CN111593067A - Construction and application of plant expression vector of F3'5' H gene of phyllanthus floridulus - Google Patents
Construction and application of plant expression vector of F3'5' H gene of phyllanthus floridulus Download PDFInfo
- Publication number
- CN111593067A CN111593067A CN202010560539.8A CN202010560539A CN111593067A CN 111593067 A CN111593067 A CN 111593067A CN 202010560539 A CN202010560539 A CN 202010560539A CN 111593067 A CN111593067 A CN 111593067A
- Authority
- CN
- China
- Prior art keywords
- gene
- vector
- plant
- transgenic
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/0004—Oxidoreductases (1.)
- C12N9/0071—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14)
- C12N9/0073—Oxidoreductases (1.) acting on paired donors with incorporation of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen 1.14.13
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/66—General methods for inserting a gene into a vector to form a recombinant vector using cleavage and ligation; Use of non-functional linkers or adaptors, e.g. linkers containing the sequence for a restriction endonuclease
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/825—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving pigment biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y114/00—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14)
- C12Y114/13—Oxidoreductases acting on paired donors, with incorporation or reduction of molecular oxygen (1.14) with NADH or NADPH as one donor, and incorporation of one atom of oxygen (1.14.13)
- C12Y114/13088—Flavonoid 3',5'-hydroxylase (1.14.13.88)
Abstract
The invention discloses a special plant expression vector pCAMBIA1301-35S-F3'5' H containing 3',5' -hydroxylase gene (F3'5' H) of cymbidium floribundum and capable of improving the content of plant anthocyanin. The invention clones F3'5' H gene from leaf spot art orchid by RACE method, uses 35S promoter to over-express in Dendrobium officinale, and transfers it into wild type Dendrobium officinale by similar leaf disc (protocorm) transformation method. Experimental results show that the F3'5' H gene in the transgenic dendrobium officinale can be normally expressed, the transgenic plant is stronger when the growth condition of the F3'5' H gene is transferred than that of a control plant, the stem and the leaves show purplish red, the F3'5' H enzyme activity in the transgenic dendrobium officinale can be greatly improved and increased by over-expressing the F3'5' H gene, the protein content and the soluble sugar content are increased, and the anthocyanin and flavonoid substance content is increased. The result shows that the leaf spot art orchid F3'5' H gene has a promoting effect on the growth and development of the dendrobium officinale, and promotes the synthesis of flavonoid and anthocyanin, so that the plant is purple red and develops color.
Description
Technical Field
The invention belongs to the field of plant genetic engineering, and particularly relates to a plant expression vector pCAMBIA1301-35S-F3'5' H of flavonoid 3',5' -hydroxylase gene F3'5' H, a construction method thereof and application thereof in transgenic plants.
Background
The leaf (line) art orchid (line art orchid) refers to a general name of Chinese orchids with golden yellow, silvery white, dark green, vermilion or black mouth, edge, point, line and spot inlaid on leaves of orchidae (orchidae) orchid plants, and can be roughly divided into line art orchid, spot art orchid and crystal art orchid, and different color and shape variation types such as leaf butterfly also appear along with the deep appreciation and understanding of orchid leaf art. The variety of the cymbidium sinense has the most number of cymbidium sinense (such as 'white black of leaf art', 'silver dragging cymbidium', 'dalomo', 'lightning', 'solar direction', 'lucky jade', 'large stone door'), the second time of cymbidium sinense (C.goeringii), cymbidium faberi and cymbidium kanran (C.kanran), the cultivation history of the cymbidium sinense has been known for thousands of years, and the cymbidium sinense is known as 'monarch of flower' and is a precious ornamental flower. The leaf (line) art is popular in Japan for the first time, and with the advent of the leaf (line) art orchid 'Jiajiayu' the Japan orchid world raises a hot tide for pursuing the variety of the leaf art orchid, and forms the extremely hot leaf (line) art orchid market atmosphere, for example, the 'Ruiyu' of the leaf (line) art variety of Maolan in the 40 th generation has a selling price of 5 ten thousand yen (3 seedlings), the 'Helichua' in the 60 th generation has a selling price of 650 ten thousand yen (7 seedlings), and the 'Damomao' is more $ 20-30 million dollars per seedling. In recent decades, leaf (line) art is popular in the continents of our country, although it starts late, it develops rapidly, and various types of variation, such as flowers, leaves and dwarf seeds, emerge endlessly. When the orchid is not in use, the orchid is difficult to trade and is easy to generate disputes, the leaf art orchid is mainly based on leaf observation and can be identified by leaf shape, leaf state, color and the like, the commodity value can be increased by times or even hundreds of times according to different line art types, and the market prospect is very wide.
