CN113943744B - Application of RCA gene of cymbidium floribundum and vector construction method thereof - Google Patents

Abstract

The invention belongs to the technical field of plant genetic engineering, and particularly discloses an application of a leaf spot art orchid RCA gene and a vector construction method thereof, wherein the RCA gene can be normally expressed by transferring the leaf spot art orchid RCA into dendrobium officinale, the polysaccharide content in the transgenic dendrobium officinale can be increased by over-expressing the RCA gene, the nucleotide sequence of the RCA gene is shown as SEQ ID NO. 1, the protein content and the soluble sugar content in the transgenic dendrobium officinale can be greatly increased by increasing the over-expressing RCA gene, the photosynthetic pigment content is increased, and the chloroplast is well developed; and the knockout protocorm cannot normally develop, and chloroplasts do not exist.

Description

Application of RCA gene of cymbidium floribundum and vector construction method thereof

Technical Field

The invention belongs to the technical field of plant genetic engineering, and particularly relates to an application of a leaf spot art orchid RCA gene and a vector construction method thereof.

Background

Chinese wild orchids are very abundant, but the wild orchids are classified in the protection range of endangered plants, and the demand of people on peculiar leaf shapes, flower types and flower colors of orchids is increasing day by day. The orchid shows a plurality of variant varieties after long-term breeding and cultivation, and is divided into two types of flower art and leaf art according to the difference of ornamental parts, wherein the spotted orchid originates from China and is gradually recognized in recent years. The leaf art refers to the relatively stable character variation of the leaves of orchid, including the change of the color and shape of the leaves. The leaf art orchid is mainly characterized in that the color of the leaf changes, and is mostly divided into three major categories of crystal art orchid, spot art orchid and line art orchid, wherein the line art orchid refers to strip-shaped art color spots with different sizes and different thicknesses, such as yellow or white, appearing on green leaves of orchid, and can be roughly divided into claw art, edge art, onyx art and middle transparent art according to the difference of the distribution positions and shapes of lines. There are many reasons for the development of leaf processes, such as environmental changes, virus invasion, certain nutritional deficiencies, etc., which cause mosaic streaks on leaves, and thus different "process" directions.

Rubisco (ribulose-1, 5-diphosphate carboxylase/oxygenase) is rich in content in plant leaves and has important effects on regulating plant pigments, photosynthesis carbon assimilation and photorespiration, yellow or white strip-shaped art color patches with different lengths and different thicknesses appear on the leaves in the phyllotaria maculata, the gene is in a down-regulated expression form, the existing research shows that the expression of Rubisco activity depends on the regulation effect of RCA, Rubisco can only show carboxylation or oxygenation activity under the effect of RCA, and the research and application of RCA (Rubisco activase) gene for regulating Rubisco gene expression in the phyllotaria maculata become a research direction and no relevant report is found at present.

Disclosure of Invention

The main purpose of the invention is to provide a gene fragment of the leaf spot orchid RCA gene which can obviously influence the growth of the dendrobium officinale, the nucleotide sequence is shown in SEQ ID NO. 1, the gene fragment is normally expressed in the dendrobium officinale, and the growth and the development of the dendrobium officinale and the synthesis of polysaccharide are promoted.

The invention also aims to provide a dendrobium officinale plant model, which is used for forming a chlorophyll-free body of the dendrobium officinale after knocking out the RCA2 gene, and providing a reference for gene editing and new variety breeding of orchids, wherein a specific RCA2 gene nucleotide sequence is shown as SEQ ID NO:2, and is a homologous RCA gene obtained in the dendrobium officinale by comparing with the RCA gene sequence of the cymbidium floribundum.

The invention also provides a recombinant vector of the gene and a construction method of the recombinant vector, which comprises the following steps,

(1) amplifying the RCA gene of the cymbidium floribundum;

comparing RCA gene sequences obtained from the transcriptome, finding that the RCA gene sequences have 5 ', amplifying 3' by using RACE technology to obtain full-length gene fragments; obtaining a homologous gene RCA2 of RCA in the dendrobium officinale according to the comparison result of the RCA gene of the phyllotaxis orchid in NCBI;

