CN113913452B

CN113913452B - Application of corn Zm00001d013367 gene in regulating and controlling primary xylem development and moisture transportation

Info

Publication number: CN113913452B
Application number: CN202111186281.0A
Authority: CN
Inventors: 宋纯鹏; 黄世全; 郭思义; 密玲煜; 李文娆; 李保珠; 赵津禾
Original assignee: Sanya Research Institute Of Henan University; Henan University
Current assignee: Sanya Research Institute Of Henan University; Henan University
Priority date: 2021-10-12
Filing date: 2021-10-12
Publication date: 2023-07-04
Anticipated expiration: 2041-10-12
Also published as: CN113913452A

Abstract

The invention relates to the technical field of genetic engineering, and particularly discloses application of a Zm00001d013367 gene of corn in regulating and controlling primary xylem development and moisture transportation thereof, wherein the nucleotide sequence of the Zm00001d013367 gene is shown as SEQ ID NO.1, the amino acid sequence of encoded protein is shown as SEQ ID NO.2, and the secondary cell wall deposition process in the primary xylem development process of the corn is regulated and controlled. The Zm00001d013367 gene is used for regulating and controlling the development of the primary xylem and the water transportation of the primary xylem.

Description

Application of corn Zm00001d013367 gene in regulating and controlling primary xylem development and moisture transportation

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of a corn Zm00001d013367 gene in regulating and controlling primary xylem development and moisture transportation thereof.

Background

Transpiration water loss, photosynthetic CO ₂ The assimilation and other processes consume a great amount of water in plants, especially in leaves, and the water in the leaves is mainly supplied through the processes of root system absorption, xylem transportation and the like. Xylem development and its pattern of thickening of the secondary walls of ducts are critical in the efficient transport of plant moisture. Xylem is a special tissue structure of terrestrial plants evolved to adapt to long-distance transportation of moisture and nutrient substances, and is most remarkable in that hollow tubes of annular, spiral, reticular or porous secondary cell walls are formed between primary walls and plasma membranes by deposition of cellulose, hemicellulose and lignin. Although the reticulation or pore structure of the secondary xylem has been shown to affect the pattern of secondary cell wall deposition by ROP11/MIDD1/Kinesin-13A complex mediated depolymerization of cortical microtubules, the pattern of regulation of the ring or thread structure of the primary xylem has not been reported. Microtubule mediated cellulose, hemicellulose and lignin deposition processes have been described using live cell imaging, but the mechanism of directing microtubule arrays in specific directions in different cell types is still unclear, and little is known about the pattern of thickening of the secondary cell wall of the catheter during xylem development versus the efficiency of moisture transport. Therefore, the research on the genes related to plant xylem development is enhanced, the relation between the xylem catheter secondary cell wall thickening mode and the water transportation efficiency is revealed, and a new way and thinking can be provided for plant stress resistance research and new variety cultivation.

Disclosure of Invention

In order to solve the technical problems, the invention provides application of a Zm00001d013367 gene of corn in regulating and controlling primary xylem development and moisture transportation thereof, wherein the Zm00001d013367 gene can regulate and control a secondary cell wall thickening mode of a primary xylem catheter, thereby influencing moisture transportation.

The invention provides application of a Zm00001d013367 gene of corn in regulating and controlling primary xylem development and moisture transportation thereof, wherein the nucleotide sequence of the Zm00001d013367 gene is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.

Further, the protein encoded by the Zm00001d013367 gene is an alpha-tubulin.

Further, the α -tubulin modulates primary xylem vessel secondary cell wall thickening patterns, affecting moisture transport.

Further, the Zm00001d013367 gene is used for regulating and controlling a primary xylem catheter secondary cell wall thickening mode.

Further, the Zm00001d013367 gene is used for maintaining the native xylem ring structure.

Further, the ring primary xylem facilitates moisture transport while allowing organ elongation.

Compared with the prior art, the invention has the beneficial effects that:

1. the functional identification of the important gene Zm00001d013367 for regulating and controlling the development of the stem and leaf primary xylem in the first crop corn worldwide has theoretical and practical significance in agricultural production compared with the research of arabidopsis and other mode plants;

2. the alpha-tubulin coded by the Zm00001d013367 gene regulates and controls the thickening mode of secondary walls of primary xylem vessels in stems and leaves of corns, regulates water transportation, and is beneficial to breeding and cultivation of corns;

3. the Zm00001d013367 gene provided by the invention is used for maintaining the primary xylem catheter ring structure, is favorable for moisture transportation, allows organ elongation, and has guiding significance for breeding corn varieties with high economic yield and biological yield.

Drawings

In order to more clearly illustrate the embodiments of the invention or the technical solutions in the prior art, the drawings that are required in the embodiments or the description of the prior art will be briefly described, it being obvious that the drawings in the following description are only some embodiments of the invention, and that other drawings may be obtained according to these drawings without inventive effort for a person skilled in the art.

FIG. 1 shows the field maize WT, dos1 phenotype and large flare period stem flow daily variation in example 1 of the present invention.

