CN113929783A - anti-CD 99 protein monoclonal antibody, cell line, preparation method and application thereof - Google Patents

Abstract

The invention relates to the field of biological detection, and provides an anti-CD 99 protein monoclonal antibody, wherein the amino acid sequences of the heavy chain and light chain variable regions are respectively the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO. 3. In the preparation of the anti-CD 99 protein monoclonal antibody, an antigen used for immunizing a mouse is a recombinant protein which is encoded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination. The inventor also provides a hybridoma cell line for secreting anti-CD 99 protein, wherein the cell line is a mouse hybridoma cell line 10D2A10F9 with the preservation number of: CGMCC NO. 22316. The anti-CD 99 protein monoclonal antibody has high specificity and sensitivity, can specifically recognize cells expressing CD99 protein, and is suitable for immunological detection, especially immunohistochemical detection.

Description

anti-CD 99 protein monoclonal antibody, cell line, preparation method and application thereof

Technical Field

The invention relates to the field of biological detection, in particular to an anti-CD 99 protein monoclonal antibody, a cell line, a preparation method and application thereof.

Background

CD99 is a type I transmembrane glycoprotein with a molecular weight of 32kDa, a type of cell adhesion molecule. The MIC2 gene encoding CD99 was located in XP22.32-pter and Yp11-pter of the short arm pseudochromosomal region (PAR) of X and Y chromosomes, and the gene had a total length of 52kb and consisted of 10 exons.

CD99 is involved in the process of cell adhesion and apoptosis, is produced by thymocytes and T cells, plays an important role in cell and extracellular matrix and cell-cell interactions, and affects tumor cell development and metastasis. CD99 is expressed in a variety of cells, such as hematopoietic cells, endothelial cells, central nervous system ependymal cells, thymocytes, ovarian granulosa cells, and pancreatic islet cells. Among the tumors, CD99 is abnormally expressed in many different tumors such as Ewing sarcoma/PNET, Hodgkin lymphoma, breast cancer, stomach cancer, prostate cancer, cervical cancer, etc. Wherein, in small round cell tumors such as EWS/PNET, poorly differentiated synovial sarcoma, rhabdomyosarcoma, olfactory neuroblastoma, mesenchymal chondrosarcoma and the like, CD99 is a sensitive marker, and the immunohistochemical marker is an effective means for differential diagnosis of the small blue round cell tumors. And the CD99 protein shows low expression in the process of forming and developing gastric adenocarcinoma, and the immunohistochemical detection result can be used as a reference index for early diagnosis of gastric cancer. In hematopoietic diseases, expression of the MIC2 gene has also been considered as a marker for lymphoblasts and their disease. The loss of expression of CD99 in Hodgkin Lymphoma (HL) can be used as a reference for the diagnosis. In addition, the CD99 can also be used for diagnosis and identification of other tumors, such as auxiliary diagnosis of hepatocellular carcinoma, combined application of the alpha inhibin CD99 to differential suo-interstitial tumor types, differential diagnosis of MERKEL cell carcinoma and PNET, and the like.

The CD99 molecule plays different roles in diagnosis, generation, development, metastasis and prognosis of different types of tumors, and has great potential application value in the aspects of differential diagnosis, metastasis potential judgment, treatment, prognosis estimation and the like of tumors.

Disclosure of Invention

The invention provides an anti-CD 99 protein monoclonal antibody, wherein the amino acid sequences of the heavy chain and light chain variable regions of the monoclonal antibody are respectively the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO. 3.

Furthermore, the heavy chain and light chain variable region amino acid sequences of the monoclonal antibody are respectively encoded by the nucleotide sequences shown in SEQ ID NO.4 and SEQ ID NO. 5.

Furthermore, in the preparation process of the monoclonal antibody, an antigen used by an immunized mouse is a recombinant protein which is coded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination.

Further, the monoclonal antibody specifically recognizes the human CD99 protein.

