CN113943782A

CN113943782A - Method for evaluating concentration of 2-methylisoborneol in water body

Info

Publication number: CN113943782A
Application number: CN202111291151.3A
Authority: CN
Inventors: 苏命; 曹腾心; 朱宜平; 陆金平; 杨敏
Original assignee: Research Center for Eco Environmental Sciences of CAS
Current assignee: SHANGHAI CHENGTOU RAW WATER CO Ltd; Research Center for Eco Environmental Sciences of CAS
Priority date: 2021-11-02
Filing date: 2021-11-02
Publication date: 2022-01-18
Anticipated expiration: 2041-11-02
Also published as: CN113943782B

Abstract

The invention discloses a method for evaluating the concentration of 2-methylisoborneol MIB in water, which comprises the steps of filtering water, collecting cyanobacterial cells, extracting cyanobacterial DNA, carrying out real-time fluorescence quantitative PCR by taking the cyanobacterial DNA as a template to obtain a Cq value of the water, and then substituting the Cq value into a standard curve A of the copy number concentration of a mic gene and the Cq value of the real-time fluorescence quantitative PCR to calculate to obtain the concentration N of the mic gene in the water; and then, the concentration of the mic gene in the water body is brought into a standard curve B of the concentration of the MIB and the copy number concentration of the mic gene in the sample, so that the concentration of the MIB in the water body to be evaluated is obtained. The method overcomes the technical defects that large-scale detection equipment is required and the detection time is long in the existing method for monitoring the concentration of the MIB in the water body, has high sensitivity, low detection limit, short detection time and high flux, and can realize rapid and accurate quantitative detection on the MIB.

Description

Method for evaluating concentration of 2-methylisoborneol in water body

Technical Field

The invention relates to an evaluation method of an olfactory substance, in particular to a qualitative and quantitative evaluation method of an olfactory substance generating a musty taste in a water source, and belongs to the technical field of biology.

Background

The safety of the drinking water is directly related to the health of human beings, and the odor of the drinking water is the most easily perceived water quality index of consumers and is also an important factor for directly judging the water quality of the consumers. The odor problem of drinking water widely exists in China, according to the general water quality inspection result of water specialties in China for key cities in China, 80% of water samples of water sources have the odor problem, wherein the odor problem accounts for a large proportion, and 2-Methylisoborneol (MIB) is a main odor substance generating the odor of terra in lake and reservoir water sources, and the detection rate of the odor substance in the water sources is up to 75%. Odor problem exists in a plurality of cities in China, and the MIB is detected in Beijing, Tianjin, Shanghai, Zhuhai, Shenzhen, Dalian Lian and the like. The MIB is difficult to achieve ideal removal effect under the conventional water treatment process conditions, and the advanced treatment process increases the cost and has a certain limit, so the odor problem still exists in the factory water.

In lake and reservoir type water source areas, MIB is a volatile terpenoid mainly produced by metabolism of filamentous blue algae, and the olfactory threshold value is only 5-10 ng/L. The olfactory filamentous blue algae are various in species, the forms of part of olfactory filamentous blue algae are similar, the identification of olfactory blue algae at present mainly adopts a traditional microscope microscopic method, the method is time-consuming and labor-consuming, the accuracy is low, certain errors exist, and the olfactory filamentous blue algae cannot be morphologically distinguished from the olfactory filamentous blue algae. The traditional detection methods for MIB can be divided into sensory analysis, instrumental analysis and combination of the sensory analysis and the instrumental analysis. Sensory Analysis methods include olfactory scoring (FRS), olfactory Threshold Number (TON) and olfactory Profile Analysis (FPA). The sensory analysis method has the advantage of comprehensively perceiving the substances in the water. The commonly used instrumental analysis methods include electronic nose measurement, gas chromatography and gas chromatography, and the most widely used method is the gas chromatography. With the development of highly sensitive and highly accurate chromatographic methods, GC-MS is commonly used to identify and detect olfactory substances.

Because the concentration of the smelly substances in the environment is extremely low, a pretreatment technology is usually adopted before the instrumental analysis, and the accuracy and the sensitivity of the qualitative and quantitative analysis are improved. The pretreatment technologies mainly include closed-loop gas stripping analysis (CLSA), Resin Adsorption (RA), liquid-liquid extraction (LLE), solid-phase extraction (SPE), solid-phase microextraction (SPME), stir-rod adsorption extraction (SBSE), liquid-phase microextraction (LPME), purging and trapping (P & T), distillation extraction (SDE), and the like. SPME-GC-MS is a widely adopted odor substance detection method at present, and has the advantages of simple and rapid pretreatment method, short sample introduction time and low detection limit.

From the traditional detection method of MIB, the sensory analysis method has strong subjectivity, large errors exist during the olfactory evaluation, the instrumental analysis method has the problems of few detectable olfactory substances and high difficulty in structural analysis and determination, and large instruments are needed, so that the field detection and the traceability of the olfactory substances are difficult to achieve.

In recent years, the molecular biological detection method of MIB is rapidly developed, and researches on the variety, origin and diversity of genes related to MIB synthesis in blue algae enable PCR (polymerase chain reaction) and real-time fluorescent quantitative PCR (qPCR) to be applied to detection of odor problems, so that high-throughput, rapid and accurate detection is realized.

The biosynthesis route and related gene research of MIB starts from actinomycetes, and is further researched and found in blue algae. The precursor of MIB is isopentenyl diphosphate (IPP), which can produce geranyl diphosphate (GPP), which is a two-step reaction to produce MIB. Firstly, geranyl pyrophosphate generates methylated GPP (methyl-GPP) under the action of GPP 2-methyltransferase (GPPMT), and then methylated GPP generates cyclization under the action of MIB synthetase (MIBynthase, MIBS) to finally generate MIB. Gene operons related to MIB synthesis in cyanobacteria include cyclic nucleotide binding protein gene (cnb), methyltransferase gene (mtf), MIB cyclase gene (mic).

The invention designs a specific primer for a blue algae MIB cyclase gene (mic), establishes a real-time fluorescence quantitative RCR (qPCR) detection method, and verifies in a plurality of water sources. The method is rapid and accurate, has high sensitivity and good specificity, and can realize the evaluation of the potential and risk of the odor substances generated by the source water.

Disclosure of Invention

The invention aims to provide a method for evaluating MIB content, in particular a method for evaluating MIB content in a water source area, aiming at the technical problems that a large-scale detection instrument is needed in the existing MIB detection process, and the detection flow is long and the sensitivity and detection limit are poor when the instrument is adopted for MIB detection and analysis.

To achieve the object of the present invention, in one aspect, the present invention provides a method for estimating the concentration of 2-Methylisoborneol (MIB) in a water body, comprising the steps of:

firstly, collecting a water sample of a water body to be evaluated, filtering the water sample, and collecting a sample on a filter membrane after filtration to obtain a sample to be evaluated;

then, extracting the DNA of the sample to be evaluated by using a DNA extraction kit to obtain the DNA of the sample to be evaluated;

then, taking the DNA of a sample to be evaluated as a template, and carrying out real-time fluorescence quantitative PCR to obtain the Cq value of the water body to be evaluated;

and then calculating according to a standard curve A of the copy number concentration of the mic gene and the Cq value of the real-time fluorescent quantitative PCR to obtain the concentration N of the mic gene in the water body to be evaluated, wherein the standard curve A is shown as a formula (1):

log10(N)＝k×Cq+b (1)

in equation (1): cq value: the Cq value of real-time fluorescence quantitative PCR of the water body to be evaluated is obtained; n: the copy number concentration of the mic gene in the water body to be evaluated; log10 (N): the logarithm value of the copy number concentration of the mic gene in the water body to be evaluated; k is the slope of the standard curve A, and k is-0.290; b is the intercept of the standard curve, and b is 11.92;

and then calculating according to a standard curve B of the MIB concentration and the mic gene copy number concentration to obtain the MIB concentration in the water body to be evaluated, wherein the standard curve B is shown as a formula (2):

log10(Y)＝k1×log10(N)-b1 (2)

in formula (2): n: copy number concentration of the mic gene, copies L, in the water to be evaluated^-1(ii) a Y: MIB concentration, ng L, of the water body to be evaluated^-1(ii) a k 1: slope of standard curve B, k1 is 0.357; b 1: the intercept, B1, of the standard curve B is 0.349.

