain anabaena, oscillatoria and Philippine fleshy silk algae, and meanwhile, the primer has longer amplified length, and is not suitable for real-time fluorescence quantitative PCR, and the detection result of gel electrophoresis is shown in Table 4.

Primer pair E: MIB-Rf/MIB-Rr

MIB-Rf：5′-CGACAGCTTCTACAYCYCCATGAC-3′：

MIB-Rr：5′-CGCCGCAATCTGTAGCACCAT-3′，

The length of the amplified product of the primer pair E is 202bp, the primer can amplify 40 strains of the olfactory blue algae, but can not amplify certain anabaena pseudostella, sphingesii and Phaeophyta pseudofloat, and the detection result of gel electrophoresis is shown in Table 4.

Primer pair F: mibC132-F/mibC132-R

mibC132-F：5′-CGYACCTGTTACGCCACCTTCT-3′；

mibC132-R：5′-TCATGGAGGTGTAGAAGCTGTCGT-3′，

The length of the amplified product of the primer pair F is 132bp, the primer can amplify 39 strains of the olfactory blue algae, but can not amplify certain anabaena pseudoanae and Sphingomonas gracilis, and the detection result of gel electrophoresis is shown in Table 4.

Primer pair G: GPPMT1/GPPR2

GPPMT1：5′-CACCTATTCACCAGTAACACATTCT-3′：

GPPR2：5′-TGGTGCGGGTTATGTTTTGGATAATC-3′，

The length of the amplification product of the primer pair G is 870bp, the primer can amplify 1 strain of anabaena pseudostellaria, and meanwhile, the primer is not suitable for real-time fluorescent quantitative PCR due to longer amplification length, and the detection result of gel electrophoresis is shown in Table 4.

Table 4 amplification of the micro Gene of the olfactory blue-green algae by the mic primer pair

Note that: +: the primer can amplify the corresponding blue algae; -: the primer cannot amplify the corresponding blue algae.

Sequence listing

<110> national academy of sciences ecological Environment research center

<120> a method for evaluating concentration of 2-methylisocyanol in water body

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 226

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

gctgcgcgac agcacgacag cttctacacc tccatgacgc taatcgaccc catcggaggg 60

tacgtcctcc cagcagatct tttcttcgaa ccgcgcgtcc gtcacgcagc gttcttggcc 120

gggacggccg tcgttctggt caacgatctc ctttcggtcg ccaaagatct ggcagacgag 180

cagccaccgg tcaacatggt gctacagatt gcggcggatc ggggct 226

<210> 2

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 2

gacagcttct acacctccat ga 22

<210> 3

<211> 22

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

caatctgtag caccatgttg ac 22

<210> 4

<211> 2936

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 4

gctgcgcgac agcacgacag cttctacacc tccatgacgc taatcgaccc catcggaggg 60

tacgtcctcc cagcagatct tttcttcgaa ccgcgcgtcc gtcacgcagc gttcttggcc 120

gggacggccg tcgttctggt caacgatctc ctttcggtcg ccaaagatct ggcagacgag 180

cagccaccgg tcaacatggt gctacagatt gcggcggatc ggggcttcgc gcgtttcggt 240

gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa 300

gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg 360

ggctggctta actatgcggc atcagagcag attgtactga gagtgcacca tatgcggtgt 420

gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgccattc gccattcagg 480

ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt cgctattacg ccagctggcg 540

aaagggggat gtgctgcaag gcgattaagt tgggtaacgc cagggttttc ccagtcacga 600

cgttgtaaaa cgacggccag tgaattcgag ctcggtacct cgcgaatgca tctagatatc 660

ggatcccggg cccgtcgact gcagaggcct gcatgcaagc ttggcgtaat catggtcata 720

gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag 780

cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg 840

ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca 900

acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 960

gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 1020

gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 1080

ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 1140

cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 1200

ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 1260

taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 1320

ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 1380

ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 1440

aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 1500

tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 1560

agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 1620

ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 1680

tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 1740

tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 1800

cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 1860

aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 1920

atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 1980

cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 2040

tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 2100

atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 2160

taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 2220

tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 2280

gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 2340

cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 2400

cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 2460

gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 2520

aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 2580

accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 2640

ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 2700

gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 2760

aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 2820

taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac 2880

cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtc 2936

Claims

1. A method for evaluating the MIB concentration of 2-methyl isoborneol in a water body, comprising the following steps:

1) Construction of a Standard mic plasmid

Introducing a blue-green algae mic gene sequence fragment into a vector through a gene cloning technology, constructing a standard mic plasmid, and determining the nucleic acid mass concentration of the constructed standard mic plasmid;