At present, the biosynthesis pathway of flavonoid substances participating in flower color formation is relatively clear. 4-Coumaryl-coenzyme A (coumaroyl-coenzyme A) is a precursor for the synthesis of class 3 anthocyanin glycosides in the flavonoid synthesis pathway, which is capable of synthesizing 4,2 ', 4 ', 6 ' -tetrahydroxystyryl ketone (tetrahydroxychalcone) under the catalysis of chalcone synthase (CHS). 4,2 ', 4 ', 6 ' -tetrahydroxystyrene is catalyzed by chalcone isomerase (CHI) to synthesize colorless naringenin. Naringenin can be catalyzed by flavanone-3-hydroxylase (F3-hydroxyrase, F3H) to Dihydrokaempferol (DHK), which is catalyzed by flavonoid-3 '-hydroxylase (F3' H) to generate Dihydroquercitrin (DHQ). Flavonoid-3 ',5' -hydroxylase (flavanoid 3',5' -hydroxyylase, F3'5' H) catalyzes DHK to produce Dihydromyricetin (DHM) (step a). Quercus dihydroquercetin (quercus dihydroflavonol) flavone generates cyanidin (cyaniding 3-O-glucoside, Cy) from red to purple under the action of dihydroxyflavone reductase (DFR), anthocyanin synthase (ANS) or 3-glucosyltransferase (3 GT) enzyme. Dihydromyricetin can generate delphinidin 3-O-glucoside (Dp) with a bluish purple color under the catalytic action of the three enzymes [24 ]. The F3'5' H gene plays an important role in regulating and controlling the synthesis of anthocyanin, so the research on the leaf spot art orchid F3'5' H gene can change the variety or the content of the anthocyanin so as to directionally improve the leaf color.
Currently, the F3'5' H gene sequence has been cloned from plants such as tomato (Solanumlycopersicum), african violet (sainpauliandian ahh. wendl.), eustoma grandiflorum (eustoma grandiflorum), eggplant (daturastramonum), epimedium sagittatum (sieb. et. Zucc.) and vitis amurensis rupr. At least 38 plant sequences of about 58F 3'5' H genes have been published on the NCBI website. The total RNA is extracted from the tender bud of the 'Zhuanwu' tuber by Yang Xiaona and the like, and is cloned to a cDNA sequence (GenBank accession number is HQ860267) of F3'5' H by RT-PCR, the molecular weight of an expression protein obtained by SDS-PAGE is about 55kDa, the full length of a gene is 1518bp, the length of a coding region is 1485bp, and 494 amino acids are coded in total. The key gene SrF 3'5' H of the flavonoid biosynthetic pathway is cloned from yellow calyx of the strelitzia reginae by RT-PCR and RACE methods, the total length of the cDNA is 1766bp, the cDNA has a complete Open Reading Frame (ORF), 1509 basic groups are totally encoded, 503 amino acids are encoded, and the transcription level of the SrF 3'5' H reaches the highest level at the initial flowering stage by applying semi-quantitative PCR analysis. Nakatsuka et al successfully reduced the expression of F3'5' H gene in gentian plants and altered the flower color of gentian plants by antisense suppression. Holton et al studied the F3'5' H gene of petunia, and found that the F3'5' H enzyme can catalyze dihydroquercetin and dihydrokaempferol to produce dihydromyricetin. Toguri et al also studied petunia and found that the F3'5' H gene was not expressed in leaves and was expressed in a high amount in the middle of bud development. By a transgenic technology, the phalaenopsis F3'5' H is introduced into lily, and the DFR color-assisting gene is introduced at the same time, so that the blue lily is finally obtained. Bruqlieera et al introduced violet F3'5' H gene into chrysanthemum to obtain light blue chrysanthemum. Xubi jade and the like transfer the F3'5' H gene of petunia into lilium formosanum to obtain a transgenic plant, and Wang and the like find that the F3'5' H gene of phalaenopsis can be detected only in the flower color stage and is not expressed in roots, leaves and other organs. The white blue and the like clone, express and immunologically identify the F3'5' H gene in the transgenic carnation.
Chandler et al introduced petunia F3'5' H gene and DFR gene into white carnation to obtain blue carnation, and successfully put it on the market. The cDNA sequence of wild buckwheat rhizome F3'5' H gene is obtained by transcriptome sequencing of plum light, etc., and the wild buckwheat rhizome F3'5' H gene belongs to cytochrome P45078A 10 family by the analysis of evolutionary tree. The royal jelly and the like clone F3'5' H gene full-length cDNA from blue petunia petals and successfully construct an expression vector of F3'5' H gene driven by a flower-specific promoter PchsA. However, the current research on the leaf F3'5' H gene of cymbidium bicolor has not been reported yet.