Wherein, panel a represents the field phenotype of maize wild type, dos1 heterozygotes and homozygotes about 40 days after sowing under normal growth conditions, scale bar = 10cm;

panel b shows wild-type leaf appearance under high temperature weather conditions, scale bar = 10cm;

panel c shows the leaf appearance of dos1 heterozygote under high temperature weather conditions, scale bar = 10cm;

panel d shows the dos1 homozygous phenotype at about 15 days post-sowing under normal growth conditions, scale bar=5 cm;

panel e under normal growth conditions, the large bell mouth period wild type and dos1 heterozygotes day cycle stem flow rates, the white and black segments of the abscissa represent day and night, respectively;

FIG. 2 is a comparison of the native xylem of the dos1 mutant with the wild type in example 1 of the present invention;

wherein, figure a shows a xylem SEM image of corn wild-type stem internodes after about 40 days of sowing by lateral scanning observation;

panel b shows SEM image of xylem between the pedicles of dos1 heterozygote after about 40 days of sowing by lateral scanning observation;

panel c shows SEM image of xylem between the nodes of dos1 homozygote stems after about 40 days of sowing by lateral scanning;

panel d shows a SEM image of xylem between wild-type stem nodes of maize after about 40 days of sowing viewed by longitudinal scanning;

panel e shows SEM image of xylem between the pedicles of dos1 heterozygote after about 40 days of seeding by longitudinal scanning observation;

FIG. f shows SEM image of xylem between the nodes of dos1 homozygote stems after about 40 days of sowing by longitudinal scanning;

in figures a-f Scale bar = 100 μm;

FIG. g shows high resolution X-ray three-dimensional microscopic imaging of native xylem vessels in maize wild type leaves;

FIG. h shows high resolution X-ray three-dimensional microscopic imaging of native xylem vessels in dos1 hybrid leaves;

FIG. i shows high resolution X-ray three-dimensional microscopic imaging of native xylem vessels in dos1 homozygote leaves;

in graph g-i Scale bar=75μm.

Panel j represents the percentage of ring and thread in corn wild type and dos1 heterozygote native xylem vessels;

panel k shows a comparison of corn wild type, dos1 heterozygote and homozygote native xylem vessel diameters;

FIG. 3 shows the pattern of map-based cloning and expression of DOS1 in example 1 of the present invention;

wherein, figure a is a schematic diagram of map-based cloning of DOS1 in example 1 of the present invention;

FIG. b is a schematic structural diagram of DOS1 gene in example 1 of the present invention;

FIG. c is a fluorescence and bright field overlay of cross-cut YFP-DOS1 leaf sheath of transgenic maize DOS1 pro;

FIG. d is a bright field plot of YFP-DOS1 leaf sheath transection of transgenic maize DOS1 pro;

FIG. e is a fluorescent and bright field overlay of the internode cleavage of YFP-DOS1 stem of transgenic maize DOS1 pro;

FIG. f is a bright field plot of YFP-DOS1 internode longitudinal cuts of transgenic maize DOS1 pro;

in panels c-f, scale bar = 15 μm;

FIG. g is a micropipe micrograph of leaf epidermal cells in YFP-DOS1 transgenic maize with Scale bar=15. Mu.m;

panel h is a cross-sectional micrograph of DOS1mRNA expression at the base of the leaf of the shoot tip development of maize seedlings analyzed by in situ hybridization technique, scale bar=10μm.

FIG. 4 shows maize material transformed with the DOS1 mutant gene (DOS 1pro:: DOS 1) in example 1 of the present invention ^G586 ^/A586 ) A phenotype similar to dos1 heterozygotes occurs;

FIG. a is a diagram of transgenic acceptor material B104, wild-type gene (DOS 1pro:: DOS 1) and mutant gene (DOS 1pro:: DOS 1) ^G586/A586 ) Phenotype of transgenic material of (2), scale bar = 10cm;

FIG. b is an agarose gel electrophoresis of a DNA fragment containing the left border of the vector and the first half of the transgene in the amplified transgenic material;

FIG. c is an agarose gel electrophoresis of a DNA fragment containing the second half of the transgene and the right border of the vector in the amplified transgenic material;

FIG. d is an agarose gel electrophoresis of DNA fragments of both the exogenous gene and the endogenous gene containing the mutation site;

FIG. e is a fluorescent peak diagram of sequencing the wild-type gene transformed in c, with the arrow indicating the mutation site;

FIG. f is a fluorescent peak diagram of sequencing the mutant gene transformed in c, with the arrow indicating the mutation site;

FIG. g is a fluorescent peak diagram of the exogenous wild-type gene and the endogenous gene transformed in step d by sequencing, and the arrow marks the mutation site;

FIG. h is a fluorescent peak diagram of the exogenous mutant gene and the endogenous gene transformed in step d by sequencing, and the arrow marks the mutation site.

Detailed Description

The following detailed description of specific embodiments of the invention is, but it should be understood that the invention is not limited to specific embodiments. All other embodiments, which can be made by those skilled in the art based on the embodiments of the invention without making any inventive effort, are intended to be within the scope of the invention. The experimental methods described in the examples of the present invention are conventional methods unless otherwise specified.

Example 1

Biological material:

mutagenesis of maize inbred line B73 by ethyl methylsulfonate (Ethyl Methane Sulfonate, EMS) to obtain a mutant dos1 encoding the alpha-tubulin gene (Zm 00001d 013367)drought-overly-sensitive1). I.e., the mutants were from the library of mutants created by EMS mutagenesis of maize inbred B73.

The vector pCM3300 used for the transgene was given by the teaching of China agricultural university Guo Yan.

The genes of the dos1 mutants have not been confirmed before this application, i.e. it is unknown which gene is mutated in the dos1 mutant in particular.