Wherein the filter membrane used for filtration is a 1.2 μm filter membrane; RTTP04700, 1.2 μm polycarbonate film.

Wherein, in the real-time fluorescent quantitative PCR process, the primer is MIBQSF/MIBQSR, wherein the ratio of MIBQSF: SEQ ID NO. 2: MIBQSR: SEQ ID NO. 3.

In particular, the primers MIBQSF: 5'-GACAGCTTCTACACCTCCATGA-3', respectively; the primer is MIBQSR: 5'-CAATCTGTAGCACCATGTTGAC-3' are provided.

In particular, the primers were designed using Primer Premier v6.24 software.

In particular, the reaction system of the real-time fluorescence quantitative PCR is as follows: TB Green^TM Premix Ex Taq^TM12.5. mu.L of each of the specific upstream and downstream primers (MIBQSF/MIBQSR) 0.8. mu.L, template DNA 2.0. mu.L, ddH₂O8.9 μ L; the real-time fluorescent quantitative PCR amplification program comprises the following steps: the activation stage is 94 ℃ and lasts for 10 min; high temperature denaturation at 95 ℃ for 20 s; low-temperature annealing is carried out for 20s at 50 ℃; an extension phase of 72 ℃ for 20 s; the reaction was carried out for 50 cycles; the annealing phase was 95 ℃ for 10s, 65 ℃ for 60s, 97 ℃ for 1 s.

Wherein, a standard curve A is drawn according to the following method:

A1) introducing a mic gene sequence fragment of blue-green algae into a vector by a gene cloning technology, constructing a standard mic plasmid, and determining the nucleic acid mass concentration of the constructed standard mic plasmid;

A2) designing a specific primer pair MIBQSF/MIBQSR, wherein the ratio of MIBQSF: SEQ ID No. 2; MIBQSR: SEQ ID NO. 3:

A3) carrying out tenfold gradient dilution on the standard mic plasmid constructed in the step A1) to prepare a standard mic plasmid diluent; calculating the mic gene copy number concentration N of the standard mic plasmid diluent according to a formula (3);

N＝(NA×c)/(L×M) (3)

in equation (3): n: copy number concentration of the mic Gene, copies. mu.L, of a Standard mic plasmid dilution^-1(ii) a NA: avogastron constant, 6.02X 10²³mol^-1(ii) a c: nucleic acid mass concentration, g.mu.L, of standard mic plasmid dilutions^-1(ii) a L: base length, bp (base length is target gene length plus carrier gene length) of constructed standard mic plasmid) L is 2936 bp; m: average molar mass per base, 660 g.mol^-1·bp^-1；

A4) Carrying out real-time fluorescent quantitative PCR by taking the mic plasmid in the standard mic plasmid diluent prepared in the step A3) as template DNA and the specific primer designed in the step A2) as a primer to obtain a Cq value corresponding to the standard mic plasmid diluent; and then, drawing a standard curve A of the mic gene copy number concentration of the standard mic plasmid and the Cq value of the real-time fluorescent quantitative PCR by taking the logarithmic value of the mic gene copy number concentration N of the standard mic plasmid diluent obtained by calculation in the step A3) as a vertical coordinate and the Cq value measured by the real-time fluorescent quantitative PCR as a horizontal coordinate.

Wherein, the blue algae mic gene sequence segment SEQ ID NO.1 in the step A1); the vector is a pUC57 vector.

Particularly, the sequence fragment of the mic gene of the blue algae is 226 bp; the pUC57 vector 2710 bp; the length L of the basic group for constructing the standard mic plasmid is 2936 bp.

Wherein the nucleic acid mass concentration of the standard mic plasmid is determined by using a micro nucleic acid determinator (such as NanoDrop 1000).

In particular, in step A3), the nucleic acid mass concentration c of the standard mic plasmid dilution is determined using a microanalyzer (e.g., NanoDrop 1000).

Wherein, a standard curve B is drawn according to the following method:

B1) collecting at least 30 different environmental water samples, filtering and collecting samples on a filter membrane to obtain environmental samples;

B2) respectively extracting the DNA of the environmental sample by using a DNA extraction kit to obtain the DNA of the environmental sample;

B3) respectively taking the DNA of an environmental sample as a template, and carrying out real-time fluorescence quantitative PCR to obtain the Cq value of the environmental water sample;

B4) respectively bringing the Cq values of the environmental water sample into a standard curve A, and calculating to obtain the copy number concentration N of the mic genes in the environmental water sample;

B5) respectively carrying out GC-MS (gas chromatography-Mass spectrometer) determination on the environmental water sample obtained in the step B1) to respectively obtain the MIB concentration Y of the environmental water sample;

B6) and B) drawing a standard curve B of the concentration of the MIB in the environment water sample and the copy number concentration of the micgenes by taking the logarithmic value of the copy number concentration N of the micgenes of the environment water sample obtained by calculation through the standard curve A in the step B4) as an abscissa and the logarithmic value of the concentration Y of the MIB in the environment water sample measured in the step B5) as an ordinate.

In particular, the conditions for the GC-MS measurements described in step B5) are as follows:

the column was HP-5ms (30 m.times.0.25 mm.times.0.25 μm); the sample injection flow is set to be 1.0 mL/min^-1(ii) a The electron energy is 70 eV; electron multiplication voltage 824V; column head pressure is 50 kPa; the temperature of the transmission line is 280 ℃; the ion source temperature is 230 ℃; the injection port temperature was 240 ℃ in quantitative measurement.

Temperature rising procedure: t0 at 50 deg.C for 2min, 8 deg.C for min^-1The speed is increased to 160 ℃, and then the temperature is increased to 20 ℃ per minute^-1The speed is increased to 280 ℃, and the temperature is kept constant at 280 ℃ for 5 min.

Quantitative analysis, and the scanning quality range of a full SCAN (SCAN) is 35 u-350 u. The injection port temperature is 260 ℃ during full scanning. The sample introduction mode is non-shunting sample introduction;

temperature rising procedure: t0 at 40 deg.C for 3min, 4 deg.C for min^-1Heating to 200 deg.C, keeping the temperature at 200 deg.C for 2min, and heating at 15 deg.C for min^-1The temperature is raised to 260 ℃ at a speed rate, and the temperature is kept constant at 260 ℃ for 2 min.

In particular, k in the standard curve a is-0.290; b is 11.92.

In particular, k1 in the standard curve B is 0.357; b1 is 0.349.