Further, the monoclonal antibody is produced by a hybridoma cell line with the preservation number of CGMCC NO. 22316. The cell line is a mouse hybridoma cell line 10D2A10F9, and is classified and named as: a mouse hybridoma cell line which has been deposited at 29.29.04 in 2021 at the center of China Committee for culture Collection of microorganisms and is addressed to the institute of microorganisms of the national academy of sciences, China, institute of sciences, No.3, West Lu 1, Beijing, Chaoyang, and the quarter.

Further, the anti-CD 99 protein is a mouse IgG1 subtype monoclonal antibody.

The inventor also provides a preparation method of the anti-CD 99 protein monoclonal antibody, and an antigen used for immunizing a mouse is a recombinant protein which is encoded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination.

The inventor also provides a hybridoma cell line secreting anti-CD 99 protein, wherein the cell line is a mouse hybridoma cell line 10D2A10F9, the cell line is deposited in the China general microbiological culture Collection center with the following deposition numbers: CGMCC NO. 22316.

The inventor also provides the application of the anti-CD 99 protein monoclonal antibody in human CD99 protein immunoassay.

Further, the immunodetection includes immunohistochemistry, immunoblotting and enzyme-linked immunoassay.

The invention further provides a human CD99 protein immunoassay reagent, and the immunoassay reagent contains any one of the anti-CD 99 protein monoclonal antibodies as an effective component.

Different from the prior art, according to the technical scheme, according to the structure, antigenicity, hydrophilicity and hydrophobicity of constituent amino acids and a secondary structure of CD99 protein, the technical scheme selects amino acid fragments from 70 th to 180 th positions of CD99 protein and corresponding nucleotide fragments thereof, carries out recombinant expression through escherichia coli, immunizes mice, and obtains a monoclonal cell line 10D2A10F9 capable of efficiently secreting anti-CD 99 protein monoclonal antibodies through cell fusion, screening and cloning, and carries out in vitro culture on the monoclonal cell line 10D2A10F9, and obtains the anti-CD 99 protein monoclonal antibodies secreted by the cell line. The antibody obtained by the scheme has high specificity and sensitivity, can specifically recognize cells expressing the CD99 protein, and is suitable for immunological detection, particularly immunohistochemical detection.

The above description of the present invention is only an overview of the technical solutions of the present application, and in order to make the technical solutions of the present application more clearly understood by those skilled in the art, the present invention may be further implemented according to the content described in the text and drawings of the present application, and in order to make the above objects, other objects, features, and advantages of the present application more easily understood, the following description is made in conjunction with the detailed description of the present application and the drawings.

Drawings

FIG. 1 is a graph showing the result of electrophoresis of the purified CD99 protein in example 3; m is a molecular weight marker.

FIG. 2 is a graph of immunohistochemical staining results for primary neuroectoblastoma: the left is CD99 secreted by 10D2A10F9, and the right is commercially available CD99 (O13).

Detailed Description

In order to explain in detail possible application scenarios, technical principles, practical embodiments, and the like of the present application, the following detailed description is given with reference to the accompanying drawings in conjunction with the listed embodiments. The embodiments described herein are merely for more clearly illustrating the technical solutions of the present application, and therefore, the embodiments are only used as examples, and the scope of the present application is not limited thereby.

Reference herein to "an embodiment" means that a particular feature, structure, or characteristic described in connection with the embodiment can be included in at least one embodiment of the application. The appearances of the phrase "an embodiment" in various places in the specification are not necessarily all referring to the same embodiment, nor are separate or related to other embodiments specifically defined. In principle, in the present application, the technical features mentioned in the embodiments can be combined in any manner to form a corresponding implementable technical solution as long as there is no technical contradiction or conflict.

Unless defined otherwise, technical terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs; the use of relational terms herein is intended only to describe particular embodiments and is not intended to limit the present application.

In the description of the present application, the term "and/or" is a expression for describing a logical relationship between objects, meaning that three relationships may exist, for example a and/or B, meaning: there are three cases of A, B, and both A and B. In addition, the character "/" herein generally indicates that the former and latter associated objects are in a logical relationship of "or".

In this application, terms such as "first" and "second" are used solely to distinguish one entity or action from another entity or action without necessarily requiring or implying any actual such relationship or order between such entities or actions.