The genome nucleotide sequence of the Zm00001d013367 gene (https:// www.maizegdb.org /) is shown as SEQ ID NO.1, and the protein amino acid sequence P001 encoded by the T001 is shown as SEQ ID NO. 2.

SEQ ID NO.1：

ATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCTGGTATCCAGGTCGGAAACGCGTGCTGGGAGCTG TACTGCCTCGAGCATGGCATTCAGGTAACGAACCGTCCATTTCCACTCCTGTTCTCGCGTTGTTGAGGTAGATCTGTACGGATCTGTACCGTCACATACATGTAGATCTATAATCGGTATGGGGGGATTTCGTCGTTCATGTGTGCCTGATTTGGTGTGGCTGAATCGCGGAAGAAATGGTATTTCAGATCGTTAGATCTGTACGGATCTGCTTGTATGTGACTGTGGCTACCCAGATCCCCGTTTGCTATGTCTGAACCGTAGATCCGTTAGAATGGTGTGGTTACAATTGTTTTTAACTGGAATTTTGATACGTAGCATCTGAATAGAGATCACCCCGAAATTGCACATTATTTTCCATTATCAATCTAGTAGTTAGGTATCGTAATTGTTGTTGGTTTTGCCTATGTGTTGTAGATCTGAACGCCCTGAAGTCGTTTAAATGTACTGTAAATCTGGATCTGTAAATTTTAATAGGCCATTTTCTTATTCACAGCTTATATGTCAGCCTTGATACAGATACAGTGCATTGTGCGTTTAATGTTAGTTTGATGTACATCATTTCGATCTGTTAATAGATCCGCAAAAAAAATTGTACACATTGGCGTTAGGCACGTAATCCATTTAGATTTTACTGTTTAGATCTGTTAGAAATGGGATGGAAGATGCCATGCTGTTTATTAACTGTTTAGATCCATTTTGATTTTACTGTTTAGATCTGTTAGAAATGGGATGGAAGATGCTATACTGTTTAGATCTGCAGGATAAATGTTGATGATTATTTGCATGTTTACAATCTATGAATAGTTATTCGAAACATGGCCATTGGTGCACGCGCTGCTGCCACTTTTAGATCGTGATGATCTGTCTGGTGTACTAGTGGCATGTAGTGTTTACGCTTCTAATGCATTTGAATTATATGTTCGACTTTTGTAAGTTGCATAAATAATGCGGCTATGACTGTTTTCTATTCAGGCTGATGGCCAGATGCCCGGTGACAAGACCATTGGGGGAGGTGATGATGCTTTCAACACCTTCTTCAGTGAGACTGGCGCTGGGAAGCACGTCCCCCGTGCTGTTTTTGTTGACCTTGAGCCCACTGTCATCGATGAGGTGAGGACTGGCACCTACCGCCAGCTCTTCCATCCTGAGCAGCTCATCAGTGGCAAGGAGGATGCAGCCAACAACTTCGCTCGTGGTCACTACACCAGTAAGTAATCTGATCGGATCTTAAGTTGGCATTGATCCCAGATATTCAATCTGTAATGAAAACCATACTTAAACTTGATTTGCTTGTCTTGCAGTTGGC AAGGAGATTGTTGACCTGTGCCTTGACCGCATCAGGAAGCTTGCAGATAATTGCACTGGTCTCCAGGGCTTCCTCGT CTTCAACGCTGTTGGTGGAGGAACGGGCTCTGGGCTTGGTTCTCTCCTCCTGGAGCGCCTGTCTGTTGACTATGGCA AGAAGTCCAAGCTCGGTTTCACCGTGTACCCATCCCCCCAGGTGTCCACATCCGTGGTTGAGCCATACAACAGTGTC CTGTCCACCCACTCTCTCCTCGAGCACACTGATGTTGCTGTCCTGCTCGACAATGAGGCCATCTATGACATCTGCCG CCGCTCCCTTGACATTGAGCGCCCAACCTACACCAACCTCAACAGGCTTGTCTCCCAGGTACTGTCTCTGTGTACTGTACTGGCTTTGGATTCAGTCTGATTTGTATTCTTGGCTTTTGTCTAACCATTGGCTCTTACTGATGTTGTTCAGGTC ATCTCATCCCTGACGGCTTCCCTGAGGTTCGATGGTGCTCTGAACGTTGATGTGAACGAGTTCCAGACCAACCTGGT GCCCTACCCGAGGATCCACTTCATGCTTTCGTCCTACGCTCCAGTCATTTCTGCTGAGAAGGCCTACCACGAGCAGC TGTCCGTGGCTGAAATCACCAACAGCGCCTTCGAGCCATCCTCCATGATGGCCAAGTGCGACCCCCGCCATGGCAAG TACATGGCATGCTGCCTCATGTACCGTGGTGATGTGGTTCCCAAGGACGTGAACGCTGCTGTGGCCACAATCAAGAC CAAGCGCACCATCCAGTTCGTGGACTGGTGCCCGACTGGCTTCAAGTGCGGAATCAACTACCAGCCTCCCAGCGTCG TCCCAGGCGGTGATCTGGCCAAGGTGCAGCGTGCCGTGTGTATGATCTCCAACTCCACCAGTGTTGTGGAGGTCTTC TCCCGCATTGACCACAAGTTCGACCTCATGTACGCCAAGCGCGCCTTCGTGCACTGGTACGTCGGTGAGGGTATGGA GGAGGGCGAGTTCTCCGAGGCTCGTGAGGATCTGGCGGCGCTTGAGAAGGACTACGAGGAGGTCGGTGCTGAGTTTG ACGAGGGTGAGGACGGCGACGAGGGTGACGAGTACTAG

Description: the underlined section indicates the sequence of 4 exons of the Zm00001d013367 gene transcript T001, the remainder being intronic sequences.