The invention also provides a method for evaluating the concentration of 2-methylisoborneol in water, which comprises the following steps:

1. construction of Standard mic plasmids

Introducing the blue algae mic gene sequence fragment into a vector by a gene cloning technology, constructing a standard mic plasmid, and measuring the nucleic acid mass concentration of the standard mic plasmid;

2) design of specific primers

Designing a specific primer according to the mic gene, wherein the specific primer pair is MIBQSF/MIBQSR, and the ratio of MIBQSF: SEQ ID No. 2; MIBQSR: SEQ ID No. 3;

3) preparing standard mic plasmid diluent

Carrying out tenfold gradient dilution on the standard mic plasmid constructed in the step 1) to prepare a standard mic plasmid diluent; calculating the mic gene copy number concentration of the standard mic plasmid diluent according to a formula (3);

N＝(NA×c)/(L×M) (3)

in equation (3): n: copy number concentration of the mic Gene, copies. mu.L, of a Standard mic plasmid dilution^-1(ii) a NA: avogastron constant, 6.02X 10²³mol^-1(ii) a c: nucleic acid mass concentration, g.mu.L, of standard mic plasmid dilutions^-1(ii) a L: the base length of the constructed standard mic plasmid, bp (base length is the length of a target gene length loader), L is 2936; m: average molar mass per base, 660 g.mol^-1·bp^-1；

4) Drawing a standard curve A

Carrying out real-time fluorescent quantitative PCR by taking the mic plasmid in the standard mic plasmid diluent as a template DNA and the specific primer designed in the step 2) as a primer to obtain a Cq value corresponding to the standard mic plasmid diluent; and then, taking the logarithmic value of the mic gene copy number concentration N of the standard mic plasmid diluent obtained by calculation in the step 3) as a vertical coordinate, taking the Cq value measured by the real-time fluorescence quantitative PCR as a horizontal coordinate, and drawing a standard curve A of the mic gene copy number concentration of the standard mic plasmid and the Cq value of the real-time fluorescence quantitative PCR, wherein the standard curve A is shown as a formula (1):

log10(N)＝k×Cq+b (1)

in formula (1): cq value: the Cq value of the real-time fluorescence quantitative PCR of the standard mic plasmid diluent diluted in a gradient way; n: the concentration of the copy number of the mic gene in a standard mic plasmid diluent is obtained; log10 (N): logarithmic value of the copy number concentration of the mic gene in the standard mic plasmid diluent; k is the slope of the standard curve A, and k is-0.290; b is the intercept of the standard curve, and b is 11.92;

5) determination of the concentration of the copy number of a mic gene in an environmental sample

Collecting at least 30 different environmental water samples, filtering respectively, and collecting the environmental samples on the filter membrane after filtering respectively; then, respectively extracting the DNA of the environmental sample by using a DNA extraction kit to obtain the DNA of the environmental sample; then, taking the specific primer designed in the step 2) as a primer, taking the extracted environmental sample DNA as a template, and carrying out real-time fluorescence quantitative PCR to obtain a corresponding Cq value of the environmental water sample; then, bringing the determined Cq value of the environmental water sample into a standard curve A, and calculating to obtain the copy number concentration N of the micgenes in the environmental water sample;

6) determination of MIB concentration in environmental water sample

Taking the environmental water sample obtained in the step 5) for GC-MS determination, and determining the concentration Y of the MIB in the environmental water sample;

7) drawing a standard curve B

Taking the logarithm value of the copy number concentration N of the micgene of the environmental water sample obtained by calculating through the standard curve A in the step 5) as an abscissa, and taking the logarithm value of the MIB concentration Y of the environmental water sample determined in the step 6) as an ordinate, and establishing a standard curve B of the MIB concentration and the copy number concentration of the micgene in the environmental water sample, wherein the standard curve B is shown as a formula (2):

logl0(Y)＝k1×log10(N)-b1 (2)

in equation (2): n: copy number concentration of the micgene, copies L, in an environmental water sample^-1(ii) a Y: MIB concentration, ng L, of an environmental water sample^-1(ii) a k 1: slope of standard curve B, k1 is 0.357; b1 is the intercept of standard curve B, B1 is 0.349;

8) collecting and filtering a water sample of a water body to be evaluated, and collecting a sample to be evaluated on a filtered filter membrane; then, extracting the DNA of the sample to be evaluated by using a DNA extraction kit to obtain the DNA of the sample to be evaluated; then, taking the specific primer designed in the step 2) as a primer, taking the extracted sample DNA to be evaluated as a template, and carrying out real-time fluorescence quantitative PCR to obtain a Cq value of the water body to be evaluated; then, bringing the Cq value into a standard curve A, and calculating to obtain the concentration N of the micgene in the water body to be evaluated; and then substituting the calculated concentration N of the mic gene in the water body to be evaluated into a standard curve B, and calculating to obtain the concentration of the MIB in the water body to be evaluated.

Wherein the mic gene sequence of the blue algae in the step 1) is a mic gene sequence of the blue algae searched in an NCBI database.

In particular, the constructed standard mic plasmid is a circular DNA molecule.

Particularly, according to the searched mic gene sequence, part of gene segments are selected for gene cloning, and the sequence of the selected mic gene segment is as follows: SEQ ID NO. 1.

SEQ ID NO.1：gctgcgcgacagcacgacagcttctacacctccatgacgctaatcgaccccatcggagggtacgtcctccc agcagatcttttcttcgaaccgcgcgtccgtcacgcagcgttcttggccgggacggccgtcgttctggtcaacgatctcctttcggtcgcc aaagatctggcagacgagcagccaccggtcaacatggtgctacagattgcggcggatcggggct

Wherein, the vector in the step 1) is pUC57 vector.

In particular, it also comprises determining the nucleic acid mass of the constructed standard mic plasmid.

In particular, the method also comprises the step of measuring the nucleic acid mass concentration of the constructed standard mic plasmid by using a micro-nucleic acid tester (such as NanoDrop 1000).

Wherein, in the step 2), the software of Primer Premier v6.24 is adopted to carry out the design of specific primers.

In particular, the forward primer, MIBQSF (SEQ ID NO. 2): 5'-GACAGCTTCTACACCTCCATG A-3', respectively; downstream primer, MIBQSR (SEQ ID NO. 3): 5'-CAATCTGTAGCACCATGTTGAC-3' are provided.

The method also comprises PCR amplification verification of the specific primer designed in the step 2), and comprises the following specific steps:

2A) selecting at least 10 strains of cyanobacteria culture solution, respectively filtering, respectively collecting cyanobacteria cells, and then respectively extracting cyanobacteria cell DNA by using a DNA extraction kit;

2B) carrying out PCR amplification by taking the designed specific primer pair MIBQSF/MIBQSR as a primer and the extracted cyanobacteria cell DNA as a template, and carrying out 1% agarose gel electrophoresis on the amplified product;

2C) judging the amplification conditions of different blue algae DNAs according to gel electrophoresis, wherein the strip with the position of 200bp is capable of being amplified;

2D) taking the cyanobacteria culture solution in the step 2A) to carry out GC-MS determination, and determining the content of MIB in the culture solution;

2E) the blue algae capable of amplifying the 200bp strip is consistent with the blue algae for producing the MIB determined in the step 2D), which shows that the designed specific primer can specifically amplify the blue algae for producing the MIB.

In particular, the filter membrane used for the filtration in step 2A) was a 1.2 μm, RTTP04700, 1.2 μm polycarbonate membrane.

Wherein, the PCR amplification conditions in the step 2B) are as follows:

the PCR reaction system is as follows: 2 XPCR Taq MasterMix with dye12.5 uL, upstream and downstream primers (which are designed specific primers) each 0.8 uL, template DNA 2.0 uL, ddH₂O 8.9μL；

The PCR amplification procedure was: the activation stage is 94 deg.C, and lasts for 5 min; high temperature denaturation at 94 ℃ for 30 s; low-temperature annealing is carried out for 30s at 56 ℃; an extension phase of 72 ℃ for 30 s; the reaction was carried out for a total of 30 cycles.

Wherein, 1 mu L of the standard plasmid constructed in the step 1) is taken in the step 3), and ddH is used₂And O, obtaining standard mic plasmid diluent with at least 8 concentration gradients according to a tenfold gradient dilution method.

In particular, the tenfold gradient dilution method adds 9. mu.L ddH to 1. mu.L of the standard plasmid₂O as the first concentration gradient, and then 9. mu.L ddH was added to 1. mu.L of the first concentration gradient₂0 is taken as a second concentration gradient, eight concentration gradients are sequentially established, and each concentration gradient is subjected to 3 technical repetitions.

ddH₂O means: and sterilizing the ultrapure water at 121 ℃ by using a high-temperature high-pressure sterilizing pot.