(2) constructing an overexpression vector pCAMBIA1300-35S-RCA and a knockout vector pCAMBIA1300DM-OsU6-Cas 9;

designing a primer according to the RCA gene of the phyllotaxis art orchid, cloning the gene by using high-fidelity enzyme, performing double digestion on a pCAMBIA1300-35S vector by using the gene, carrying out complementary cohesive ends on the obtained full-length sequence and the vector sequence, recovering the obtained vector fragment, performing in-vitro homologous recombination reaction with a PCR product of the RCA, transforming escherichia coli, selecting a single colony for identification, screening a recon through digestion identification, constructing a recombinant vector pCAMBIA1300-35S-RCA expressed by a plant, and then obtaining a recombinant plasmid;

designing 2 CRISPR target sites according to a cds sequence of an RCA2 gene obtained by homologous comparison, designing according to two selected target sites, carrying out enzyme digestion on a vector by BsaI, connecting with a small fragment annealed with the target site, carrying out PCR amplification by using a primer with the BsaI enzyme digestion site, obtaining a gRNA expression cassette containing the target site, recovering the amplified target site fragment, carrying out enzyme digestion by BsaI, connecting with a Cas9 vector obtained by BsaI enzyme digestion, carrying out member knockout on the vector pCAMBIA1300DM-OsU6-Cas9, electrically transforming a connected product into competent cells of escherichia coli, coating a kanamycin-resistant plate for culture, selecting a single colony, carrying out screening of positive cloning, and obtaining the constructed knockout plasmid.

Further, in the step (2), 2 CRISPR Target sites are Target 1: ATCCAT GGGAGACTCACCGC, respectively; target 2: TGATCAATC AGATGACCAGC; the joint primers of the Target sites are respectively Target 1F: GCCGATCCATGG GAGACTCACCGC, respectively; target 1R: AAACGCGG TGAGTCTCCCATGGAT, respectively; target 2F: GTTGTGATCAATCAGATGACCAGC, respectively; target 2R: AAACGCTGGTCATCTG ATTGATCA are provided.

The RCA gene is cloned from leaf spot art orchid by using an RACE method, the homologous gene RCA2 of the RCA gene in the dendrobium officinale is obtained by comparing the sequences, the overexpression and the knockout expression are carried out in the dendrobium officinale, the RCA gene is transferred into wild type dendrobium officinale by a similar leaf disc (protocorm) conversion method, the experimental result shows that the RCA gene can be normally expressed in the overexpression transgenic dendrobium officinale, the growth condition of the transferred overexpression RCA gene is more robust than that of a control plant, the overexpression RCA gene can greatly improve the protein content and the soluble sugar content in the transgenic dendrobium officinale, the photosynthetic pigment content is increased, and the chloroplast is well developed; and the knockout protocorm cannot normally develop, and chloroplasts do not exist.

Description of the drawings:

FIG. 1 shows the gel electrophoresis display before and after RCA gene amplification (A: RCA gene 3 'end PCR product, M: maker 2000 bp; 3: 3' RACE product B: RCA gene full-length amplification, M: maker10000 bp; 1: RCA gene full-length);

FIG. 2 is a schematic diagram: the over-expression vector PCR verifies the gel electrophoresis display picture;

FIG. 3: constructing a display picture by the gene knockout recombinant vector;

FIG. 4: overexpression transformation of the protocorm of the dendrobium officinale (A: infection; B: air drying after infection; C: co-culture; D: screening culture; E: proliferation and differentiation culture; F: differentiation and rooting culture);

FIG. 5: knocking out transformed dendrobium officinale protocorm (A: treatment of protocorm; B: infection of protocorm; C: co-culture; D: transferring to screening culture; E: screening; F: screening post-culture);

FIG. 6 shows the PCR detection of transgenic positive plants (A is overexpression, B is knock-out, M: DL2000, 1: wild type plants, 2: positive control, and the rest are transgenic plants);

FIG. 7 shows the morphology of transgenic and wild type plants (A, B, C for transgenic plants; CK for wild plants);

FIG. 8: a comparison graph of the content of photosynthetic pigments in leaves of wild type and transgenic dendrobium officinale plants;

FIG. 9: comparing soluble protein content and sugar content in leaves of wild type and transgenic dendrobium officinale plants;

FIG. 10: a contrast image of development conditions of chloroplasts in a wild type, an overexpression and a knockout protocorm IS observed by a transmission electron microscope (A, B, C IS the wild type, D, E, F IS the overexpression, G, H, I IS the knockout, Ch represents the chloroplast, CW represents the cell wall, M represents the mitochondrion, O represents the hungry granule, IS represents the cell gap, GL represents the basal granule layer, SG represents the starch granule and N represents the cell nucleus).