SEQ ID NO.2：

MRECISIHIGQAGIQVGNACWELYCLEHGIQADGQMPGDKTIGGGDDAFNTFFSETGAGKHVPRAVFVDLEPTVIDEVRTGTYRQLFHPEQLISGKEDAANNFARGHYTIGKEIVDLCLDRIRKLADNCTGLQGFLVFNAVGGGTGSGLGSLLLERLSVDYGKKSKLGFTVYPSPQVSTSVVEPYNSVLSTHSLLEHTDVAVLLDNEAIYDICRRSLDIERPTYTNLNRLVSQVISSLTASLRFDGALNVDVNEFQTNLVPYPRIHFMLSSYAPVISAEKAYHEQLSVAEITNSAFEPSSMMAKCDPRHGKYMACCLMYRGDVVPKDVNAAVATIKTKRTIQFVDWCPTGFKCGINYQPPSVVPGGDLAKVQRAVCMISNSTSVVEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEEVGAEFDEGEDGDEGDEY

1. The corn gene DOS1 is critical to the development of corn seedlings

The maize inbred line B73 and dos1 are sown in summer at the crop stress adaptation and improvement national key laboratory crop species planting base of Henan university and planted in winter at the Henan south Breeding base.

As shown in FIGS. 1a-d, M obtained by mutagenesis ₂ In the generation material, a wilting mutant is found in one strain during the field phenotype identification. Under the condition of soil non-drought, the upper leaf of the mutant is wilted, and particularly, the phenotype is obvious in the bell mouth period, and the lower leaf is normal. Wilting mutantThe inbred offspring separates out the normal, wilting and core rolling 3 phenotypes, the core leaves of the core rolling plants are tightly wrapped by the wilting leaves and are in a shape of a straw, and sometimes the core leaves arch outwards like a bow, so that the life history cannot be completed, and the mutants are propagated and stored through heterozygotes. The phenotype of the core plant is generally on leaf 3, wilting plant phenotype is generally on leaf 7 and leaf 8, if hot dry weather is encountered, the phenotype of the core plant is earliest on leaf 2, and wilting plant phenotype is on leaf 5 and leaf 6. Indicating that the mutant phenotype was advanced by hot dry weather, the mutant was hypersensitive to drought and was designated dos1 (draft-overly sensitivity 1).

The dos1 heterozygote plant has low transpiration rate in the morning or in overcast and rainy days with lower air temperature and higher air humidity, and has no obvious wilting phenotype; if the air temperature is increased, the illumination is enhanced, the humidity is reduced, the transpiration is accelerated, and the tender leaves on the upper part of the plant gradually wilt. With the progress of growth, the leaves which are wilted originally gradually return to normal, the newly grown tender leaves are wilted again until flowering, and the plants generally return to normal. The core phenotype of dos1 homozygotes cannot be recovered at night, the plant growth is very slow, and far behind wild type B73 and heterozygotes, and the final plant height is generally not more than 20cm.

As shown in fig. 1e, the stem Flow rate of corn stems was measured using the dynnage Flow32-1K wrap stem Flow meter system and dynnage sensor in the united states and the moisture transport rate of threaded native xylem catheter mutant hybrid corn was found to be significantly lower than that of ring-line native xylem catheter wild-type corn.

The measuring method comprises the following steps: after 45 days of sowing, stem fluid Flow between 3 nodes of randomly selected wild type and dos1 heterozygote plants was measured using Dynagage Flow32-1K, 3 biological replicates. The cross-sectional area of the stem is calculated according to the calculation formula of the elliptical area. Stem flow data were collected every 3 minutes and daily changes in stem flow rate of plants were recorded.

2. Mutation of the maize DOS1 gene affects the pattern of primary xylem secondary cell wall thickening

As shown in fig. 2, a significant difference in the structure of the secondary cell wall of the primary xylem between the wild-type and mutant dos1 stem nodes was found by observation with a scanning electron microscope (Scanning Electron Microscope, SEM). The primary xylem catheter secondary cell wall of the stem of the wild plant is mainly in an annular thickening mode (94%), and spiral thickening is intermittently distributed among annular thickening. The primary xylem secondary cell wall of dos1 heterozygote is mainly thickened in a spiral shape (82%) and is in a single spiral shape or a double spiral shape. dos1 homozygote is in a multi-strand spiral thickening mode and is highly extruded to form a very short secondary cell wall conduit. The dos1 heterozygotes and homozygotes have smaller native xylem vessel diameters than the wild type. The nondestructive detection of the native xylem vessels in the leaves by using a high-resolution X-ray three-dimensional microscopic imaging (high-resolution X-ray micro-computed tomography, X [ mu ] CT) technology also proves that the native xylem vessels of the wild type, dos1 heterozygotes and homozygotes of the corn have obvious differences.

The preparation method of the sample observed by the scanning electron microscope comprises the following steps: sections of corn stem sections were cut longitudinally or transversely to about 1mm thickness, fixed with 2.5% glutaraldehyde solution for 24 hours, and the fixed samples were dehydrated with ethanol gradient series 30% ethanol-50% ethanol-70% ethanol-90% ethanol-absolute ethanol. Then at CO ₂ The samples were dried in a critical point drying system (EMITECH K850, uk). Finally, the dried samples were coated with gold particles using an ion coater (MSP-2S, USA). The treated samples were observed using an environmental scanning electron microscope (FEI QUANTA250, USA).