Wherein k in the standard curve a in the step 4) is-0.290; b is 11.92.

In particular, the reaction system of the real-time fluorescence quantitative PCR in the steps 4), 5) and 8) is as follows: TB Green^TM Premix Ex Taq^TM12.5. mu.L of each of the specific upstream and downstream primers (MIBQSF/MIBQSR) 0.8. mu.L, template DNA 2.0. mu.L, ddH₂O 8.9μL。

In particular, the real-time fluorescent quantitative PCR amplification procedure is as follows: the activation stage is 94 ℃ and lasts for 10 min; high temperature denaturation at 95 ℃ for 20 s; low-temperature annealing is carried out for 20s at 50 ℃; an extension phase of 72 ℃ for 20 s; the reaction was carried out for 50 cycles; the annealing phase was 95 ℃ for 10s, 65 ℃ for 60s, 97 ℃ for 1 s.

Among them, the number of the environmental samples in the step 5) is preferably 50.

In particular, the filter is a 1.2 μm filter (RTTP04700, 1.2 μm polycarbonate membrane).

In particular, the concentration and quality of the extracted environmental sample DNA are detected by a NanoDrop1000 micro nucleic acid analyzer. The value of the absorbance D260/D280 of the extracted DNA of the environmental sample is considered to be qualified for extraction, and if the extraction quality is not qualified, re-extraction is required.

Wherein, the GC-MS determination conditions in the step 6) are as follows:

Particularly, 10mL of sample is taken from an environmental water sample and is respectively placed in 15mL extraction bottles, 4.0g of high-grade pure NaCl dried for 4 hours at 450 ℃ is added into each extraction bottle, and after uniform dissolution, the gas chromatography-mass spectrometry (GC-MS) determination is carried out.

The method of the invention has the following advantages and benefits:

1. the specific primers (MIBQSF: 5'-GACAGCTTCTACACCTCCATGA-3' and MIBQSR: 5'-CAATCTGTAGCACCATGTTGAC-3') designed by the invention can specifically amplify the known 45 plants of olfactory blue algae, and the coverage is the highest among all the published mic gene primers.

2. The specific primer of the invention has high specificity and specificity, only can specifically amplify MIB blue algae with high yield, but cannot amplify non-MIB blue algae with low yield.

3. The method is applied to 50 environmental samples of 9 reservoirs/lakes in China, and a linear equation of the MIB concentration and the mic gene abundance of the environmental samples is established. The molecular biology detection method of the mic gene is better consistent with the MIB instrumental analysis method (GC-MS), and can be used for evaluating and early warning the MIB concentration in the water body.

4. Compared with the traditional detection method of MIB, the real-time fluorescent quantitative PCR method based on the mic gene can realize high-throughput detection, is rapid and sensitive, and can be used for in-situ odor detection and early warning.

The invention designs a specific primer based on a mic gene based on 43 MIB olfactory alga, and simultaneously optimizes the amplification condition of qPCR. And the method is verified in 17 pure algae strains and 50 reservoir samples, and the method can be used for evaluating and early warning the MIB concentration in the water body.

Drawings

FIG. 1A shows mic gene amplification bands of blue algae numbered 2-6 in example 3;

FIG. 1B is a mic gene amplification band of blue algae numbered 7-9 in example 3;

FIG. 1c is a mic gene amplification band of blue algae numbered 10-16 in example 3;

FIG. 1D shows mic gene amplification bands of blue algae numbered 17-18 in example 3;

FIG. 2 is a standard curve A of gene copy number concentration of the mic gene and Cq value of real-time fluorescent quantitative PCR;

FIG. 3 is a linear equation standard curve B of the concentration of MIB and the copy concentration of its mic gene in a water sample.

Detailed Description

The invention will be further described with reference to specific embodiments, and the advantages and features of the invention will become apparent as the description proceeds. These examples are illustrative only and do not limit the scope of the present invention in any way. It will be understood by those skilled in the art that various changes in form and details may be made therein without departing from the spirit and scope of the invention, and that such changes and modifications may be made without departing from the spirit and scope of the invention.

Example 1 construction of Standard plasmids

Searching a mic gene sequence of blue-green algae in an NCBI database, selecting a mic gene sequence fragment (SEQ ID NO.1) of anabaena pseudobaena, introducing the mic gene fragment into a pUC57 vector through a gene cloning technology, and constructing to obtain a standard mic plasmid (SEQ ID NO.4), wherein the mic gene sequence fragment (SEQ ID NO.1) of anabaena pseudobaena is as follows:

gctgcgcgacagcacgacagcttctacacctccatgacgctaatcgaccccatcggagggtacgtcctcccagcagatcttttct tcgaaccgcgcgtccgtcacgcagcgttcttggccgggacggccgtcgttctggtcaacgatctcctttcggtcgccaaagatctggca gacgagcagccaccggtcaacatggtgctacagattgcggcggatcggggct。

the original standard mic plasmid constructed by the invention is synthesized by Shanghai Biotechnology Limited, and the mass concentration of the plasmid nucleic acid is determined by adopting a micro nucleic acid determinator (such as NanoDrop 1000); the length of the basic group is 2936bp (226 basic groups of a mic gene sequence fragment, 2710 basic groups of a PUC57 vector).

The mic gene sequence for constructing the standard mic plasmid is exemplified by the mic gene sequence of anabaena pseudobaena, and the mic gene sequences of other blue-green algae are all suitable for the invention.

Example 2 extraction of blue algae DNA

Respectively filtering 17 blue algae culture solutions (shown in table 1) purchased from freshwater algae seed banks of Chinese academy of sciences by using filter membranes (1.2 mu m, RTTP04700, 1.2 mu m polycarbonate membrane, IsoporetM, USA), and enriching blue algae cells on the filter membranes to respectively obtain 17 blue algae cells;

using DNA extraction kit (FastDNA)

The Kit for Soil Kit (6560-: the concentration of DNA was the value of ng/. mu.L as shown in NanoDrop1000, and ddH was usually used in real-time fluorescent quantitative PCR₂Diluting to 20 ng/mu L with O; the quality of the blue algae DNA extraction is tested by a NanoDrop1000 micro nucleic acid tester, and the value of the absorbance D260/D280 is judged to be qualified after the extraction, wherein the value is between 1.8 and 2.2. And using the qualified DNA as a template DNA for later use.

Example 2A determination of blue algae producing MIB

The MIB detection method comprises the following steps: accurately measuring 10mL of blue algae culture solution of 17 blue algae respectively, placing the blue algae culture solution in respective 15mL extraction bottles, adding high-grade pure NaCl (4.0g) dried at 450 ℃ for 4 hours into each extraction bottle respectively, dissolving uniformly, and then measuring by gas chromatography-mass spectrometry (GC-MS); determining the content of MIB in the blue algae sample; wherein, the GC-MS determination conditions are as follows:

the column was HP-5ms (30 m.times.0.25 mm.times.0.25 μm); the sample injection flow is set to be 1.0 mL/min^-1(ii) a The electron energy is 70 eV; electron multiplication voltage 824 v; column head pressure is 50 kPa; the temperature of the transmission line is 280 ℃; the ion source temperature is 230 ℃; the injection port temperature was 240 ℃ in quantitative measurement.

Temperature rising procedure: t0 at 50 deg.C for 2min, raising the temperature to 160 deg.C at 8 deg.C/min-1, and then at 20 deg.C/min^-1The speed is increased to 280 ℃, and the temperature is kept constant at 280 ℃ for 5 min.

Quantitative analysis, and the scanning quality range of a full SCAN (SCAN) is 35 u-350 u. The injection port temperature is 260 ℃ during full scanning.