Disclosure of Invention
The invention aims to provide a plant expression vector of flavonoid 3',5' -hydroxylase gene for improving the content of plant anthocyanin, which is a plant expression vector containing the flavonoid 3',5' -hydroxylase gene F3'5' H. Meanwhile, a construction method of the vector and application of the vector in improving the content of plant anthocyanin are provided.
In order to achieve the above purpose of the present invention, the present invention provides the following technical solutions:
a recombinant vector contains a 3',5' -hydroxylase gene, namely F3'5' H gene, of the flavonoid of the cymbidium floribundum, wherein the nucleotide sequence of the F3'5' H gene is shown as SEQ ID NO: 1.
Further, the starting vector for constructing the plant expression vector was pCAMBIA 1301.
Furthermore, the recombinant vector is pCAMBIA1301-35S-F3'5' H, and a promoter 35S is linked to the starting vector pCAMBIA1301, followed by the F3'5' H gene.
Further, the invention also provides a construction method of the recombinant vector, which comprises the following steps:
(1) amplification of the F3'5' H Gene of cymbidium floribundum
Comparing the F3'5' H gene sequence obtained from the transcriptome, finding that the F3'5' H gene sequence has 5', amplifying 3' by using RACE technology to obtain a full-length gene fragment;
(2) TA cloning of the F3'5' H Gene
Recovering a coding region gene fragment of F3'5' H, connecting the coding region gene fragment to a pMD18-T vector, extracting plasmid DNA by adopting an alkaline lysis method, obtaining a recombinant plasmid pMD-F3'5' H through PCR detection and enzyme digestion detection, screening positive clones, enriching a bacterial liquid, and extracting a plasmid;
(3) construction of F3'5' H gene plant expression vector pCAMBIA1301-35S-F3'5' H
Carrying out double enzyme digestion on the recombinant plasmid pMD-F3'5' H by using NcoI and BstEII, and recovering a band containing the full length of F3'5' H after enzyme digestion; then, NcoI and BstEII are used for enzyme digestion of pCAMBIA1301 vectors, obtained vector fragments are recovered, complementary cohesive ends are carried on obtained full-length sequences and vector sequences, the two are connected, escherichia coli is transformed, recombinants are screened out through enzyme digestion identification, and the plant-expressed recombinant vector pCAMBIA1301-35S-F3'5' H is constructed. Preferably, the amplification of the cymbidium floribundum F3'5' H gene in the step (1) specifically comprises the following steps:
(ii) PCR primer
The following primers were designed based on the F3'5' H gene fragment obtained in the transcriptome,
B26：5’-GACTCTAGACGACATCGATTTTTTTTTTTTTTTTT-3’；
F3′5′H1：5’-CTCTCAGCATACCTCACTACGCCTC-3’；
F3′5′H2：5’-GTTCCCAAGAAATACTGCACCATCA-3’；
② PCR was carried out using the above reverse transcription product in the following system, 10xPCR buffer2.5ul, dNTP mix (10mM)2.5ul, F3'5' H10.5ul, B260.5ul, cDNA1.5ul, Taq plus0.25ul and H2O16.25ul, total capacity 25 ul;
PCR reaction procedure is as follows: pre-denaturation at 96 ℃ for 5 min; denaturation at 94 ℃ for 30sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 2min, 35 cycles; extending for 10min at 72 ℃, and stopping the reaction at 4 ℃;
fourthly, the same system and reaction program are adopted, the RCR product obtained in the third step is used as a template to carry out second round PCR, and the primers are F3'5' H2 and B26;
connecting the obtained fragment into pMDl8-T, and performing sequence determination after enzyme digestion identification;
sixthly, splicing the full-length cDNA of the target gene according to the determined sequence and the overlapping region thereof, and respectively designing a primer F3'5' H3: 5'-CGTTCGGAGCGGGGCGGAGGATTTGC-3' and F3'5' H4: 5'-CGGGAAGTTAATGGGGATGCTGATGG-3', PCR full-length sequences were amplified for further validation.
Furthermore, the recombinant vector constructed by the construction method is mainly applied to preparation of agrobacterium transgenic plants.
Further, the recombinant vector prepared by the invention is applied to preparation of agrobacterium tumefaciens transgenic dendrobium officinale.