Without further limitation, in this application, the use of "including," "comprising," "having," or other similar expressions in phrases and expressions of "including," "comprising," or "having," is intended to cover a non-exclusive inclusion, and such expressions do not exclude the presence of additional elements in a process, method, or article that includes the recited elements, such that a process, method, or article that includes a list of elements may include not only those elements but also other elements not expressly listed or inherent to such process, method, or article.

As is understood in the examination of the guidelines, the terms "greater than", "less than", "more than" and the like in this application are to be understood as excluding the number; the expressions "above", "below", "within" and the like are understood to include the present numbers. In addition, in the description of the embodiments of the present application, "a plurality" means two or more (including two), and expressions related to "a plurality" similar thereto are also understood, for example, "a plurality of groups", "a plurality of times", and the like, unless specifically defined otherwise.

EXAMPLE 1 preparation of recombinant CD99 protein fragment

First, antigen fragment selection

The CD99 protein sequence with the number P01236 was selected as standard sequence from the Uniprot database (http:// www.uniprot.org). The invention selects amino acid fragments from 70 th site to 180 th site of human CD99 protein as antigen, and utilizes software Primer 5.0 to design specificity upstream Primer 5 'GGGATCCCCGAACCCTCCTAAACCAAT' (SEQ ID NO.6 restriction site, BamH I) and downstream Primer of CD99 protein according to corresponding base sequence (SEQ ID NO. 1): 5 'ATCTCGAGACGCTGAACCGCCGGTT 3' (SEQ ID NO.7, restriction site, Xho I), reverse transcription amplifying the gene fragment SEQ ID NO.1 encoding amino acids 70 to 180.

And separating the PCR product by agarose gel electrophoresis, recovering, carrying out BamH I and Xho I double digestion on the recovered target gene and a plasmid vector pET27b for expression, recovering by electrophoresis again, and connecting by using T4 DNA ligase. And transforming the connecting product into an escherichia coli competent cell Rosetta, selecting clone on a plate, inoculating, expanding and culturing, extracting plasmid DNA, and performing PCR identification. And (4) sequencing and analyzing the clone with positive target gene shown by PCR, and using the clone with completely correct sequence for next experiment.

Secondly, expression and purification of recombinant CD99 protein fragment

Take 100ul of competent cells (Rosetta) preserved at-80 deg.C, thaw, add 5ul of CD99 plasmid DNA, and stand on ice for 30 min. After heat shock at 42 ℃ for 90 seconds and ice bath for 5min, 800. mu.L of non-resistant LB medium was added. Recovering and culturing at 37 deg.C for 60min, plating, and culturing overnight. The transformed plate was picked up and single colonies were cultured in 4ml of LB liquid medium overnight at 37 ℃ and 200rpm, and then the cells were maintained.

4ul of the bacterial liquid is taken to be put into 4ml of LB liquid culture medium and cultured overnight for recovery. The cultured bacterial suspension was transferred to 200ml of LB liquid medium, mixed, cultured at 37 ℃ and 200rpm until OD becomes 0.6-0.8, and then IPTG (0.5mM) was added thereto for overnight induction at low temperature. The cells were collected by centrifugation in a 400ml large centrifuge bowl at 4000rpm for 10min and the supernatant was discarded. The pellet was blown off with 20-30ml of 10mM Tris-HCl (pH7.0) and NaCl at a final concentration of 0.5M, and the cells were disrupted by sonication. After centrifugation at 12000rpm for 20 minutes, the centrifuged supernatant was applied to a Ni-NTA nickel column (QIAGEN) for purification, and then eluted with 10mM Tris-HCl (pH7.0) (containing 0.5M sodium chloride) containing 50mM imidazole, 250mM imidazole and 500mM imidazole, respectively, to collect protein peaks, followed by electrophoresis for detection.