The sample introduction mode is non-shunting sample introduction;

The measurement results are shown in Table 1, wherein 12 blue algae produce MIB blue algae; 5 blue algae do not produce MIB.

Example 3 design of specific primers

1. Primer design

According to the mic gene sequence of MIB blue algae generated in an NCBI database, adopting Primer Premier v6.24 software to carry out specific Primer design on the mic gene; specific primers were designed as follows:

upstream primer, MIBQSF (SEQ ID NO. 2): 5'-GACAGCTTCTACACCTCCATGA-3', respectively;

downstream primer, MIBQSR (SEQ ID NO. 3): 5'-CAATCTGTAGCACCATGTTGAC-3', respectively;

2. verification of PCR amplification

DNA of 17 blue algae extracted in example 2 was used as a template, and the primers (MIBQSF; MIBQSR) as specific primers, respectively carrying out PCR amplification, carrying out 1% agarose gel electrophoresis on common PCR amplification products, and verifying the specificity of the designed specific primers, wherein:

the common PCR reaction system is as follows: 2 XPCR Taq MasterMixwith dye12.5 uL, upstream and downstream primers 0.8 uL, template DNA 2.0 uL, ddH₂O 8.9μL。

The template DNAs were DNAs of 17 strains of cyanobacteria extracted in example 2, respectively, and the template DNA for the negative control was ddH₂O；

The general PCR amplification procedure was: the activation stage is 94 deg.C, and lasts for 5 min; high temperature denaturation at 94 ℃ for 30 s; low-temperature annealing is carried out for 30s at 56 ℃; an extension phase of 72 ℃ for 30 s; the reaction was carried out for a total of 30 cycles.

The results of gel electrophoresis of the general PCR amplification are shown in Table 1 and FIGS. 1A-D.

MIB production and mic gene existence of Table 117 blue algae

Gel electrophoresis results of PCR amplification products of DNA extracted from 17 blue algae are shown in figures 1A-1D, and the sequence length of a DNA marker in figures 1A-1D is 2000bp, 1000bp, 750bp, 500bp, 250bp and 100bp from top to bottom in sequence; 1 is negative control; reference numerals 2 to 18 correspond to the blue algae denoted by the reference numerals in Table 1.

From the detection results of FIGS. 1A to 1D, it can be seen that: the amplification can be carried out under the amplification conditions of different blue algae DNAs, and the occurrence of a strip at the position of 200bp is the amplification.

The gel electrophoresis chart can obtain that the numbers of the algae strains 2, 3, 4, 5, 6, 8, 9, 11, 12, 13, 17 and 18 can amplify strips, which shows that the micgene can be amplified specifically by the primer designed by the invention, and meanwhile, the MIB concentration of the blue algae is determined by the GC-MS method, and the result shows that the blue algae can generate the MIB.

The

strains

7, 10, 14, 15 and 16 can not amplify bands, and the blue algae can not generate MIB when the MIB concentration is measured by the GC-MS method. Therefore, the primer designed by the invention can specifically amplify the blue algae producing the MIB.

Example 4 plotting the standard curve of the copy number of the mic gene

1. Real-time fluorescent quantitative PCR amplification

The standard mic plasmid constructed in example 1 was subjected to tenfold gradient dilution for constructing a standard curve.

1-1) taking 1. mu.L of the original standard mic plasmid constructed in example 1, adding 9. mu.L of ddH₂O as the first concentration gradient, and further 1. mu.L from the first concentration gradient, and 9. mu.L of ddH₂O as a second concentration gradient, then take 1. mu.L from the second concentration gradient, add 9. mu.L ddH₂O as the third concentration gradient, 10 concentration gradients were sequentially established according to the dilution method (see Table 2) to obtain a standard mic plasmid solution diluted in gradients, each concentration gradient was subjected to 3 technical repetitions, of which the former 8 dilution concentration gradients (10)¹～10⁸Multiple) was performed, and the last 2 concentration gradients were set as the validation detection limit.

TABLE 2 Standard Curve Gene copy number and detection Limit validation

1-2) respectively taking the standard micplasmids with ten-fold gradient dilution in the step 1-1) as template DNAs (deoxyribonucleic acids)Real-time fluorescent quantitative PCR was performed while setting a negative control (DNA template is ddH)₂O), the corresponding cq value is obtained.

The real-time fluorescent quantitative PCR reaction system is as follows: TB Green^TM Premix E× Taq^TM12.5. mu.L of each of the specific upstream and downstream primers (MIBQSF/MIBQSR) 0.8. mu.L, template DNA 2.0. mu.L, ddH₂O 8.9μL。

Wherein: drawing template DNA of a mic gene copy number standard curve as DNA which is subjected to ten-fold gradient dilution by standard mic plasmid constructed in example 1; template DNA of negative control sample as ddH₂O is replaced;

the real-time fluorescent quantitative PCR amplification program comprises the following steps: the activation stage is 94 ℃ and lasts for 10 min; high temperature denaturation at 95 ℃ for 20 s; low-temperature annealing is carried out for 20s at 50 ℃; an extension phase of 72 ℃ for 20 s; the reaction was carried out for 50 cycles; the annealing phase was 95 ℃ for 10s, 65 ℃ for 60s, 97 ℃ for 1 s.

2. Calculation of Standard mic plasmid copy number concentration

Respectively calculating the copy number concentration of the 10 standard mic plasmids diluted in the step 1) according to the formula (1),

N＝(NA×c)/(L×M) (1)

in equation (1): n: copy number concentration of the mic Gene, copies. mu.L, of a Standard mic plasmid dilution^-1(ii) a NA: avogastron constant, 6.02X 10²³mol^-1(ii) a c: nucleic acid mass concentration, g.mu.L, of standard mic plasmid dilutions^-1(ii) a L: the base length of the constructed standard mic plasmid, bp (base length is the length of a target gene length loader), L is 2936; m: average molar mass per base, 660 g.mol^-1·bp^-1；

The results of the calculation of the standard mic plasmid copy number concentrations for 10 gradient dilutions are shown in table 2.

3. Constructing a mic gene copy number standard curve A:

respectively carrying out real-time fluorescent quantitative PCR on the first eight plasmids subjected to gradient dilution in the table 2 to obtain corresponding Cq values;

establishing a standard curve by using the cq values of the first 8 plasmids subjected to gradient dilution in the table 2 and the logarithm value of the copy number concentration (N) of the corresponding standard mic plasmid calculated in the step (2), drawing a standard curve A of the gene copy number concentration of the standard mic gene and the cq value of the real-time fluorescent quantitative PCR by using the logarithm value of the copy number concentration (N) of the standard mic plasmid as a vertical coordinate and the cq value measured by the real-time fluorescent quantitative PCR as a horizontal coordinate, wherein the standard curve A is shown as a formula (2) and is shown as a figure 2:

log10(N)＝k×Cq+b (2)

in equation (2): cq value: the Cq value of the real-time fluorescence quantitative PCR of the standard mic plasmid diluent diluted in a gradient way; n: the concentration of the copy number of the mic gene in a standard mic plasmid diluent is obtained; log10 (N): logarithmic value of the copy number concentration of the mic gene in the standard mic plasmid diluent; k is the slope of the standard curve A, and k is-0.290; b is the intercept of the standard curve, and b is 11.92;

r of the standard curve A²＝0.999，p＜0.0001。

4. Determination of PCR amplification efficiency (E)

Calculating according to the formula (4): PCR amplification efficiency (E):

in equation (3): e: PCR amplification efficiency; k: the slope of a standard mic gene copy number standard curve A, k is 0.290;

the PCR amplification efficiency of the method is 95 percent; detection limit of 1.86X 10⁴copies·μL^-1(Table 2), the requirements of mic gene detection are met. Therefore, the copy number of the mic gene in the sample can be determined by the cq value of the sample to be detected and the standard curve.