The invention clones F3'5' H gene from leaf spot art orchid by RACE method, uses 35S promoter to over-express in Dendrobium officinale, and transfers it into wild type Dendrobium officinale by similar leaf disc (protocorm) transformation method. Experimental results show that the F3'5' H gene in the transgenic dendrobium officinale can be transcribed normally, the growth condition of the transferred F3'5' H gene is stronger than that of a control plant (a wild type without transgenosis), the transgenic plant is characterized in that the stem and leaves show purplish red, the F3'5' H gene is overexpressed, the activity of the F3'5' H enzyme in the transgenic dendrobium officinale can be improved to a great extent, the protein content and the soluble sugar content are increased, and the anthocyanin and flavonoid substance content is increased. The result shows that the leaf spot art orchid F3'5' H gene has a promoting effect on the growth and development of the dendrobium officinale, and promotes the synthesis of flavonoid and anthocyanin, so that the plant is purple red and develops color.
Description of the drawings:
FIG. 1A is a PCR product of the 3' end of the F3'5' H gene, M is marker 2000 bp; 3: 3' RACE product B is F3'5' H gene full-length amplification, M is maker10000 bp; 1: the full length of F3'5' H gene;
FIG. 2: double enzyme digestion of pCAMBIA1301 vector;
FIG. 3: f3'5' H gene overexpression vector;
FIG. 4 QPCR detection of the expression of F3'5' H gene in transgenic and wild plants
FIG. 5 transgenic and wild type plant morphology;
FIG. 6: the contents of anthocyanin and flavonoid in leaves of wild type and transgenic dendrobium officinale plants;
FIG. 7: soluble protein and sugar content in leaves of wild type and transgenic dendrobium officinale plants
Wherein: A. b, C is a transgenic plant; CK is wild plant.
Detailed Description
In order to clearly understand the technical spirit and the advantages of the present invention, the applicant below describes in detail by way of example, but the description of the example is not intended to limit the technical scope of the present invention, and any equivalent changes made according to the present inventive concept, which are merely in form and not in material, should be considered as the technical scope of the present invention.
To avoid unnecessary detail, the following examples will not describe the known art in detail. Unless defined otherwise, technical and scientific terms used in the following examples have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.
The test reagent consumables used in the following examples are all conventional biochemical reagents unless otherwise specified; the experimental methods are conventional methods unless otherwise specified.
Firstly, constructing a recombinant vector pCAMBIA1301-35S-F3'5' HpCAMBIA1301-35S-F3 '5' H of F3'5' H, wherein the pCAMBIA1301-35S-F3'5' H plant expression vector contains F3'5' H gene of cymbidium lobayense, and an initial vector is pCAMBIA 1301.
The pCAMBIA1301-35S-F3'5' H plant expression vector obtained by the invention contains 35S promoter, and is followed by F3'5' H gene.
The so-called F3'5' H gene is obtained by RACE technology on the basis of EST sequences in transcriptome data constructed by us and is named as F3'5' H, the nucleotide sequence is shown as SEQ ID NO:1, ORF Finder analysis shows that the F3'5' H gene has a complete open reading frame with a longer sequence, 1512bp in total, an initiation codon is ATG, a termination codon is TAA, and 503 amino groups in total are codedAnd (4) acid. The molecular formula of the protein is presumed to be C by ExPASy analysis2517H4018N686O692S27The molecular weight is 55827.39, and the isoelectric point PI is 8.75.
Secondly, the recombinant vector pCAMBIA1301-35S-F3'5' H is constructed by the following method:
(1) amplification of the F3'5' H Gene of cymbidium floribundum
Comparing the F3'5' H gene sequence obtained from our transcriptome, the F3'5' H gene sequence was found to have 5', and 3' was amplified by RACE technique to obtain the full-length gene sequence shown in FIG. 1.
(ii) PCR primer
Primers were designed based on the fragment of the F3'5' H gene obtained in our transcriptome:
B26：5’-GACTCTAGACGACATCGATTTTTTTTTTTTTTTTT-3’
F3′5′H1：5’-CTCTCAGCATACCTCACTACGCCTC-3’
F3′5′H2：5’-GTTCCCAAGAAATACTGCACCATCA-3’
secondly, PCR is carried out by using the reverse transcription product, and the system is as follows:
| 10xPCR buffer | 2.5ul |
| dNTP mixture(10mM) | 2.5ul |
| F3′5′H1 | 0.5ul |
| B26 | 0.5ul |
| cDNA | 1.5ul |
| Taq plus | 0.25ul |
| H2O | 16.25ul |
| Total volume | 25ul |
PCR reaction procedure is as follows: pre-denaturation at 96 ℃ for 5 min; denaturation at 94 ℃ for 30sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 2min, 35 cycles; extension was carried out at 72 ℃ for 10min and the reaction was stopped at 4 ℃.