The preparation method of the high-resolution X-ray three-dimensional microscopic imaging sample comprises the following steps: corn leaves were cut longitudinally into strips about 1mm wide and fixed with 3% (v/v) glutaraldehyde. The fixed samples were dehydrated with ethanol gradient series 30% ethanol-50% ethanol-70% ethanol-90% ethanol-absolute ethanol. Subsequently, tert-butanol was replaced with ethanol by a gradient series of 30% tert-butanol-50% tert-butanol-70% tert-butanol-90% tert-butanol-pure tert-butanol using absolute ethanol. Finally, the samples were dried in a vacuum freeze dryer (CoolSafe 110, denmark).

The corn trunk sample is subjected to phase contrast imaging by utilizing a 3.5GeV wiggler source beam line-X-ray imaging and biomedical application beam line (BL 13W 1) of a third generation light source of an Shanghai synchrotron radiation light source. Polychromatic X-rays generated by a wiggler source beam line are monochromatized by a bimorph monochromator. The X-ray cross section is 5mm 5mm@30m@20keV. The detector is Optique Peter (model: MICRX 016) containing 2048 x 2048 pixels CMOS of HAMAMATSU (model: ORCAFlash 4.0C11440). The basic pixel is 6.5 mu m, and after 20 times of optical zooming, the equivalent pixel can reach 0.325 mu m. Successive X-ray images were taken at a frame rate of 5 frames per second (fps) and an exposure time of 500 milliseconds using a 20X objective lens at a temperature of 25 c and a relative humidity of 39-57%. The photon energy of CT was 15kev and the distance from the sample to the detector was 70mm. 1080 projections were collected during a 180 degree rotation, with an exposure time of 0.5 seconds for each projection. Projection phase recovery and slice reconstruction are performed using PITRE. Three-dimensional visualization is achieved by commercial software VGSTUDIO MAX 3.2. Finally, three-dimensional images or videos were synthesized using commercial software Amira.

3. The maize DOS1 gene encodes a tubulin necessary for the development of the hydraulic structure of the native xylem

As shown in FIG. 3a, mutant dos1 was constructed with Mo17 as F ₂ The mutant genes in mutant dos1 were mapped using the map-based cloning technique. The results show that: DOS1 is located between the two SSR markers umc2036 and bnlg1660 (about 6 Mb). Backcrossing the mutant dos1 with maize inbred line Mo17 for 6 generations, selfing for 1 generation to obtain Near Isogenic Lines (NILs) of Mo17 background, and carrying out whole genome resequencing analysis to find that mutation of G:C-A:T occurs at the 586 th site of Zm00001d013367 coding region sequence T001 in the mutant dos1, so that the 196 th amino acid of protein P001 coded by the gene is changed from glutamic acid to lysine.

As shown in FIG. 3b, DOS1 (Zm 00001d 013367) encodes a highly conserved α -tubulin family member in maize. Since the mutant is capable of developing a mutant phenotype under normal conditions, no additional phenotypic identification conditions are required. Genetic statistical analysis shows that the mutant gene belongs to co-dominant gene.

As shown in FIGS. 3c-h, the present invention further constructs pCM3300 vector (DOS 1pro:: YFP-DOS 1) of DOS1 gene containing self promoter and T001 coding sequence fused with Yellow Fluorescent Protein (YFP) and transferred into receptor inbred line B73-329. The fused Yellow Fluorescent Protein (YFP) was observed using confocal microscopy to determine the localization of DOS1 protein to the native xylem between the growing leaf sheath and stem node. The expression pattern of DOS1 gene during xylem development was examined using in situ hybridization techniques. The results show that DOS1 mRNAnti sense probe binds complementarily to DOS1mRNA sequence at the site of the leaf internal primary xylem development during shoot tip development, i.e., DOS1 has strong expression in xylem developing tissues.

The primers designed to fuse the yellow fluorescent protein include:

ZmTTA 4InR primer (gene sequence is shown in SEQ ID NO. 10);

pri1-DOS1cDNAF primer (the gene sequence is shown as SEQ ID NO. 11);

pri2-DOS1cDNAR primer (gene sequence shown in SEQ ID NO. 12);

pri3-YFPproF primer (gene sequence shown in SEQ ID NO. 13);

pri4-YFPproR primer (gene sequence shown in SEQ ID NO. 14);

pri5-DOS1ORFF primer (gene sequence shown in SEQ ID NO. 15);

SEQ ID NO.10:

CGATCGGGGAAATTCGAGCTCCTAGTACTCGTCACCCTCGTCGC

SEQ ID NO.11:TGGAACCCTACACTGAGAACC

SEQ ID NO.12:AAGAACCGACAGAAACATAACA

SEQ ID NO.13:CAACAACACCATGGGATCCACCATGGTGAGC

SEQ ID NO.14:CTCCCTCATTCTAGAGGATCCGTTCAAGTCTTCT

SEQ ID NO.15:GATCCTCTAGAATGAGGGAGTGCATCTCGATCC

primers used for in situ hybridization:

DOS1-Long Probe-F primer (gene sequence is shown as SEQ ID NO. 16);

DOS1-Long Probe-R+T7 primer (the gene sequence is shown as SEQ ID NO. 17);