Example 210 establishment of a D2A10F9 hybridoma cell line

Immunization

The recombinant CD99 protein obtained in example 1 was emulsified by mixing with an equal volume of complete Freund's adjuvant (CFA, Sigma Co.), and 18-20g of Balb/c mice (purchased from Wu's laboratory animal, Fox) were immunized by abdominal injection at a dose of 50. mu.g/mouse. Thereafter, the booster was administered every 14 days, and the antigen was emulsified with Freund's incomplete adjuvant (IFA, Sigma Co.) at a dose of 25. mu.g/mouse. The polyclonal titer of the anti-immunogen in the serum of the mice is detected by indirect ELISA (wavelength 450nm) 14 days after the 2 nd boosting immunization, the mice with the highest titer are injected by tail vein for impact immunization, and the antigen is uniformly mixed by PBS solution with the dosage of 50 mu g/mouse.

Secondly, cell fusion:

aseptically preparing mouse spleen cell suspension with qualified immunity, mixing with mouse myeloma cell sp2/0(ATCC) at a ratio of 5:1, centrifuging at 1000rpm for 10min, discarding supernatant, adding 1mL of PEG (Sigma) solution preheated to 37 ℃ from slow to fast within 1 min, and slightly rotating the centrifuge tube during the addition process to make the cells fully contact with PEG. Standing at room temperature for 90s, adding 4mL of serum-free DMEM (Hyclone company) culture medium preheated to 37 ℃ from slow to fast within 2min, then adding 10mL of preheated serum-free DMEM culture medium within 2min, finally adding the rest preheated serum-free DMEM culture medium within 2min, and fixing the volume to 50mL, wherein the centrifugal tube needs to be slowly shaken in the whole adding process to ensure uniform mixing and reduce the damage to cells. Standing at room temperature for 10min, centrifuging (1000rpm, 5min), discarding supernatant, resuspending cells in 10-20mLHAT (Sigma) medium, and diluting with HAT medium to final concentration of 0.5X 10⁶cells/mL, all solutions were transferred to 96-well plates at 200. mu.L/well and labeled. The 96-well plates were carefully transferred to 37 ℃ with 5% CO₂Culturing in an incubator. The growth state and potential pollution of cells are regularly checked, and the incubator is opened and closed as little as possible to ensure the stability of the culture environment. On day 5 post-fusion, plates were supplemented with HAT medium at 50. mu.L/well.

Thirdly, cloning and ELISA screening positive hybridoma cells:

when the fused cell diameter is about 1-2mm, 50-200. mu.L of culture supernatant is aspirated for the first cell selection (ELISA, IHC-P and other methods of detection), and HAT medium is added to the culture wells to 200. mu.L. And (3) detecting the culture solution supernatant by ELISA, transferring all cell culture solution in the culture hole with the positive result obtained by detection to a 24-hole culture plate, supplementing HT medium, culturing for 3 days at a concentration of 2 mL/hole.

And repeatedly screening each cell line in the 24-pore plate, and removing the culture well cells which are not positive results to obtain the culture well cells with better positive results. Performing subclone screening on the positive well cells obtained from the 24-well culture plate by limiting dilution method, namely adding cell sap obtained by limiting dilution method into 96-well culture plate, and transferring to CO₂Culturing in incubator for 11 days until the diameter of cell to be cloned is 1-2mmIn this case, cell screening was repeated. According to the detection result, 4 well-grown monoclonal positive culture wells are selected from each subcloned cell line, and transferred to a 24-well plate for continuous culture. After a period of time, the positive clone cell line cloned in the 24-well plate is screened again, namely the hybridoma cell line 10D2A10F9 secreting the specific monoclonal antibody. The cell line is transferred into a T-75 culture flask to be amplified to a logarithmic growth phase for seed preservation or subsequent experiments are carried out.

EXAMPLE 3 preparation of monoclonal antibodies by in vitro culture

First, in vitro culture

After obtaining the stable hybridoma cell line, the monoclonal antibody is obtained mainly by an in vitro culture method.

The hybridoma cells were cultured in DMEM complete medium containing 10% fetal bovine serum, and then centrifuged at low speed to collect culture supernatant, which was stored at 4 ℃ for further use.