Fourthly, the same system and reaction program are adopted, the RCR product of the first round is taken as a template to carry out second round PCR, and the primers are F3'5' H2 and B26.
Linking the obtained fragment with pMDl8-T, and performing sequence determination after enzyme digestion identification.
Sixthly, splicing the full-length cDNA of the target gene according to the determined sequence and the overlapping region thereof, and respectively designing a primer F3'5' H3: 5'-CGTTCGGAGCGGGGCGGAGGATTTGC-3' and F3'5' H4: 5'-CGGGAAGTTAATGGGGATGCTGATGG-3' are provided. The full-length sequence was amplified by PCR for further validation.
(2) TA cloning of the F3'5' H Gene
Recovering a coding region gene fragment of F3'5' H, connecting the coding region gene fragment to a pMD18-T vector, extracting plasmid DNA by adopting an alkaline lysis method, and obtaining a recombinant plasmid pMD-F3'5' H through PCR detection and enzyme digestion detection;
(3) construction and screening of a forward positive clone of a plant expression vector pCAMBIA1301-35S-F3'5' H of the F3'5' H gene, carrying out bacterial liquid enrichment, extracting a pMD-F3'5' H plasmid, carrying out double enzyme digestion by using NcoI and BstEII, and recovering a band containing the full length of F3'5' H after enzyme digestion; the pCAMBIA1301 vector was digested with NcoI and BstEII, and the resultant vector fragment was recovered as shown in FIG. 2. The obtained full-length sequence and the vector sequence are provided with complementary cohesive ends, and are connected to transform escherichia coli, recombinants are screened out through enzyme digestion identification, and a plant expression vector pCAMBIA1301-35S-F3'5' H is constructed.
Genetic transformation of agrobacterium and detection of transformants
Competent cells of Agrobacterium were prepared, the above-constructed plant expression vector pCAMBIA1301-35S-F3'5' H was transferred to Agrobacterium (EHA105) by electric pulse method, and transformant colonies were selected on a plate containing hygromycin. The lysate of the agrobacterium colony is used as a template of PCR reaction, specific primers F3'5' H3 and F3'5' H4 of F3'5' H gene are used as PCR detection transformant colonies, and the transformant colonies confirmed by colony PCR are used for transforming plants.
Thirdly, transforming plants with Agrobacterium of plant expression vector containing F3'5' H gene
A single colony of agrobacterium carrying the plasmid pCAMBIA1301-35S-F3'5' H is selected, inoculated in a liquid culture medium for culture, centrifuged to collect thalli, and then suspended by an MS liquid culture medium. Infecting plant tissue which is easy to differentiate with suspended agrobacterium, then obtaining transgenic plantlet through tissue culture, and obtaining transgenic plant through screening with antibiotics.
Insertion condition and transcription level detection of F3'5' H gene in transgenic plant
To confirm that the transgenic plants obtained by antibiotic selection did contain the F3'5' H gene, the selected transgenic plants were further characterized using the 2XT5Direct PCR Kit (Plant) Kit. Firstly, genome DNA of a transgenic plant is extracted, then the plant genome DNA is used as a template, a specific primer of an internal fragment of F3'5' H gene is used for PCR detection, and analysis is carried out, and the structure is shown as figure 3.
In order to examine the expression condition of the F3'5' H gene in a transgenic plant containing the F3'5' H gene, total RNA is extracted from the transgenic plant, and is subjected to reverse transcription to synthesize cDNA for QPCR analysis, and the expression level of the F3'5' H gene in the transgenic plant is detected. And (3) taking the cDNA as a template, using F3'5' H gene specific primers as PCR, and using positive transgenic plants confirmed by QPCR for subsequent determination experiments of anthocyanin content and the like.
Fifth, experiment of transgenic plant color change
The F3'5' H gene-transferred and contrast wild type buds are cultured in a culture medium to form seedlings, the F3'5' H gene-transferred plant dendrobium officinale stalks and leaves show purple red, which indicates that the leaf spot art orchid F3'5' H gene really changes the plant color to achieve the expected effect, and various physiological indexes are measured to obtain a table 1, a figure 5 and a figure 6, the determination result and the experimental result of fig. 7 show that the F3'5' H gene in transgenic dendrobium officinale can be normally expressed, the growth condition of the transferred F3'5' H gene is stronger than that of a control plant (non-transgenic wild type), the transgenic plant is characterized by purplish red, the over-expression F3'5' H gene can greatly improve and increase the activity of the F3'5' H enzyme in the transgenic dendrobium officinale, the protein content and the soluble sugar content are increased, and the anthocyanin and flavonoid substance content is increased.