DOS1-Short Probe-F primer (gene sequence is shown as SEQ ID NO. 18);

DOS1-Short Probe-R+T7 primer (gene sequence is shown as SEQ ID NO. 19);

SEQ ID NO.16:GACAAGACCATTGGGGGAGG

SEQ ID NO.17:

GTAATACGACTCACTATAGGGCGGCCTGCTCGAAGCAAGAAAAT

SEQ ID NO.18:TGTGCCACTGCTATCCTGTG

SEQ ID NO.19:

GTAATACGACTCACTATAGGGCGGCAACTCGTGTGCTGCTCTC

as shown in FIG. 4, the inventors further constructed pCM3300 vector (DOS 1pro:: DOS 1) containing the genomic sequence of the self promoter and mutant gene ^G586/A586 ) The transgenic corn with the phenotype consistent with DOS1 is obtained by transferring the transgenic corn into a receptor inbred line B104 and taking a wild type gene (DOS 1pro: DOS 1) as a control, and the mutation of Zm00001d013367 gene is proved to cause the related phenotype of the mutant. The relevant experimental procedure is briefly described below.

The genome sequence of Zm00001d013367 (full length 2494 bp) was amplified and sequenced (Beijing qing department of biotechnology Co., ltd. (http:// www.tsingke.net/shop)) using primers TUA4gDNA-S (gene sequence shown in SEQ ID NO. 3) and TUA4gDNA-A (gene sequence shown in SEQ ID NO. 4).

Construction of recombinant vector pCM 3300: (1) The vector pCM3300 (taught by China agricultural university Guo Yan) was digested with SpeI and SacI, and the linear vector was recovered for use. (2) The fragment containing the Zm00001d013367 gene promoter is pre-amplified by using the primers TUA4 promter-6S (the gene sequence is shown as SEQ ID NO. 5) and TUA4 promter-6A (the gene sequence is shown as SEQ ID NO. 6) and used as a template, and then the promoter fragment is obtained by amplifying the primers ZmTTA 4promInF (the gene sequence is shown as SEQ ID NO. 7) and ZmTTA 4promInR (the gene sequence is shown as SEQ ID NO. 8). (3) The genome sequence fragment containing Zm00001d013367 is pre-amplified by using the primers TUA4gDNA-S and TUA4gDNA-A and used as a template, and then the genome fragment Zm00001d013367 is obtained by amplifying the primers ZmTTA 4InF (the gene sequence is shown as SEQ ID NO. 9) and ZmTTA 4InR (the gene sequence is shown as SEQ ID NO. 10). (4) By commercialization

MultiS One Step Cloning Kit(C113-02, http:// www.vazyme.com /) homologous recombination of pCM3300 linear vector, promoter fragment and Zm00001d013367 genomic fragment to obtain recombinant vector of pCM 3300. Corn genetic transformation is completed by Henan university crop stress adaptation and improvement of national key laboratory corn transgenic platform and Beijing Bomeixing Oriental Co.

SEQ ID NO.3:CAGGCTGTCGTTCCGTTCTA

SEQ ID NO.4:AAGGCGTAAGTAAGCATTGAGG

SEQ ID NO.5:CCACAACCGACCCCAACATT

SEQ ID NO.6:TTCCGACCTGGATACCAGCC

SEQ ID NO.7:

CGGATCCATTTAAATACTAGTCCACAACCGACCCCAACA

SEQ ID NO.8:CACTCCCTCATGGTGTTGTTGAACGGGGGGAGCGGC

SEQ ID NO.9:TTCAACAACACCATGAGGGAGTGCATCTCGATCC

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. It is therefore intended that the following claims be interpreted as including the preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various modifications and variations can be made to the present invention without departing from the spirit or scope of the invention. Thus, it is intended that the present invention also include such modifications and alterations insofar as they come within the scope of the appended claims or the equivalents thereof.

Sequence listing

<110> university of Henan, three-grade institute of Henan university

<120> application of corn Zm00001d013367 gene in regulating and controlling primary xylem development and water transportation thereof