2) Design of specific primers

3) Preparing standard mic plasmid diluent

N = (NA ×c ) / ( L × M ) （3）

in formula (3): n: mic gene copy number concentration, copies.mu.L of standard mic plasmid diluent ^-1 NA: avogalileo constant, 6.02X10 ²³ mol ^-1 C: nucleic acid mass concentration, g.mu.L, of standard mic plasmid diluent ^-1 The method comprises the steps of carrying out a first treatment on the surface of the L: the base length of the constructed standard mic plasmid is bp, wherein the base length is the length of a target gene plus the length of a vector, and L=2936; m: average molar mass per unit base of 660 g mol ^-1 ·bp ^-1 ；

4) Drawing a mic gene copy number standard curve A

Performing real-time fluorescent quantitative PCR by taking the mic plasmid in the standard mic plasmid diluent as a template DNA and the specific primer designed in the step 2) as a primer to obtain a Cq value corresponding to the standard mic plasmid diluent; and then, drawing a standard curve A of the mic gene copy number concentration of the standard mic plasmid and the Cq value of the real-time fluorescence quantitative PCR by taking the logarithmic value of the mic gene copy number concentration N of the standard mic plasmid diluent as an ordinate and taking the Cq value measured by the real-time fluorescence quantitative PCR as an abscissa, wherein the standard curve A is shown in a formula (1):

log10(N)= k × Cq + b （1）

In formula (1): cq value: the Cq value of the real-time fluorescence quantitative PCR for the standard mic plasmid diluent subjected to gradient dilution; n: the concentration of the copy number of the mic gene in the standard mic plasmid diluent is shown; log10 (N): logarithmic value of mic gene copy number concentration in standard mic plasmid diluent; k is the slope of the standard curve a, k= -0.290; b is the intercept of the standard curve, b=11.92;

6) Determination of MIB concentration in environmental Water sample

7) Drawing a MIB concentration and mic gene copy number concentration standard curve B

Establishing a standard curve B of the MIB concentration and the mic gene copy number concentration in the environmental water sample by taking the logarithmic value of the mic gene copy number concentration N of the environmental water sample obtained by calculating the standard curve A in the step 5) as an abscissa and taking the logarithmic value of the MIB concentration Y measured in the step 6) as an ordinate, wherein the standard curve B is shown in a formula (2):

log10(Y) = k1 × log10(N) - b1 （2）

in formula (2): n: copy number concentration of mic gene and copies L in environmental water sample ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Y is MIB concentration and ng L of environmental water sample ^-1 The method comprises the steps of carrying out a first treatment on the surface of the k1: slope of standard curve B; b1 is the intercept of the standard curve B;

8) Collecting and filtering a water sample of a water body to be evaluated, and collecting the filtered sample to be evaluated on the filter membrane; then extracting DNA of the sample to be evaluated by using a DNA extraction kit to obtain DNA of the sample to be evaluated; then, carrying out real-time fluorescence quantitative PCR by taking the specific primer designed in the step 2) as a primer and taking the extracted DNA of the sample to be evaluated as a template to obtain a Cq value of the water body to be evaluated; then, calculating according to a standard curve A to obtain the mic gene concentration N in the water body to be evaluated; and then calculating according to the standard curve B to obtain the MIB concentration in the water body to be evaluated.

2. The method according to claim 1, wherein the reaction system of the real-time fluorescent quantitative PCR in step 4) is: TB Green ™ Premix Ex Taq ™ 12.5.5 [ mu ] L, specific upstream and downstream primers MIBQSF/MIBQSR each 0.8 [ mu ] L, template DNA 2.0 [ mu ] L, ddH ₂ O8.9 μl; the real-time fluorescent quantitative PCR amplification procedure was: the activation stage is 94 ℃ for 10 min; high temperature denaturation at 95 ℃ for 20 s; low temperature annealing at 50 ℃ for 20 s; the extension stage is 72 ℃ for 20 s; the reaction is carried out for 50 cycles; annealing stage95℃for 10s,65℃for 60s,97℃for 1s.

3. The method of claim 1 or 2, wherein in step 2) the primer MIBQSF:5'-GACAG CTTCTACACCTCCATGA-3'; the primer is MIBQSR:5'-CAATCTGTAGCACCATGTTG AC-3'.