TABLE 1 morphological characteristics of transgenic Dendrobium officinale tissue culture seedlings
<110> Yunnan university of agriculture
Construction and application of plant expression vector of <120> leaf spot art orchid F3'5' H gene
<160>1
<170>SIPOSequenceListing 1.0
<210>1
<211>1512
<212>DNA
<213> leaf spot art orchid (Cymbidium)
<400>1
atgtctatct tcctcatcgc agccctcctg ctctgccttt tcctcctcct cctcctccgc 60
cgccgccgcg gttgtctccc cctccctcca ggaccaccta acttccctat ccttggcgct 120
ctgcccttca tcggccccat gccacactcc gctctcgctc tccttgcacg tcactacggc 180
cccatcatgt tcctcaagat gggcacccgg cgcgtcgtcg tagcgtcatc cgccgccgca 240
gctcgatcgt ttctcaaaac cctcgactcc cacttctccg accgccccac cggcatcatc 300
tccaaggaaa tcagctacaa cggccagaac atggtctttg ccgactacgg cccaaagtgg 360
aagctcctcc gcaaagtctc cagcctccat cttctcggtt ccaaggccat gtcccgttgg 420
tccggcgtgc ggcgcgatga ggccttctcc acgcttcaat tcttgaagaa tcggagcgat 480
tctggaaagc cggtgttgct tccgaattta ctggtttgtg ccatggcgaa tgtgataggg 540
aggatttcca tgagcaagag ggtatttgat gaggacggga aggaggcgaa ggagttcaag 600
gagatgatca aggagctttt ggttgggcag ggggcatcga atatcgggga tttggtgcct 660
gggatcaggt ggttggatcc gcagggagtg aggaagaaga tgctgggatt gaatcgcagg 720
tttgatagga tggtaagtaa gttgttggtg gagcacgctg agactgcagc ggagaggcag 780
gggaaccctg atctgttgga tcttatgatg gctaataaag taactggtga ggatggggag 840
gggctcaacg aggaaaacat caagggcttc atatctgatc tgttcgtagc ggggacggac 900
acgtccgcca tagtcataga gtgggcgatg gcggagatgc taaaaaatcc agcgatcctc 960
cgacgagcgc aagaggaaac cgaccgcgtc gtcggccgcc accgccttct cgacgaatcc 1020
gacataccga atctccccta cctccaagcc atctgcaagg aagctctgcg aaagcatccc 1080
ccaactcctc tcagcatacc tcactacgcc tccgagccct gcgaggtgga aggttacagc 1140
attccaggca agacatggct ctttgtcaac atatgggcca tcggccggga cccggacgtg 1200
tgggaggagc cgttggcgtt cgatccggag aggttcctgc aaggaaagat ggcgaagatt 1260
gatcccatgg gaaacgactt tgagctgata ccgttcggag cggggcggaggatttgcgcc 1320
gggaagttaa tggggatgct gatggtgcag tatttcttgg gaacattggt gcacgctttc 1380
gattggagtt tgccggaagg ggttggggaa ctggacatgg aggaagggcc ggggttggta 1440
ctgcccaagg ctgtgccgct gtcggtggtg gcgaggccga ggctcgcgcc ggcggcttat 1500
aggcttgatt aa 1512
Claims (7)
1. A recombinant vector is characterized by comprising a 3',5' -hydroxylase gene, namely F3'5' H gene, of the flavonoid of the cymbidium floribundum, wherein the nucleotide sequence of the F3'5' H gene is shown as SEQ ID NO. 1.
2. The recombinant vector of claim 1, wherein the starting vector for constructing the plant expression vector is pCAMBIA 1301.
3. The recombinant vector of claim 2, wherein the recombinant vector is pCAMBIA1301-35S-F3'5' H, having the promoter 35S ligated to the starting vector pCAMBIA1301 followed by the F3'5' H gene.