Detailed Description

In order to clearly understand the technical spirit and the advantages of the present invention, the applicant below describes in detail by way of example, but the description of the example is not intended to limit the technical scope of the present invention, and any equivalent changes made according to the present inventive concept, which are merely in form and not in material, should be considered as the technical scope of the present invention.

To avoid unnecessary detail, the following examples will not describe the known art in detail. Unless defined otherwise, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

The test reagent consumables used in the following examples are all conventional biochemical reagents unless otherwise specified; the experimental methods are conventional methods unless otherwise specified.

Example 1

Firstly, constructing recombinant vectors pCAMBIA1300-35S-RCA and pCAMBIA1300DM-OsU6-Cas9 of RCA

pCAMBIA1300-35S-RCA is a recombinant plant overexpression vector, the pCAMBIA1300-35S-RCA plant expression vector contains RCA genes of cymbidium maculatum, and the starting vector is pCAMBIA 1301. pCAMBIA1300DM-OsU6-Cas9 is a knockout vector and contains a homologous gene RCA2 gene of the RCA gene of the cymbidium floribundum in dendrobium officinale.

The pCAMBIA1300-35S-RCA plant expression vector obtained by the invention contains a 35S promoter, and is followed by an RCA gene. pCAMBIA1300DM-OsU6-Cas9 contains a promoter U6, and uses a homologous gene RCA2 gene of the leaf cymbidium RCA gene in dendrobium officinale as a knockout target gene.

The RCA gene is obtained by RACE technology on the basis of EST sequence in transcriptome data constructed by people and is named RCA, the nucleotide sequence is shown as SEQ ID NO:1, ORF Finder analysis shows that the RCA gene has a long and complete open reading frame with 1317bp total, an initiation codon is ATG, a termination codon is TAG, and 541 amino acids total are coded. The overall average hydrophilicity of the protein analyzed by ExPASy was-0.285, indicating that the protein is a hydrophilic protein. The nucleotide sequence of the homologous gene of the leaf-orchids RCA gene obtained after the RCA2 gene is compared with the sequence is shown as SEQ ID NO. 2.

Secondly, the recombinant vectors pCAMBIA1300-35S-RCA and pCAMBIA1300DM-OsU6-Cas9 are constructed by the following method:

(1) amplification of RCA gene of cymbidium floribundum

Comparing RCA gene sequences obtained from the transcriptome of people, finding that the RCA gene sequences have 5 ', amplifying 3' by utilizing RACE technology to obtain full-length gene sequences.

PCR primer

Primers were designed based on RCA gene fragments obtained in our transcriptome:

B26：5’-GACTCTAGACGACATCGATTTTTTTTTTTTTTTTT-3’；

RCA-1：5’-GTTCAGCTCCCAGGTCTATACAACA-3’；

RCA-2：5’-AACCCACTTTCTCACTTCATCATCATAC-3’。

secondly, PCR is carried out by using the reverse transcription product, and the system is as follows: 10xPCR buffer 2.5ul, dNTP mix (10mM)2.5ul, RCA110.5 ul, B260.5 ul, cDNA 1.5ul, Taq plus0.25ul and H2O 16.25.25 ul, total capacity 25 ul;

PCR reaction procedure is as follows: pre-denaturation at 96 ℃ for 5 min; denaturation at 94 ℃ for 30sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 2min, 35 cycles; extension was carried out at 72 ℃ for 10min and the reaction was stopped at 4 ℃.

Fourthly, the same system and reaction program are adopted, the RCR product of the first round is taken as a template to carry out the second round of PCR, and the primers are RCA-2 and B26.

Linking the obtained fragment with pMDl8-T, and performing sequence determination after enzyme digestion identification.

Splicing the full-length cDNA of the target gene according to the determined sequence and the overlapping region thereof, and respectively designing a primer RCA-3: 5'-CAAGGTCCCCCTCATTTTGGGTGTT-3' and RCA-4: 5'-CTCATTTTGGGTGTTTGGGGAGGCA-3' are provided. The full-length sequence was amplified by PCR for further validation. As shown in FIG. 1, the target gene fragment was clear and the size was consistent with the expected result.