Secondly, purification of monoclonal antibody

Antibody purification using rProtein A sepharose Fast Flow (GE) affinity column: filling a proper amount of purchased ProteinA filler into a gravity chromatography column, and washing the gravity chromatography column with an equilibrium buffer solution (a 0.1M Tris solution containing 1.5M NaCl, pH7.0) until the equilibrium is reached; secondly, loading, namely adding cell supernatant filtered by a 0.22-micron filter membrane into a packed chromatographic column, and controlling the flow rate to be 1 drop/second; thirdly, balancing, and washing the sample solution to be balanced by using a balancing buffer solution after the sample solution is loaded; eluting, adding an elution buffer solution (0.1M citric acid solution, pH4.5) to wash the column and collecting the eluent; fifthly, regenerating, adding an equilibrium buffer solution to wash the column to be balanced after the elution is finished, washing the column with 2 times of column volume of 20 percent ethanol, and storing the column at 4 ℃. And finally, identifying the purity of the antibody by adopting an SDS-PAGE method. The result is shown in figure 1, the polyacrylamide gel electrophoresis picture of the purified CD99 monoclonal antibody has the purity of more than 95 percent, and the concentration of the antibody is measured by an ultraviolet micro-spectrophotometer method and reaches more than 3.0 mg/mL.

EXAMPLE 4 characterization of monoclonal antibodies

Identification of one, two subtypes

Diluting antigen protein to 1 μ g/mL coated enzyme label plate, adding 100 μ L per well, coating overnight at 4 deg.C, emptying liquid, and adding P containing 0.05% TweenThe plate was washed 3 times with BS (PBS-T) and 200. mu.L of blocking solution (2% BSA in PBS-T) was added to each well and incubated at 37 ℃ for 1 h. The liquid was decanted and washed 3 times with PBS-T. 0.1mL of culture supernatant of hybridoma cell line diluted 5-fold was added to each well and incubated at 37 ℃ for 1 hour. The liquid was decanted and washed 3 times with PBS-T. Using a confining liquid 1: HRP-labeled goat anti-mouse (kappa, lambda, IgM, IgG1, IgG2a, IgG2b, IgG) diluted 400₃IgA) antibody (Southern Biotech) was added in an amount of 0.1mL per well and incubated at 37 ℃ for 1 hour. The liquid was decanted and washed 3 times with PBS-T. 100 mu of LTMB (Hiroshi Biotech, Inc., Huzhou) substrate (A, B mixed solution with equal volume) is added into each well for color development, the reaction is carried out for 15min at room temperature, 50 mu L of 1N HCl solution is added into each well to stop the color development reaction, and then the OD value at the wavelength of 450nm is measured by a microplate reader. The results show that the monoclonal antibody of the present invention is a murine monoclonal antibody of the IgG1 type.

Second, determination of affinity constant

The CD99 protein was coated at a concentration of 100. mu.g/ml, 100. mu.l/well, coated overnight at 4 ℃ and washed 3 times with PBS-T. Add 200. mu.l of blocking solution to each well and block for 1h at 37 ℃ and wash 3 times with PBS-T. The monoclonal antibody purified in example 3 was diluted to the following concentrations (unit: ng/mL): 2000. 500, 125, 62.5, 31.25, 15.625, 3.125, 0.625, incubation at 37 ℃ for 1h, PBS-T wash 3 times. HRP-labeled goat anti-mouse secondary antibody 1: diluted at 5000, 100. mu.l/well, incubated at 37 ℃ for 1h, and washed 3 times with PBS-T. Mu.l of TMB (Hiroshi, England Biotech Co., Ltd., Huzhou) color developing solution was added to each well, and the reaction was stopped by adding 100. mu.l of 1.0N hydrochloric acid solution for color development for 13 min. And measuring the light absorption value with the wavelength of 450nm by using a microplate reader. The OD values were plotted against the antibody dilution factor to find 1/2 the antibody concentration a corresponding to the "plateau OD value". The affinity constant was calculated to be 5.98X 10 using the following formula⁹。