4. The method of constructing a recombinant vector according to any one of claims 1 to 3, comprising the steps of:
(1) amplification of the F3'5' H Gene of cymbidium floribundum
Comparing the F3'5' H gene sequence obtained from the transcriptome, finding that the F3'5' H gene sequence has 5', amplifying 3' by using RACE technology to obtain a full-length gene fragment;
(2) TA cloning of the F3'5' H Gene
Recovering a coding region gene fragment of F3'5' H, connecting the coding region gene fragment to a pMD18-T vector, extracting plasmid DNA by adopting an alkaline lysis method, obtaining a recombinant plasmid pMD-F3'5' H through PCR detection and enzyme digestion detection, screening positive clones, enriching a bacterial liquid, and extracting a plasmid;
(3) construction of F3'5' H gene plant expression vector pCAMBIA1301-35S-F3'5' H
Carrying out double enzyme digestion on the recombinant plasmid pMD-F3'5' H by using NcoI and BstEII, and recovering a band containing the full length of F3'5' H after enzyme digestion; then, NcoI and BstEII are used for enzyme digestion of pCAMBIA1301 vectors, obtained vector fragments are recovered, complementary cohesive ends are carried on obtained full-length sequences and vector sequences, the two are connected, escherichia coli is transformed, recombinants are screened out through enzyme digestion identification, and the plant-expressed recombinant vector pCAMBIA1301-35S-F3'5' H is constructed.
5. The method of claim 4, wherein the steps of:
(1) the amplification of the F3'5' H gene of the phyllanthus floribundus L specifically comprises the following steps:
(ii) PCR primer
The following primers were designed based on the F3'5' H gene fragment obtained in the transcriptome,
B26：5’-GACTCTAGACGACATCGATTTTTTTTTTTTTTTTT-3’；
F3'5'H1：5’-CTCTCAGCATACCTCACTACGCCTC-3’；
F3'5'H2：5’-GTTCCCAAGAAATACTGCACCATCA-3’；
② PCR was carried out using the above reverse transcription product in the following system, 10xPCR buffer2.5ul, dNTP mix (10mM)2.5ul, F3'5' H10.5ul, B260.5ul, cDNA1.5ul, Taq plus0.25ul and H2O16.25ul, total capacity 25 ul;
PCR reaction procedure is as follows: pre-denaturation at 96 ℃ for 5 min; denaturation at 94 ℃ for 30sec, annealing at 60 ℃ for 30sec, extension at 72 ℃ for 2min, 35 cycles; extending for 10min at 72 ℃, and stopping the reaction at 4 ℃;
fourthly, the same system and reaction program are adopted, the RCR product obtained in the third step is used as a template to carry out second round PCR, and the primers are F3'5' H2 and B26;
connecting the obtained fragment into pMDl8-T, and performing sequence determination after enzyme digestion identification;
splicing the full-length cDNA of the target gene according to the determined sequence and the overlapping region thereof, and respectively designing primers:
f3'5' H3: 5'-CGTTCGGAGCGGGGCGGAGGATTTGC-3' and F3'5' H4: 5'-CGGGAAGTTAATGGGGATGCTGATGG-3', PCR full-length sequences were amplified for further validation.
6. The use of the recombinant vector constructed by the construction method according to claim 5 in the preparation of transgenic Agrobacterium plants.
7. The use of the recombinant vector of claim 6, wherein the recombinant vector is used for preparing Agrobacterium transgenic Dendrobium officinale.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010560539.8A CN111593067A (en) | 2020-06-18 | 2020-06-18 | Construction and application of plant expression vector of F3'5' H gene of phyllanthus floridulus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202010560539.8A CN111593067A (en) | 2020-06-18 | 2020-06-18 | Construction and application of plant expression vector of F3'5' H gene of phyllanthus floridulus |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN111593067A true CN111593067A (en) | 2020-08-28 |
Family
ID=72188097
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202010560539.8A Pending CN111593067A (en) | 2020-06-18 | 2020-06-18 | Construction and application of plant expression vector of F3'5' H gene of phyllanthus floridulus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN111593067A (en) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113186207A (en) * | 2020-12-28 | 2021-07-30 | 南京农业大学 | Method for cultivating blue chrysanthemum by transferring gene OhF3'5' H of blue chrysanthemum |
| CN113943744A (en) * | 2021-11-02 | 2022-01-18 | 云南农业大学 | Application of RCA gene of cymbidium floribundum and vector construction method thereof |
| CN115873891A (en) * | 2022-08-09 | 2023-03-31 | 四川农业大学 | Application of dendrobium officinale DoObgC and variable spliceosome thereof in promotion of elongation of embryonic axis |