(2) Construction of RCA gene plant overexpression vector pCAMBIA1300-35S-RCA and knockout vector pCAMBIA1300DM-OsU6-Cas9

Designing a primer according to the RCA gene of the leaf art orchid (RCA-BamHIF (5 '-3'): TCTGATCAA GAGACAGGATCCATGGCCTCCTCTGTTTCAAC; RCA-SalIR (5 '-3'): CATCGGTGCACTAGTGTCGACCTAACGATAGAA AGATCCAG), cloning the gene by using high-fidelity enzyme, carrying out double enzyme digestion on pCAMBIA1300-35S vector by using BamHI and SalI, carrying complementary cohesive ends on the obtained full-length sequence and the vector sequence, recovering the obtained vector fragment, carrying out in-vitro homologous recombination reaction with a PCR product of the RCA, transforming escherichia coli, screening recombinants by enzyme digestion identification, and constructing a recombinant vector pCAMBIA1300-35S-RCA expressed by a plant, and then obtaining a recombinant plasmid. The target gene fragment is clear, the size of the target gene fragment is consistent with the expected result (1317bp), a non-specific amplification band does not exist, and an overexpression vector is successfully constructed; FIG. 2 is a diagram of an overexpression vector.

Designing 2 CRISPR Target sites (Target 1: ATCCAT GGGAGACTCACCGC; Target 2: TGATCAATCAGATGACCAGC) according to a cds sequence of the dendrobium officinale RCA2 gene obtained by homologous comparison, and designing a joint primer of the Target sites according to the two selected Target sites:

Target 1F：GCCGATCCATGG GAGACTCACCGC；

Target 1R：AAACGCGGTGAGTCTCCCATGGAT；

Target2F：GTTGTGATCAATCAGATGACCAGC；

Target2R：AAACGCTGGTCATCTG ATTGATCA；

And digesting and knocking out the vector by BsaI enzyme, then connecting the vector with a small fragment annealed by a target site, and then carrying out PCR amplification by using a primer with a BsaI enzyme digestion site to obtain a gRNA expression frame containing the target site. And recovering the amplified target site fragment, carrying out enzyme digestion by BsaI, connecting the target site fragment with a Cas9 vector obtained by the enzyme digestion of BsaI, electrically transforming the connected product into competent cells of escherichia coli, coating a kanamycin resistant plate for culture, and selecting a single colony for screening positive clones to obtain the constructed knockout plasmid. The target gene fragment is clear, the size of the target gene fragment is consistent with the expected result (432bp), and the knockout vector is successfully constructed; FIG. 3 is a schematic of the knock-out vector construction.

Genetic transformation of agrobacterium and detection of transformant

Competent cells of Agrobacterium were prepared, the above-constructed plant expression vectors pCAMBIA1300-35S-RCA and pCAMBIA1300DM-OsU6-Cas9 were transferred to Agrobacterium (EHA105) by electric pulse method, and transformant colonies were screened on a hygromycin-added plate. The lysate of the agrobacterium colony is used as a template of PCR reaction, specific primers RCA-BamHIF and RCA-SalIR of RCA gene and Target 2F and Target 2R are used for PCR detection, and the colony of the transformant confirmed by colony PCR is used for transforming plants.

Fourthly, transforming plants by agrobacterium of plant overexpression and knockout vectors containing RCA genes

Single agrobacterium colony carrying plasmids pCAMBIA1300-35S-RCA and pCAMBIA1300DM-OsU6-Cas9 is inoculated into liquid culture medium for culture, and bacteria are collected by centrifugation and suspended by MS liquid culture medium. Infecting plant tissue which is easy to differentiate with suspended agrobacterium, obtaining transgenic plantlets through tissue culture, obtaining transgenic plants through screening by using antibiotics, wherein the flow of overexpression genetic transformation is shown in figure 4, the flow of knockout transformation genetic transformation is shown in figure 5, and obtaining positive plants or protocorms.