Example 5 tissue chip staining and characterization

First, preparation of tissue wax block

HE section staining was performed on the sample tissue to determine the tumor lesion site. And (5) circling the lesion site and preparing to punch. When the receptor wax block is manufactured, a plastic frame is placed on a mold, melted paraffin (the melting point is 56-58 ℃) is poured into the mold, the tissue block is placed into wax liquid in the mold, then a proper amount of wax liquid is added to enable the tissue block to be completely embedded in the wax liquid, the mold is placed into a refrigerator with the temperature of-20 ℃ for 6min after being cooled to the room temperature, the wax block is taken out of the mold, and the section is sliced or placed into the refrigerator with the temperature of 4 ℃ for storage. After trimming, continuous slicing is carried out, the thickness is determined to be 4 mu m, the continuous slicing is rinsed in 40% alcohol, the slices are naturally unfolded, then the separated slices are transferred to warm water at 45 ℃ for 30 seconds, a glass slide treated by 2% APES acetone solution is used for mounting the slices, the prepared tissue chip is placed into an oven at 60 ℃ for baking for 2 hours, the slices are taken out for cooling at room temperature, and the tissue chip is placed into a refrigerator at-4 ℃ for storage.

Second, IHC staining and analysis

Conventional xylene dewaxing was performed 3 times for 6 minutes each time with 100%, 95%, 85% gradient ethanol hydration for 3 minutes each time and finally tap water rinse. Antigen retrieval was performed and the sections were then placed in a wet box and washed 3 x 3min with PBS. Dropwise adding 3% H₂O₂Incubate for 10min and wash with PBS for 3 × 3 min. The PBS was spun off and the peroxidase blocker was added dropwise and incubated for 10 minutes at room temperature. Spin-drying the slices, dripping primary antibody diluted in a proper proportion (the dilution proportion of the antibody is designed according to the concentration of the antibody in the primary dilution) and incubating for 1 hour at room temperature (25 ℃), washing for 3X 3 minutes by PBS, dripping secondary antibody and incubating for 30 minutes at room temperature, washing for 3X 3 minutes by PBS, throwing off the PBS, and developing for 3-10 minutes by using a freshly prepared DAB developing solution. Hematoxylin counterstain for 20 seconds, PBS turns blue. Dehydration was carried out in a gradient of 85% (3 min), 95% (3 min), 100% (3 min) and 100% (3 min) in order, and finally two times xylene was cleared for 10min, followed by sealing with neutral gum.

The immunohistochemical staining results were divided into: positive and negative. Positive expression must be at a specific antigenic site in cells and tissues to be considered positive. Under the condition that the tissue staining distribution is clear and the cell positioning is accurate, the staining result is further divided according to the difference of staining intensity, which is as follows:

1. the sample is weakly positive; marked "+";

2. the sample is moderately positive; marked "+";

3. the sample is highly positive; marked as "+ + +".

4. The sample was negative and marked "-".

Thirdly, sample detection results:

the anti-CD 99 protein monoclonal antibody (10D2A10F9) prepared by the invention and the commercial anti-CD 99 protein monoclonal antibody (O13) are synchronously detected in 8 cases of ovarian granulocytoma and 8 cases of primitive neuroectoblastoma, and the results are shown in the following table:

note: the application cases of CD99 are extremely rare, and the above is the expression of all cases in the current pool.

The result shows that the staining of the anti-CD 99 protein monoclonal antibody (10D2A10F9) is accurate in location, clear in staining, free of non-specific staining and clean in background, and the anti-CD 99 protein monoclonal antibody (10D2A10F9) is strong in specificity. In 8 cases of ovarian granulocytoma and 8 cases of primitive neuroectoblastoma, the positive rate of the monoclonal antibody (10D2A10F9) against CD99 protein is equivalent to the positive rate of the commercial antibody, but the number and the positive intensity of the positive cells are higher than those of the control reagent, which indicates that the monoclonal antibody (10D2A10F9) against CD99 protein is more sensitive to the differential diagnosis of ovarian granulocytoma and primitive neuroectoblastoma than the commercial antibody, and the risk of node omission can be avoided. FIG. 2 is a graph of immunohistochemical staining results for primary neuroectoblastoma: the left is CD99 secreted by 10D2A10F9, and the right is commercially available CD99 (O13).

And the anti-CD 99 protein monoclonal antibody (10D2A10F9) and the control antibody (O13) are adopted to carry out synchronous detection on 30 normal tissue chips, and the positive and negative results of the samples are consistent, which shows that the specificity of the antibody on the commercial tissue is equivalent to that of the commercial antibody.