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2494

<212> DNA

<213> corn

<400> 1

atgagggagt gcatctcgat ccacatcggc caggctggta tccaggtcgg aaacgcgtgc 60

tgggagctgt actgcctcga gcatggcatt caggtaacga accgtccatt tccactcctg 120

ttctcgcgtt gttgaggtag atctgtacgg atctgtaccg tcacatacat gtagatctat 180

aatcggtatg gggggatttc gtcgttcatg tgtgcctgat ttggtgtggc tgaatcgcgg 240

aagaaatggt atttcagatc gttagatctg tacggatctg cttgtatgtg actgtggcta 300

cccagatccc cgtttgctat gtctgaaccg tagatccgtt agaatggtgt ggttacaatt 360

gtttttaact ggaattttga tacgtagcat ctgaatagag atcaccccga aattgcacat 420

tattttccat tatcaatcta gtagttaggt atcgtaattg ttgttggttt tgcctatgtg 480

ttgtagatct gaacgccctg aagtcgttta aatgtactgt aaatctggat ctgtaaattt 540

taataggcca ttttcttatt cacagcttat atgtcagcct tgatacagat acagtgcatt 600

gtgcgtttaa tgttagtttg atgtacatca tttcgatctg ttaatagatc cgcaaaaaaa 660

attgtacaca ttggcgttag gcacgtaatc catttagatt ttactgttta gatctgttag 720

aaatgggatg gaagatgcca tgctgtttat taactgttta gatccatttt gattttactg 780

tttagatctg ttagaaatgg gatggaagat gctatactgt ttagatctgc aggataaatg 840

ttgatgatta tttgcatgtt tacaatctat gaatagttat tcgaaacatg gccattggtg 900

cacgcgctgc tgccactttt agatcgtgat gatctgtctg gtgtactagt ggcatgtagt 960

gtttacgctt ctaatgcatt tgaattatat gttcgacttt tgtaagttgc ataaataatg 1020

cggctatgac tgttttctat tcaggctgat ggccagatgc ccggtgacaa gaccattggg 1080

ggaggtgatg atgctttcaa caccttcttc agtgagactg gcgctgggaa gcacgtcccc 1140

cgtgctgttt ttgttgacct tgagcccact gtcatcgatg aggtgaggac tggcacctac 1200

cgccagctct tccatcctga gcagctcatc agtggcaagg aggatgcagc caacaacttc 1260

gctcgtggtc actacaccag taagtaatct gatcggatct taagttggca ttgatcccag 1320

atattcaatc tgtaatgaaa accatactta aacttgattt gcttgtcttg cagttggcaa 1380

ggagattgtt gacctgtgcc ttgaccgcat caggaagctt gcagataatt gcactggtct 1440

ccagggcttc ctcgtcttca acgctgttgg tggaggaacg ggctctgggc ttggttctct 1500

cctcctggag cgcctgtctg ttgactatgg caagaagtcc aagctcggtt tcaccgtgta 1560

cccatccccc caggtgtcca catccgtggt tgagccatac aacagtgtcc tgtccaccca 1620

ctctctcctc gagcacactg atgttgctgt cctgctcgac aatgaggcca tctatgacat 1680

ctgccgccgc tcccttgaca ttgagcgccc aacctacacc aacctcaaca ggcttgtctc 1740

ccaggtactg tctctgtgta ctgtactggc tttggattca gtctgatttg tattcttggc 1800

ttttgtctaa ccattggctc ttactgatgt tgttcaggtc atctcatccc tgacggcttc 1860

cctgaggttc gatggtgctc tgaacgttga tgtgaacgag ttccagacca acctggtgcc 1920

ctacccgagg atccacttca tgctttcgtc ctacgctcca gtcatttctg ctgagaaggc 1980

ctaccacgag cagctgtccg tggctgaaat caccaacagc gccttcgagc catcctccat 2040

gatggccaag tgcgaccccc gccatggcaa gtacatggca tgctgcctca tgtaccgtgg 2100

tgatgtggtt cccaaggacg tgaacgctgc tgtggccaca atcaagacca agcgcaccat 2160

ccagttcgtg gactggtgcc cgactggctt caagtgcgga atcaactacc agcctcccag 2220

cgtcgtccca ggcggtgatc tggccaaggt gcagcgtgcc gtgtgtatga tctccaactc 2280

caccagtgtt gtggaggtct tctcccgcat tgaccacaag ttcgacctca tgtacgccaa 2340

gcgcgccttc gtgcactggt acgtcggtga gggtatggag gagggcgagt tctccgaggc 2400

tcgtgaggat ctggcggcgc ttgagaagga ctacgaggag gtcggtgctg agtttgacga 2460

gggtgaggac ggcgacgagg gtgacgagta ctag 2494

<210> 2

<211> 451

<212> PRT

<213> corn

<400> 2

Met Arg Glu Cys Ile Ser Ile His Ile Gly Gln Ala Gly Ile Gln Val

1 5 10 15

Gly Asn Ala Cys Trp Glu Leu Tyr Cys Leu Glu His Gly Ile Gln Ala

20 25 30

Asp Gly Gln Met Pro Gly Asp Lys Thr Ile Gly Gly Gly Asp Asp Ala

35 40 45

Phe Asn Thr Phe Phe Ser Glu Thr Gly Ala Gly Lys His Val Pro Arg

50 55 60

Ala Val Phe Val Asp Leu Glu Pro Thr Val Ile Asp Glu Val Arg Thr

65 70 75 80

Gly Thr Tyr Arg Gln Leu Phe His Pro Glu Gln Leu Ile Ser Gly Lys

85 90 95

Glu Asp Ala Ala Asn Asn Phe Ala Arg Gly His Tyr Thr Ile Gly Lys

100 105 110

Glu Ile Val Asp Leu Cys Leu Asp Arg Ile Arg Lys Leu Ala Asp Asn

115 120 125

Cys Thr Gly Leu Gln Gly Phe Leu Val Phe Asn Ala Val Gly Gly Gly

130 135 140

Thr Gly Ser Gly Leu Gly Ser Leu Leu Leu Glu Arg Leu Ser Val Asp

145 150 155 160

Tyr Gly Lys Lys Ser Lys Leu Gly Phe Thr Val Tyr Pro Ser Pro Gln

165 170 175

Val Ser Thr Ser Val Val Glu Pro Tyr Asn Ser Val Leu Ser Thr His

180 185 190

Ser Leu Leu Glu His Thr Asp Val Ala Val Leu Leu Asp Asn Glu Ala

195 200 205

Ile Tyr Asp Ile Cys Arg Arg Ser Leu Asp Ile Glu Arg Pro Thr Tyr

210 215 220

Thr Asn Leu Asn Arg Leu Val Ser Gln Val Ile Ser Ser Leu Thr Ala

225 230 235 240