Fifth, detection of insertion of RCA gene in transgenic plants

To confirm that the transgenic plants obtained by screening with antibiotic (hygromycin) did contain the RCA gene, the screened transgenic plants were further characterized using the 2XT5 Direct PCR Kit (Plant) Kit. Firstly, genome DNA of a transgenic plant is extracted, and then a hygromycin specific primer (HygR F: ACGCGTCGACA TGTCTAAGGGCGAGGAACTC; HygR R: GGACTAGTTTATTTATAGAGTTCGTC CAT) is used as a template for PCR detection to identify whether the plant is a positive plant, wherein the identification result is shown in figure 6. Sixth, transgenic plant morphology and physiological index change experiment

Culturing transgenic and control wild protocorms in a culture medium to form seedlings, wherein the plant dendrobium officinale plants over-expressing RCA genes grow vigorously, and measuring various physiological indexes to obtain the measuring results of figures 7, table 1, table 2, figure 8, figure 9 and figure 10; the contents of protein and soluble sugar of plants with over-expressed RCA gene are increased, and the GC-MS technology is adopted to detect the components of saccharide substances, the result shows that compared with wild dendrobium, the contents of sucrose, arabinose, rhamnose, fucose, inositol, sorbitol, xylitol and maltose of the over-expressed plants are increased, which shows that the over-expression of the RCA gene influences the sugar metabolism path in dendrobium, plays an important role in the process of photosynthetic carbon assimilation, and promotes the synthesis and accumulation of organic matters of main sugar metabolites.

TABLE 1 detection of Positive plant morphological indices

TABLE 2 RCA Gene-transferred plant carbohydrates

Substance(s)	Class of matter	WT	RCA	Type
					Maltose	Disaccharides	0.193±0.005a	0.382±0.139a	up
Sucrose	Disaccharides	19.420±1.990a	20.559±1.486a	up
					Trehalose	Disaccharides	0.656±0.048a	0.491±0.027b	down
D-arabinose	Monosaccharides	0.225±0.056a	0.260±0.030a	up
					D-fructose	Monosaccharides	10.051±1.443a	5.197±0.726b	down
L-fucose	Monosaccharides	0.083±0.005B	0.139±0.008A	up
					D-galactose	Monosaccharides	0.536±0.042a	0.499±0.046a	down
Glucose	Monosaccharides	28.006±4.401a	17.239±2.809a	down
					Inositol	Monosaccharides	1.850±0.212a	2.533±0.541a	up
L-rhamnose	Monosaccharides	0.309±0.009a	0.310±0.005a	up
					D-sorbitol	Monosaccharides	0.015±0.0001a	0.019±0.004a	up
Xylitol, its preparation method and use	Monosaccharides	0.012±0.0003a	0.013±0.0002a	up

<110> Yunnan university of agriculture

Application of <120> leaf spot art orchid RCA gene and vector construction method thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1317

<212> DNA

<213> leaf spot art orchid (Cymbidium)