The 30 normal tissues include: brain, heart, cerebellum, esophagus, adrenal gland, stomach, ovary, small intestine, pancreas, colorectal, parathyroid, liver, pituitary, salivary gland, testis, kidney, thyroid, prostate, breast, uterus, spleen, bladder, tonsil, skeletal muscle, thymus (young child), skin, bone marrow, peripheral nerve, lung, mesothelial cells.

Finally, it should be noted that, although the above embodiments have been described in the text and drawings of the present application, the scope of the patent protection of the present application is not limited thereby. All technical solutions which are generated by replacing or modifying the equivalent structure or the equivalent flow according to the contents described in the text and the drawings of the present application, and which are directly or indirectly implemented in other related technical fields, are included in the scope of protection of the present application.

SEQUENCE LISTING

<110> Fuzhou mai New Biotechnology development Co., Ltd

<120> anti-CD 99 protein monoclonal antibody, cell line, preparation method and application thereof

<130> 2020

<160> 7

<170> PatentIn version 3.5

<210> 1

<211> 333

<212> DNA

<213> Artificial sequence (Artificial)

<400> 1

ccgaaccctc ctaaaccaat gcctaatcct aacccgaacc acccaagctc ttccggttct 60

ttcagcgatg cagatctggc cgacggtgtt tccggtggtg aaggtaaagg tggctccgat 120

ggtggtggct ctcatcgcaa ggaaggtgaa gaagcagacg ctccgggtgt tatcccgggt 180

atcgttggtg cggttgttgt agcagtagcg ggcgccatca gcagcttcat tgcctaccag 240

aaaaaaaaac tgtgcttcaa ggagaacgct gaacagggcg aagtagacat ggaatctcac 300

cgtaacgcta acgcggaacc ggcggttcag cgt 333

<210> 2

<211> 133

<212> PRT

<213> Artificial sequence (Artificial)

<400> 2

Met Lys Cys Ser Trp Val Ile Phe Phe Leu Met Ala Val Val Thr Gly

1 5 10 15

Val Asn Ser Glu Val Gln Leu Gln Gln Ser Gly Ala Glu Leu Val Lys

20 25 30

Pro Gly Ala Ser Val Lys Leu Ser Cys Thr Ala Ser Gly Phe Asn Ile

35 40 45

Lys Asp Thr Tyr Met His Trp Val Lys Gln Arg Pro Glu Gln Gly Leu

50 55 60

Glu Trp Ile Gly Arg Ile Asp Pro Ala Asn Gly Asn Thr Lys Tyr Asp

65 70 75 80

Pro Lys Phe Gln Gly Lys Ala Thr Ile Thr Ala Asp Thr Ser Ser Asn

85 90 95

Thr Ala Tyr Leu Gln Leu Ser Ser Leu Thr Ser Glu Asp Thr Ala Val

100 105 110

Tyr Tyr Cys Gly Arg Arg Gly Phe Ala Tyr Trp Gly Gln Gly Thr Leu

115 120 125

Val Thr Val Ser Ala

130

<210> 3

<211> 131

<212> PRT

<213> Artificial sequence (Artificial)

<400> 3

Met Ser Pro Ala Gln Phe Leu Phe Leu Leu Val Leu Trp Ile Arg Glu

1 5 10 15

Thr Asn Gly Asp Val Val Met Thr Gln Thr Pro Leu Thr Leu Ser Val

20 25 30

Thr Ile Gly Gln Pro Ala Ser Ile Ser Cys Lys Ser Ser Gln Ser Leu

35 40 45

Leu Asp Gly Asp Gly Lys Thr Tyr Leu Asn Trp Leu Phe Gln Met Pro

50 55 60

Gly Gln Ser Pro Lys Arg Leu Leu Tyr Leu Val Ser Lys Leu Asp Ser

65 70 75 80

Gly Val Pro Asp Arg Phe Thr Gly Ser Gly Ser Gly Thr Asp Phe Thr

85 90 95

Leu Lys Ile Ser Arg Val Glu Ala Glu Asp Leu Gly Val Tyr Tyr Cys

100 105 110

Cys Gln Gly Thr His Phe Pro Arg Thr Phe Gly Gly Gly Thr Lys Leu

115 120 125

Glu Ile Lys

130

<210> 4

<211> 399

<212> DNA

<213> Artificial sequence (Artificial)