Example 5 determination of the concentration of a mic Gene in an environmental sample

50 environmental samples (namely reservoir water samples, each 1000mL) of 9 reservoirs/lakes (a dense cloud reservoir, an ocean river reservoir, an in-bridge reservoir, a grass sand reservoir, a golden lake reservoir, an east lake, a thousand island lake, a phoenix mountain reservoir and a Nanping reservoir) are collected by a water collector and are used for measuring the concentration of the mic gene. Wherein: the geographical location of the reservoir/lake, the number of samples are shown in table 3.

1. Enriching blue algae cells

Taking 500mL of each environmental sample (reservoir water sample), respectively filtering by adopting a 1.2-micrometer filter membrane (RTTP04700, 1.2-micrometer polycarbonate membrane, Isopore (TM), USA), respectively filtering and enriching the cyanobacterial cells in each environmental sample to the 1.2-micrometer filter membrane;

in the present invention, except for the example of using RTTP04700 and 1.2 μm polycarbonate membrane for filtration and enrichment, other 1.2 μm filter membranes are suitable for the present invention, such as PVDF (polyvinylidene fluoride) filter membrane.

2. Extraction of blue algae DNA

Using DNA extraction kit (FastDNA)

The Kit for Soil Kit (6560-.

The value of the absorbance D260/D280 of the extracted DNA of the environmental sample is considered to be qualified for extraction, and if the extraction quality is not qualified, re-extraction is required.

3. Real-time fluorescent quantitative PCR

And carrying out real-time fluorescent quantitative PCR detection on the extracted environmental sample DNA to obtain a corresponding Cp value. Respectively taking blue algae DNA in the extracted environmental sample as a template, carrying out real-time fluorescence quantitative PCR, and setting a negative control (the DNA template is ddH)₂O), wherein:

the real-time fluorescent quantitative PCR reaction system is as follows: TB Green^TM Premix E×Taq^TM12.5. mu.L of each of the specific upstream and downstream primers (MIBQSF/MIBQSR) 0.8. mu.L, template DNA 2.0. mu.L, ddH₂O 8.9μL。

4. Calculating the mic Gene copy number in environmental samples

And (3) substituting the Cq value measured by the real-time fluorescent quantitative PCR in the step (3) into the mic gene copy number standard curve A, calculating to obtain the copy number concentration (N) of the mic gene in the environmental sample, and calculating the result as shown in the table 3.

The concentration range of the measured mic genes in 50 environmental samples is 1.25 multiplied by 10³To 5.24X 10⁸copies L^-1. The concentrations of the mic gene copies in the environmental samples determined are given in table 3.

TABLE 3 determination of the sources, amounts, mic concentrations, MIB contents of environmental samples

Example 6 determination of MIB content of environmental samples

Respectively and accurately measuring 10mL of 50 environmental samples in example 5, respectively placing the environmental samples in 15mL extraction bottles corresponding to the environmental samples, adding high-grade pure NaCl (4.0g) dried for 4 hours at 450 ℃ into each extraction bottle, and performing gas chromatography-mass spectrometry (GC-MS) determination after uniform dissolution; measuring the content of MIB in the environmental sample; wherein the GC-MS measurement conditions are the same as those in example 2A; the measurement results are shown in Table 3.

Example 7 construction of a MIB concentration and mic Gene copy number Linear equation for environmental samples

Taking the logarithm of the copy number of the mic gene of 50 environmental samples obtained by calculation through the standard curve A in example 5 as the abscissa and the logarithm of the MIB concentration of the corresponding 50 environmental samples measured in example 6 as the ordinate, a linear equation B (standard curve B) of the concentration of the MIB in the samples and the copy number of the mic gene in the samples is established, wherein the linear equation B is shown in formula (4), and the curve is shown in FIG. 3.

As shown in fig. 3, a linear equation of the MIB concentration and the mic gene copy number concentration in the environmental sample is established with the logarithmic value of the mic gene copy number concentration (N) in the environmental sample as the abscissa and the logarithmic value of the MIB concentration (Y) in the environmental sample as the ordinate:

log10(Y)＝k1×log10(N)-b1 (3)

in equation (3): n: copy number of the mic Gene of the sample, copies L of copies of the copy of the gene, copy L of the copy of the gene of the copy of the gene of the copy of the^-1(ii) a Y: MIB concentration of the sample, ngL^-1(ii) a k 1: slope of standard curve B, k1 is 0.357; b1 is the intercept of standard curve B, B1 is 0.349; r of the standard curve B²＝0.614，p＜0.001。

From the above analysis, it can be seen that: the molecular biology detection method of the mic gene has better consistency with a MIB instrumental analysis method (GC-MS), and a linear equation of the MIB concentration and the mic gene concentration is established, so that the method can be used for evaluating the MIB concentration in the water body and early warning the MIB in the water body. The method for carrying out real-time fluorescence quantitative PCR on the environmental sample can be used for evaluating the MIB concentration of the environmental water sample.

Test example 1

Collecting a water sample of a grass sand reservoir, taking 1000mL of the water sample, filtering by adopting a 1.2-micrometer filter membrane (RTTP04700, 1.2-micrometer polycarbonate membrane, Isopore (TM), USA), and filtering and enriching blue algae cells in the water sample of the reservoir to the 1.2-micrometer filter membrane; using DNA extraction kit (FastDNA)

Kit for Soil Kit (6560 + 200, MPBio, USA)) to extract the water sample DNA of grass sand reservoir; performing real-time fluorescent quantitative PCR detection on the extracted reservoir water sample DNA to obtain a reservoir water sample Cq value; calculating according to the standard curve A to obtain the concentration (N) of the mic gene in the reservoir water sample of 5.22 multiplied by 10⁵copies L^-1(ii) a And calculating according to a linear equation B (namely the formula (4) and a standard curve B) to obtain the MIB concentration of 49.22ng/L in the reservoir water sample.

And taking 10mL of the green grass sand reservoir water sample, and carrying out GC-MS (gas chromatography-mass spectrometry) determination according to the method in the embodiment 6 to obtain the MIB concentration of 52.18ng/L in the green grass sand reservoir water sample.

The relative error between the MIB concentration measured by the method and the MIB concentration measured by an instrument method is 5.67 percent, which shows that the method can be used for measuring and evaluating the MIB concentration in the water body, and compared with the instrument analysis method, the method has the advantages of high sensitivity, short detection time, high flux and high sensitivity.

Control example primer amplification coverage verification

The specific primers designed by the method can amplify 43 existing strains of olfactory blue algae (Table 4) in NCBI database (Table 4 contains 45 strains of blue algae, and the primers designed by the invention can amplify 43 strains), and compared with the primers published at present, the primers reach the highest coverage, wherein the sequences of the primers A-G in the Table 4 are obtained from the published documents (Table 5), and the primers are synthesized by Shanghai Biotechnology Co., Ltd and are used for experiments.

TABLE 5 literature sources of primer pairs

The blue-green algae with the serial numbers of 1-12 in the table 4 are blue-green algae producing MIB in the table 1 (17 blue-green algae in the table 1, 12 plants producing MIB and 5 plants not producing MIB), are purchased from a freshwater algae seed bank of Chinese academy of sciences, and the primers A-G are verified to be common PCR and gel electrophoresis.

Since blue-green algae of numbers 13 to 45 in Table 4 cannot be purchased, the primer amplification verification method employs the following method:

respectively downloading the mic gene sequences of blue-green algae with the serial numbers of 13-45 in an NCBI database, then comparing primers A-G and the specific primers of the method with the downloaded mic gene sequences of the blue-green algae, and if the mic gene of the blue-green algae contains primer sequence fragments, considering that the primers can be used for amplification; if the mic gene does not contain the corresponding primer series fragment, the primer is not considered to be used for amplification.