<400> 1

atggcctcct ctgtttcaac tgtgggggcc gtcaatagag taccactcag cttgcatggc 60

tcaggctcag gagtttcagc accaagctca gcaatcttcg gcaacagctt gaagaaggtg 120

aactcaggcg ttagccatgg aaggatctct actgcgacgt tcaaagtcat ggcagctgat 180

caggatgaat caaagcagac taagacggac aggtgggccg ggcttgccta tgacatatca 240

gatgaccagc aggacattac cagaggaaag ggaatggtgg actccctctt ccaagctccc 300

atgggtgatg gaactcatgt tgctgtcatg aactcctatg agtacataag ccagggcctc 360

cgacaataca agctcgacaa cacaatagat ggtttttata ttgctccagc tttcatggac 420

aagcttgttg tgcacatcag caagaacttc atgaccctgc ccaatatcaa ggtccccctc 480

attttgggtg tttggggagg caaaggacag ggaaaatctt tccaatgcga gcttgtgttt 540

gccaagatgg gtataaaccc aatcatgatg agcgctggag aactagaaag cggaaatgct 600

ggagagcctg caaaattgat aagacagaga taccgcgagg ccgctgatat cataaagaaa 660

ggaaaaatgt gctgcctctt cataaatgac cttgacgcag gagcaggcag gatgggaggc 720

actacacagt acactgttaa caaccaaatg gttaatgcca cccttatgaa catcgctgat 780

agccccacca acgttcagct cccaggtcta tacaacaaac aggagaatcc aagagttcct 840

attatcgtca ctggaaacga cttctccacc ttgtatgccc ctctcattcg tgatggtcgc 900

atggagaaat tctactgggc gccgaccaga gaggacagga ttggtgtttg tctgggaatt 960

ttcagaactg acaatattcc tcaggaagac atcgtcaagc ttgttgatac cttcccaggc 1020

cagtccattg acttcttcgg tgctctcagg gcgagagtgt atgatgatga agtgagaaag 1080

tgggttgaaa aagttggggt tgatttggtt gggaagaagc ttgtgaactc gcgagagggg 1140

cctccgaatt tcgaacagcc gaaaatgacc gttgagaagc tccttgagta cggtaacatg 1200

ttggtgaagg agcaggagaa cgtgaagagg gtgcagctgg ctgacaagta cttaagcgaa 1260

gctgctcttg gagatgccaa tgaagatgcc atgaagactg gatctttcta tcgttag 1317

<210> 2

<211> 1730

<212> DNA

<213> Dendrobium officinale (Dendrobium officinale)

<400> 2

acatgggaca ctgttcttaa ataagcctcc catatcttcg gtgcgcttaa tccacaggat 60

cttcttccct caccttcagc tatggccacc gccgtctcga ccatcggagc tgtcaaccga 120

gttccattgc agcttacctt acatggctcg ggctcggcaa cttcagctcc gagctcaacc 180

ttctttggca acaacttgaa gaaggttaac caaagtatca tccatgggag actcaccgct 240

ggaaccttca aggtcttggc tgctgacctc gacgagacga agcagactca gaaggacagg 300

tggggtgggc ttgcctatga tcaatcagat gaccagcagg acataaccag aggaaagggg 360

atggtggact ccctcttcca agctcccatg ggagatggaa cccatgttgc tgtcatgaat 420

tcctatgagt acctcagcaa aggtcttcgc acgtacaatc tggacaacac agtggatggt 480

ttttacatag ctccagcttt catggacaag cttgttgtac acatcactaa gaatttcatg 540

actttgccta atatcaaggt acccctcatt ttgggcgttt ggggaggcaa aggtcaggga 600

aagtccttcc aatgtgaact tgtatttgct aagatgggaa tcaacccaat catgatgagc 660

gctggagaac tcgaaagcgg caatgcagga gagcctgcaa aattgatcag acaaagatat 720

cgcgaggctg cagagatcat caagaaggga aaaatgtgtt gcctcttcat caatgatctt 780

gatgcaggag caggaaggat gggaggcacc acccagtaca ctgttaacaa ccaaatggtg 840

aatgccaccc tcatgaatat cgccgataac ccaacgaatg ttcagctccc cggactgtat 900

aacaagcagg agaatgctag agttcctatt atagtcactg gtaatgattt ctccactttg 960

tatgcccctc ttattcgaga tggtcgtatg gagaaattct actgggcacc aactagagaa 1020

gacagaattg gtgtctgcat tggcatcttc agaactgata atattgctca ggaagacatt 1080

gtgaagcttg ttgacacttt cccaggccag tccattgatt tctttggagc actaagggcc 1140

agagtctatg atgatgaagt gagaaagtgg attgaggatg ttggagttga cagggttggg 1200

aagaggcttg tgaattcccg cgagggacct ccgacattcg agcagcctaa gatgagcttg 1260

gagaagctgc ttgagtatgg aaacatgctg gtccaggagc aggagaatgt gaagagggtg 1320

cagctggctg acaagtattt gagtgaagct gcgcttgggg atgccaatga agatgctatg 1380

aagactggtt ctttctatgg ttagctctta aaccctcggg cactggccgg aggtaaagga 1440

gctcagcaag tgcagattcc tgtccctgaa ggttgcactg atccgcaggc aaagaacttt 1500

gatcccactg cgaggagtga taatggaagt tgcacataca ttgcctagag ttcctagttg 1560

tcttttgtgg aaactataag gatgcagtgt tttctggtag agtaagggtg cactaattaa 1620

tttgtacaac tccatgtcta gatgcatgta atttttctgt gcttcactgc atgaagcctt 1680

tgtattgtta tcaaatgctc tatttataca ttatattcac aaaaaaaaaa 1730

Claims (1)

1. The application of the RCA gene of the cymbidium floribundum is characterized in that the RCA gene in the transgenic dendrobium officinale can be normally expressed, the content of saccharides in the transgenic dendrobium officinale can be increased by over-expressing the RCA gene, and the nucleotide sequence of the RCA gene is shown as SEQ ID NO. 1; the saccharide is maltose, sucrose, D-arabinose, L-fucose, inositol, L-rhamnose, D-sorbitol or xylitol.

Images