<400> 4

atgaaatgca gctgggttat cttcttcctg atggcagtgg ttacaggggt caattcagag 60

gttcagctgc agcagtctgg ggcagagctt gtgaagccag gggcctcagt caagttgtcc 120

tgcacagctt ctggcttcaa cattaaagac acctatatgc actgggtgaa acagaggcct 180

gaacagggcc tggagtggat tggaaggatt gatcctgcga atggtaatac taaatatgac 240

ccgaagttcc agggcaaggc cactataaca gcagacacat cctccaacac agcctacctg 300

cagctcagca gcctgacatc tgaggacact gccgtctatt actgtggtag acgggggttt 360

gcttactggg gccaagggac tctggtcact gtctctgca 399

<210> 5

<211> 393

<212> DNA

<213> Artificial sequence (Artificial)

<400> 5

atgagtcctg cccagttcct gtttctgtta gtgctctgga ttcgggaaac caacggtgat 60

gttgtgatga cccagactcc actcactttg tcggttacca ttggacaacc agcctccatc 120

tcttgcaagt caagtcagag cctcttagat ggtgatggaa agacatattt gaattggttg 180

ttccagatgc caggtcagtc tccaaagcgc ctactctatc tggtgtctaa actggactct 240

ggagtccctg acaggttcac tggcagtggt tcagggacag atttcacact gaaaatcagc 300

agagtggagg ctgaggattt gggagtttat tattgctgcc aaggtacaca ttttcctcgg 360

acgttcggtg gaggcaccaa gctggaaatc aaa 393

<210> 6

<211> 27

<212> DNA

<213> Artificial sequence (Artificial)

<400> 6

gggatccccg aaccctccta aaccaat 27

<210> 7

<211> 25

<212> DNA

<213> Artificial sequence (Artificial)

<400> 7

atctcgagac gctgaaccgc cggtt 25

Claims (10)

1. The monoclonal antibody for resisting the CD99 protein is characterized in that the amino acid sequences of heavy chain and light chain variable regions of the monoclonal antibody are respectively the amino acid sequences shown in SEQ ID NO.2 and SEQ ID NO. 3.

2. The monoclonal antibody of claim 1, wherein the heavy and light chain variable region amino acid sequences of the monoclonal antibody are encoded by the nucleotide sequences set forth in SEQ ID No.4 and SEQ ID No.5, respectively.

3. The monoclonal antibody of claim 1, wherein the antigen used for immunizing a mouse in the preparation process of the monoclonal antibody is a recombinant protein encoded by the nucleotide sequence shown in SEQ ID No.1 and recombinantly expressed by Escherichia coli.

4. The monoclonal antibody of claim 1, wherein the monoclonal antibody specifically recognizes human CD99 protein.

5. The monoclonal antibody of claim 1, which is produced by a hybridoma cell line having a collection number of CGMCC No. 22316.

6. The monoclonal antibody of claim 1, wherein the anti-CD 99 protein is a mouse IgG1 subtype monoclonal antibody.

7. A preparation method of a monoclonal antibody for resisting CD99 protein is characterized in that an antigen used for immunizing a mouse is a recombinant protein which is encoded by a nucleotide sequence shown in SEQ ID NO.1 and is expressed by escherichia coli recombination.

8. A hybridoma cell line for secreting anti-CD 99 protein monoclonal antibodies, wherein the cell line is a mouse hybridoma cell line 10D2A10F9, the cell line is preserved in the China general microbiological culture Collection center with the preservation number: CGMCC NO. 22316.

9. Use of the anti-CD 99 protein monoclonal antibody of any one of claims 1-6 in human CD99 protein immunoassay.

10. An immunodetection reagent for human CD99 protein, comprising the anti-CD 99 monoclonal antibody of any one of claims 1 to 6 as an active ingredient.

Images