And comparing the primer sequence with the sequence of the mic gene downloaded in the NCBI database, and if the mic gene contains a primer sequence fragment, determining that the amplification can be carried out.

The method for verifying the primer amplification coverage of blue-green algae with serial numbers 1-12 in the table 4 comprises the following steps:

1. extraction of blue algae DNA

Using FastDNA

Respectively extracting DNA from 12 blue algae with the serial numbers of 1-12 in the table 4 by using a Kit for Soil Kit (6560-;

2. PCR amplification

Respectively using the existing known primer pairs A-G, respectively using the blue algae DNA extracted in the step 1) as a template, carrying out conventional common PCR amplification, carrying out 1% agarose gel electrophoresis on the amplification product, wherein,

the common PCR reaction system is as follows: 2 XPCR Taq MasterMix with 12.5. mu.L dye, upstream and downstream primers 0.8. mu.L each, template DNA 2.0. mu.L, ddH₂O 8.9μL。

Primer pairs A-G are as follows:

primer pair A: MIB3313F/MIB 4226R;

MIB3313F：5′-CTCTACTGCCCCATTACCGAGCGA-3′：

MIB4226R：5′-GCCATTCAAACCCGCCGCCCATCCA-3′；

the length of the amplification product of the primer pair A is 913bp, the primer can amplify 23 strains of olfactory blue-green algae, but cannot amplify certain anabaena pseudocarp, oscillatoria, myxothrix tenuis and aphrodisias, and meanwhile, the amplification length of the primer is long, so that the primer pair A is not suitable for real-time fluorescence quantitative PCR, and the detection results of gel electrophoresis are shown in Table 4.

And (3) primer pair B: MIB3324F/MIB4050R

MIB3324F：5′-CATTACCGAGCGATTCAACGAGC-3′：

MIB4050R：5′-CCGCAATCTGTAGCACCATGTTGA-3′；

The length of the amplification product of the primer pair B is 726bp, the primer can amplify 26 strains of olfactory blue algae, but cannot amplify certain anabaena pseudobaena and coleus tenuissima, and meanwhile, the amplification length of the primer is long, so that the primer pair B is not suitable for real-time fluorescent quantitative PCR, and the detection results of gel electrophoresis are shown in Table 4.

And (3) primer pair c: MIBS02F/MIBS02R

MIBS02F：5′-ACCTGTTACGCCACCTTCT-3′；

MIBS02R：5′-CCGCAATCTGTAGCACCATG-3′：

The length of the amplification product of the primer pair c is 307bp, the primers can amplify 39 strains of olfactory blue-green algae, but cannot amplify certain anabaena pseudobaena, oscillatoria and anabrospirea, and the gel electrophoresis detection results are shown in Table 4.

And (3) primer pair D: Mibf/Mibr

Mibf：5′-ATGCCCCAAAMTATCACTGCC-3′；

Mibr：5′-GCCGCAATCTGTAGCACCAT-3′，

The length of the amplification product of the primer pair D is 864bp, the primer can amplify 33 strains of olfactory blue algae, but cannot amplify certain anabaena pseudobaena, oscillatoria and aphanotheca tenera, and meanwhile, the primer is not suitable for real-time fluorescence quantitative PCR due to long amplification length, and the detection results of gel electrophoresis are shown in Table 4.

And (3) primer pair E: MIB-Rf/MIB-Rr

MIB-Rf：5′-CGACAGCTTCTACAYCYCCATGAC-3′：

MIB-Rr：5′-CGCCGCAATCTGTAGCACCAT-3′，

The length of the amplification product of the primer pair E is 202bp, the primer can amplify 40 strains of olfactory blue algae, but cannot amplify certain anabaena pseudobaena, coleus teloticus and anabrospira pseudoflonica, and the detection result of gel electrophoresis is shown in Table 4.

And (3) primer pair F: mibC132-F/mibC132-R

mibC132-F：5′-CGYACCTGTTACGCCACCTTCT-3′；

mibC132-R：5′-TCATGGAGGTGTAGAAGCTGTCGT-3′，

The length of the amplification product of the primer pair F is 132bp, the primer can amplify 39 strains of olfactory blue algae, but cannot amplify certain anabaena pseudobaena and coleus telangilica, and the detection results of gel electrophoresis are shown in Table 4.

A primer pair G: GPPMT1/GPPR2

GPPMT1：5′-CACCTATTCACCAGTAACACATTCT-3′：

GPPR2：5′-TGGTGCGGGTTATGTTTTGGATAATC-3′，

The length of the amplification product of the primer pair G is 870bp, the primer can amplify 1 anabaena pseudocarp strain, meanwhile, the amplification length of the primer is longer, so that the primer is not suitable for real-time fluorescent quantitative PCR, and the detection results of gel electrophoresis are shown in Table 4.

TABLE 4 amplification of the mic gene of olfactory blue-green algae with the mic primer

Note: +: the primer can amplify corresponding blue-green algae; -: the primer cannot amplify corresponding blue algae.

Sequence listing

<110> ecological environment research center of Chinese academy of sciences

<120> method for evaluating concentration of 2-methylisoborneol in water body

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 226

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

gctgcgcgac agcacgacag cttctacacc tccatgacgc taatcgaccc catcggaggg 60

tacgtcctcc cagcagatct tttcttcgaa ccgcgcgtcc gtcacgcagc gttcttggcc 120

gggacggccg tcgttctggt caacgatctc ctttcggtcg ccaaagatct ggcagacgag 180

cagccaccgg tcaacatggt gctacagatt gcggcggatc ggggct 226

<210> 2

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

gacagcttct acacctccat ga 22

<210> 3

<211> 22

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

caatctgtag caccatgttg ac 22

<210> 4

<211> 2936

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

gctgcgcgac agcacgacag cttctacacc tccatgacgc taatcgaccc catcggaggg 60

tacgtcctcc cagcagatct tttcttcgaa ccgcgcgtcc gtcacgcagc gttcttggcc 120

gggacggccg tcgttctggt caacgatctc ctttcggtcg ccaaagatct ggcagacgag 180

cagccaccgg tcaacatggt gctacagatt gcggcggatc ggggcttcgc gcgtttcggt 240

gatgacggtg aaaacctctg acacatgcag ctcccggaga cggtcacagc ttgtctgtaa 300

gcggatgccg ggagcagaca agcccgtcag ggcgcgtcag cgggtgttgg cgggtgtcgg 360

ggctggctta actatgcggc atcagagcag attgtactga gagtgcacca tatgcggtgt 420

gaaataccgc acagatgcgt aaggagaaaa taccgcatca ggcgccattc gccattcagg 480

ctgcgcaact gttgggaagg gcgatcggtg cgggcctctt cgctattacg ccagctggcg 540

aaagggggat gtgctgcaag gcgattaagt tgggtaacgc cagggttttc ccagtcacga 600

cgttgtaaaa cgacggccag tgaattcgag ctcggtacct cgcgaatgca tctagatatc 660

ggatcccggg cccgtcgact gcagaggcct gcatgcaagc ttggcgtaat catggtcata 720

gctgtttcct gtgtgaaatt gttatccgct cacaattcca cacaacatac gagccggaag 780

cataaagtgt aaagcctggg gtgcctaatg agtgagctaa ctcacattaa ttgcgttgcg 840

ctcactgccc gctttccagt cgggaaacct gtcgtgccag ctgcattaat gaatcggcca 900

acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc tcactgactc 960

gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg cggtaatacg 1020

gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag gccagcaaaa 1080

ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc gcccccctga 1140

cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag gactataaag 1200

ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga ccctgccgct 1260

taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc atagctcacg 1320

ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg tgcacgaacc 1380

ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt ccaacccggt 1440

aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca gagcgaggta 1500

tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca ctagaagaac 1560

agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag ttggtagctc 1620

ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca agcagcagat 1680

tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg ggtctgacgc 1740

tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa aaaggatctt 1800

cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta tatatgagta 1860

aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag cgatctgtct 1920

atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga tacgggaggg 1980

cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac cggctccaga 2040

tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc ctgcaacttt 2100

atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta gttcgccagt 2160

taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac gctcgtcgtt 2220

tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat gatcccccat 2280

gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa gtaagttggc 2340

cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg tcatgccatc 2400

cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag aatagtgtat 2460

gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc cacatagcag 2520

aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct caaggatctt 2580

accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat cttcagcatc 2640

ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg ccgcaaaaaa 2700

gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc aatattattg 2760

aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta tttagaaaaa 2820

taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgacg tctaagaaac 2880

cattattatc atgacattaa cctataaaaa taggcgtatc acgaggccct ttcgtc 2936

Claims

1. A method for evaluating the concentration of 2-methylisoborneol in a water body is characterized by comprising the following steps:

and then, calculating according to a standard curve A to obtain the concentration N of the mic gene in the water body to be evaluated, wherein the standard curve A is shown as a formula (1):

log10(N)＝k×Cq+b (1)

and then, calculating according to a standard curve B to obtain the concentration of the MIB in the water body to be evaluated, wherein the standard curve B is shown as a formula (2):

log10(Y)＝k1×log10(N)-b1 (2)

in equation (2): n: copy number concentration of the mic gene, copies L, in the water to be evaluated^-1(ii) a Y: MIB concentration, ng L, of the water body to be evaluated^-1(ii) a k 1: the slope of the standard curve B; b1 is the intercept of the standard curve B.

2. The method of claim 1, wherein in the real-time fluorescent quantitative PCR process, the primers are MIBQSF/MIBQSR, wherein the ratio of MIBQSF: SEQ ID No. 2; MIBQSR: SEQ ID NO. 3.

3. The method of claim 2, wherein the primers MIBQSF: 5'-GACAGCTTCTACACCTCCATG A-3', respectively; the primer is MIBQSR: 5'-CAATCTGTAGCACCATGTTGAC-3' are provided.

4. The method of any one of claims 1 to 3, wherein the reaction system of the real-time fluorescence quantitative PCR is as follows: TB Green^TMPremix Ex Taq^TM12.5. mu.L of each of the specific upstream and downstream primers (MIBQSF/MIBQSR) 0.8. mu.L, template DNA 2.0. mu.L, ddH₂O8.9 μ L; the real-time fluorescent quantitative PCR amplification program comprises the following steps: the activation stage is 94 ℃ and lasts for 10 min; high temperature denaturation at 95 ℃ for 20 s; low-temperature annealing is carried out for 20s at 50 ℃; an extension phase of 72 ℃ for 20 s; the reaction was carried out for 50 cycles; the annealing phase was 95 ℃ for 10s, 65 ℃,the temperature was maintained for 60s, 97 ℃ and 1 s.

5. A method according to any of claims 1-3, characterized in that the standard curve a is plotted as follows:

A2) designing a specific primer pair MIBQSF/MIBQSR, wherein the ratio of MIBQSF: SEQ ID No. 2; MIBQSR: SEQ ID No. 3;

N＝(NA×c)/(L×M) (3)

in equation (3): n: copy number concentration of the mic Gene, copies. mu.L, of a Standard mic plasmid dilution^-1(ii) a NA: avogastron constant, 6.02X 10²³mol^-1(ii) a c: nucleic acid mass concentration, g.mu.L, of standard mic plasmid dilutions^-1(ii) a L: the base length of the constructed standard mic plasmid is bp, and L is 2936 bp; m: average molar mass per base, 660 g.mol^-1·bp^-1；

6. A method according to any of claims 1-3, characterized in that the standard curve B is plotted as follows:

B1) collecting at least 30 different environmental water samples, filtering, and collecting samples on a filter membrane after filtering to obtain environmental samples;

B6) and B) drawing a standard curve B of the concentration of the MIB in the environment water sample and the copy number concentration of the micgenes by taking the logarithmic value of the copy number concentration NN of the micgenes of the environment water sample obtained by calculation through the standard curve A in the step B4) as an abscissa and the logarithmic value of the concentration Y of the MIB in the environment water sample determined in the step B5) as an ordinate.

7. A method for evaluating the concentration of 2-Methylisoborneol (MIB) in a water body is characterized by comprising the following steps:

1) construction of Standard mic plasmids

Introducing a mic gene sequence fragment of blue-green algae into a vector by a gene cloning technology, constructing a standard mic plasmid, and determining the nucleic acid mass concentration of the constructed standard mic plasmid;

2) design of specific primers

3) preparing standard mic plasmid diluent

N＝(NA×c)/(L×M) (3)

4) Drawing a mic gene copy number standard curve A

Carrying out real-time fluorescent quantitative PCR by taking the mic plasmid in the standard mic plasmid diluent as a template DNA and the specific primer designed in the step 2) as a primer to obtain a Cq value corresponding to the standard mic plasmid diluent; and then, drawing a standard curve A of the mic gene copy number concentration of the standard mic plasmid and the Cq value of the real-time fluorescence quantitative PCR by taking the logarithmic value of the mic gene copy number concentration N of the standard mic plasmid diluent as the ordinate and the Cq value measured by the real-time fluorescence quantitative PCR as the abscissa, wherein the standard curve A is shown as the formula (1):

log10(N)＝k×Cq+b (1)

in equation (1): cq value: the Cq value of the real-time fluorescence quantitative PCR of the standard mic plasmid diluent diluted in a gradient way; n: the concentration of the copy number of the mic gene in a standard mic plasmid diluent is obtained; log10 (N): logarithmic value of the copy number concentration of the mic gene in the standard mic plasmid diluent; k is the slope of the standard curve A, and k is-0.290; b is the intercept of the standard curve, and b is 11.92.

Collecting at least 30 environmental water samples, filtering respectively, and collecting the environmental samples on the filter membrane after filtering respectively; then, respectively extracting the DNA of the environmental sample by using a DNA extraction kit to obtain the DNA of the environmental sample; then, taking the specific primer designed in the step 2) as a primer, taking the extracted environmental sample DNA as a template, and carrying out real-time fluorescence quantitative PCR to obtain a corresponding Cq value of the environmental water sample; then, bringing the determined Cq value of the environmental water sample into a standard curve A, and calculating to obtain the copy number concentration N of the micgenes in the environmental water sample;

6) determination of MIB concentration in environmental water sample

7) drawing a MIB concentration and mic gene copy number concentration standard curve B

Taking the logarithm value of the mic gene copy number concentration N of the environmental water sample obtained by calculating through the standard curve A in the step 5) as an abscissa, and taking the logarithm value of the MIB concentration Y determined in the step 6) as an ordinate, and establishing a standard curve B of the MIB concentration and the mic gene copy number concentration in the environmental water sample, wherein the standard curve B is shown as a formula (2):

log10(Y)＝k1×log10(N)-b1 (2)

in equation (2): n: copy number concentration of the micgene, copies L, in an environmental water sample^-1(ii) a Y MIB concentration of environmental water sample, ng L^-1(ii) a k 1: the slope of the standard curve B; b1 is the intercept of the standard curve B;

8) collecting and filtering a water sample of a water body to be evaluated, and collecting a sample to be evaluated on a filtered filter membrane; then, extracting the DNA of the sample to be evaluated by using a DNA extraction kit to obtain the DNA of the sample to be evaluated; then, taking the specific primer designed in the step 2) as a primer, taking the extracted sample DNA to be evaluated as a template, and carrying out real-time fluorescence quantitative PCR to obtain a Cq value of the water body to be evaluated; then, calculating according to the standard curve A to obtain the concentration N of the micgene in the water body to be evaluated; and then calculating according to the standard curve B to obtain the MIB concentration in the water body to be evaluated.