Ser Leu Arg Phe Asp Gly Ala Leu Asn Val Asp Val Asn Glu Phe Gln

245 250 255

Thr Asn Leu Val Pro Tyr Pro Arg Ile His Phe Met Leu Ser Ser Tyr

260 265 270

Ala Pro Val Ile Ser Ala Glu Lys Ala Tyr His Glu Gln Leu Ser Val

275 280 285

Ala Glu Ile Thr Asn Ser Ala Phe Glu Pro Ser Ser Met Met Ala Lys

290 295 300

Cys Asp Pro Arg His Gly Lys Tyr Met Ala Cys Cys Leu Met Tyr Arg

305 310 315 320

Gly Asp Val Val Pro Lys Asp Val Asn Ala Ala Val Ala Thr Ile Lys

325 330 335

Thr Lys Arg Thr Ile Gln Phe Val Asp Trp Cys Pro Thr Gly Phe Lys

340 345 350

Cys Gly Ile Asn Tyr Gln Pro Pro Ser Val Val Pro Gly Gly Asp Leu

355 360 365

Ala Lys Val Gln Arg Ala Val Cys Met Ile Ser Asn Ser Thr Ser Val

370 375 380

Val Glu Val Phe Ser Arg Ile Asp His Lys Phe Asp Leu Met Tyr Ala

385 390 395 400

Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu Gly Met Glu Glu Gly

405 410 415

Glu Phe Ser Glu Ala Arg Glu Asp Leu Ala Ala Leu Glu Lys Asp Tyr

420 425 430

Glu Glu Val Gly Ala Glu Phe Asp Glu Gly Glu Asp Gly Asp Glu Gly

435 440 445

Asp Glu Tyr

450

<210> 3

<211> 20

<212> DNA

<213> artificial sequence

<400> 3

caggctgtcg ttccgttcta 20

<210> 4

<211> 22

<212> DNA

<213> artificial sequence

<400> 4

aaggcgtaag taagcattga gg 22

<210> 5

<211> 20

<212> DNA

<213> artificial sequence

<400> 5

ccacaaccga ccccaacatt 20

<210> 6

<211> 20

<212> DNA

<213> artificial sequence

<400> 6

ttccgacctg gataccagcc 20

<210> 7

<211> 39

<212> DNA

<213> artificial sequence

<400> 7

cggatccatt taaatactag tccacaaccg accccaaca 39

<210> 8

<211> 36

<212> DNA

<213> artificial sequence

<400> 8

cactccctca tggtgttgtt gaacgggggg agcggc 36

<210> 9

<211> 34

<212> DNA

<213> artificial sequence

<400> 9

ttcaacaaca ccatgaggga gtgcatctcg atcc 34

<210> 10

<211> 44

<212> DNA

<213> artificial sequence

<400> 10

cgatcgggga aattcgagct cctagtactc gtcaccctcg tcgc 44

<210> 11

<211> 21

<212> DNA

<213> artificial sequence

<400> 11

tggaacccta cactgagaac c 21

<210> 12

<211> 22

<212> DNA

<213> artificial sequence

<400> 12

aagaaccgac agaaacataa ca 22

<210> 13

<211> 31

<212> DNA

<213> artificial sequence

<400> 13

caacaacacc atgggatcca ccatggtgag c 31

<210> 14

<211> 34

<212> DNA

<213> artificial sequence

<400> 14

ctccctcatt ctagaggatc cgttcaagtc ttct 34

<210> 15

<211> 33

<212> DNA

<213> artificial sequence

<400> 15

gatcctctag aatgagggag tgcatctcga tcc 33

<210> 16

<211> 20

<212> DNA

<213> artificial sequence

<400> 16

gacaagacca ttgggggagg 20

<210> 17

<211> 44

<212> DNA

<213> artificial sequence

<400> 17

gtaatacgac tcactatagg gcggcctgct cgaagcaaga aaat 44

<210> 18

<211> 20

<212> DNA

<213> artificial sequence

<400> 18

tgtgccactg ctatcctgtg 20

<210> 19

<211> 43

<212> DNA

<213> artificial sequence

<400> 19

gtaatacgac tcactatagg gcggcaactc gtgtgctgct ctc 43

Claims

1. The application of the Zm00001d013367 gene of corn in regulating and controlling the development of the primary xylem and the water transportation of the primary xylem is characterized in that the nucleotide sequence of the Zm00001d013367 gene is shown as SEQ ID NO.1, and the amino acid sequence of the coded protein is shown as SEQ ID NO. 2.

2. The use of the Zm00001d013367 gene of maize in regulating primary xylem development and its moisture transport according to claim 1, wherein the protein encoded by Zm00001d013367 gene is an α -tubulin.

3. The use of the Zm00001d013367 gene of maize in claim 2 for regulating primary xylem development and its moisture transport, wherein said α -tubulin regulates primary xylem duct secondary cell wall thickening pattern affecting moisture transport.

4. The use of the Zm00001d013367 gene of maize in regulating primary xylem development and its moisture transport according to claim 3, wherein the Zm00001d013367 gene is used for regulating primary xylem duct secondary cell wall thickening pattern.

5. The use of the Zm00001d013367 gene of maize in regulating primary xylem development and its moisture transport according to claim 4, wherein the Zm00001d013367 gene is used for maintaining primary xylem ring structure.

6. The use of the maize Zm00001d013367 gene of claim 5 for modulating primary xylem development and its moisture transport, wherein the ring primary xylem facilitates moisture transport while allowing organ elongation.