| CN116200424A (en) * | 2022-08-09 | 2023-06-02 | 云南农业大学 | Application of She Banyi orchid CcMYB24 gene |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101165186A (en) * | 2007-09-27 | 2008-04-23 | 复旦大学 | Flavonoid-3,5'-hydroxylase gene cloned from moth orchid, its coded sequence and application |
| CN103215306A (en) * | 2013-04-17 | 2013-07-24 | 昆明理工大学 | Plant expression vector of serine acetyltransferase gene and application thereof |
| CN110904147A (en) * | 2019-12-31 | 2020-03-24 | 云南中医药大学 | Construction method and application of agrobacterium-mediated chrysanthemum transfection system |
-
2020
- 2020-06-18 CN CN202010560539.8A patent/CN111593067A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101165186A (en) * | 2007-09-27 | 2008-04-23 | 复旦大学 | Flavonoid-3,5'-hydroxylase gene cloned from moth orchid, its coded sequence and application |
| CN103215306A (en) * | 2013-04-17 | 2013-07-24 | 昆明理工大学 | Plant expression vector of serine acetyltransferase gene and application thereof |
| CN110904147A (en) * | 2019-12-31 | 2020-03-24 | 云南中医药大学 | Construction method and application of agrobacterium-mediated chrysanthemum transfection system |
Non-Patent Citations (3)
| Title |
|---|
| WANG,Y.: "Cymbidium tracyanum x Cymbidium iridioides flavonoid 3", 5"-hydroxylase (F3"5"H) mRNA, complete cds", 《GENBANK DATABASE》 * |
| ZHENMING YU等: "Differential Accumulation of Anthocyanins in Dendrobium officinale Stems with Red and Green Peels", 《INT J MOL SCI 》 * |
| 夏科等: "石斛属植物再生及遗传转化研究进展", 《亚热带农业研究》 * |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN113186207A (en) * | 2020-12-28 | 2021-07-30 | 南京农业大学 | Method for cultivating blue chrysanthemum by transferring gene OhF3'5' H of blue chrysanthemum |
| CN113943744A (en) * | 2021-11-02 | 2022-01-18 | 云南农业大学 | Application of RCA gene of cymbidium floribundum and vector construction method thereof |
| CN115873891A (en) * | 2022-08-09 | 2023-03-31 | 四川农业大学 | Application of dendrobium officinale DoObgC and variable spliceosome thereof in promotion of elongation of embryonic axis |
| CN116200424A (en) * | 2022-08-09 | 2023-06-02 | 云南农业大学 | Application of She Banyi orchid CcMYB24 gene |
| CN116200424B (en) * | 2022-08-09 | 2024-02-02 | 云南农业大学 | Application of She Banyi orchid CcMYB24 gene |
| CN115873891B (en) * | 2022-08-09 | 2024-05-07 | 四川农业大学 | Dendrobium candidum DoObgC and application of alternative spliceosome thereof in promotion of hypocotyl elongation |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN111593067A (en) | Construction and application of plant expression vector of F3'5' H gene of phyllanthus floridulus | |
| US5034323A (en) | Genetic engineering of novel plant phenotypes | |
| EP0929676B1 (en) | Genetic sequences encoding flavonoid pathway enzymes and uses therefor | |
| US9567600B2 (en) | Modification of flavonoid biosynthesis in plants | |
| CN109136233B (en) | Overexpression of transcription factor SlBBX20 to increase content of tomato anthocyanin | |
| CN110029117B (en) | Flavonol synthetase gene SmFLS and application thereof, and flavonol synthetase | |
| US8962920B2 (en) | Use of active cytokinin synthase gene | |
| Mori et al. | Isolation and characterization of the dihydroflavonol 4-reductase gene in the monocotyledonous ornamental Agapanthus praecox ssp. orientalis (Leighton) Leighton | |
| JP2000300274A (en) | cDNA OF 4-COUMARIC ACID: CoA LIGASE, GENE PRODUCED USING THE SAME cDNA AND TRANSFORMANT PLANT TRANSDUCED WITH THE SAME GENE | |
| CN116970053B (en) | Plant carotenoid synthesis related protein DcAPRR2, and coding gene and application thereof | |
| LU102583B1 (en) | Gene smfls for peel coloring and use of the same | |
| US8008543B2 (en) | Modification of flavonoid biosynthesis in plants by PAP1 | |
| AU2006308510B2 (en) | Modification of flavonoid biosynthesis in plants | |
| US8143478B2 (en) | Peptide transporting to chromoplasts in petals and method of constructing plant having yellowish petals by using the same | |
| CN116694586A (en) | Phyllostachys Pubescens anthocyanin reductase gene PeANR4, extraction method and application thereof | |
| CN114032220A (en) | Protein related to biosynthesis of perilla anthocyanin and coding gene and application thereof | |
| CN114736921A (en) | Method for obtaining gene transformation plant by using iris lactea DFR gene | |
| AU2006272455B2 (en) | Modification of flavonoid biosynthesis in plants | |
| CN116064642A (en) | Application of TaDOF5.6 gene in efficient genetic transformation of wheat | |
| AU2012213953A1 (en) | Modification of flavonoid biosynthesis in plants with transparent testa glabra 1 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |