CN113913452A

CN113913452A - Application of corn Zm00001d013367 gene in regulation and control of development of native xylem and water transportation of native xylem

Info

Publication number: CN113913452A
Application number: CN202111186281.0A
Authority: CN
Inventors: 宋纯鹏; 黄世全; 郭思义; 密玲煜; 李文娆; 李保珠; 赵津禾
Original assignee: Sanya Research Institute Of Henan University; Henan University
Current assignee: Sanya Research Institute Of Henan University; Henan University
Priority date: 2021-10-12
Filing date: 2021-10-12
Publication date: 2022-01-11
Anticipated expiration: 2041-10-12
Also published as: CN113913452B

Abstract

The invention relates to the technical field of genetic engineering, and particularly discloses an application of a corn Zm00001d013367 gene in regulation and control of primary xylem development and water transportation thereof, wherein a nucleotide sequence of the Zm00001d013367 gene is shown as SEQ ID No.1, an amino acid sequence of a coded protein is shown as SEQ ID No.2, and a secondary cell wall deposition process in the corn primary xylem development process is regulated and controlled. The Zm00001d013367 gene is used for regulating and controlling the development of the native xylem and the water transportation of the native xylem.

Description

Application of corn Zm00001d013367 gene in regulation and control of development of native xylem and water transportation of native xylem

Technical Field

The invention relates to the technical field of genetic engineering, in particular to application of a corn Zm00001d013367 gene in regulation and control of development of a native xylem and water transportation of the native xylem.

Background

Transpiration of water and photosynthetic CO₂Assimilation and other processes consume a large amount of water in the plant body, particularly in the leaves, and the water in the leaves is mainly supplied through processes of root absorption, xylem transportation and the like. Xylem development and its conduit secondary wall thickening mode are critical in the efficient transport of plant moisture. Xylem is a special tissue structure of terrestrial plants which evolves to adapt to long-distance transportation of water and nutrients, and is most notably characterized in that hollow tubes of circular, spiral, reticular or porous secondary cell walls are formed between a primary wall and a plasma membrane by deposition of cellulose, hemicellulose and lignin. Although the texture or the pore structure of the metaxylum has been shown to affect the pattern of secondary cell wall deposition by ROP11/MIDD1/Kinesin-13A complex-mediated disaggregation of cortical microtubules, no pattern of regulation of the loop or thread structure of the primary xylum has been reported. Microtubule-mediated cellulose, hemicellulose and lignin deposition processes have been described using live cell imaging, but the mechanism of directing microtubule arrays in specific directions in different cell types is still unclear and little is known about the pattern of secondary cell wall thickening of vessels during xylem development in relation to water transport efficiency. Therefore, the research on genes related to plant xylem development is enhanced, the relation between the thickening mode of secondary cell walls of xylem vessels and the water transportation efficiency is revealed, and a new way and thought can be provided for the research on plant stress resistance and the cultivation of new varieties.

Disclosure of Invention

In order to solve the technical problems, the invention provides application of a corn Zm00001d013367 gene in regulation and control of primary xylem development and moisture transportation, wherein the Zm00001d013367 gene can regulate and control a thickening mode of secondary cell walls of primary xylem ducts, so that moisture transportation is influenced.

The invention provides an application of a corn Zm00001d013367 gene in regulation and control of the development of a native xylem and water transportation thereof, wherein the nucleotide sequence of the Zm00001d013367 gene is shown as SEQ ID NO.1, and the amino acid sequence of a coded protein is shown as SEQ ID NO. 2.

Further, the protein coded by the Zm00001d013367 gene is alpha-tubulin.

Further, the alpha-tubulin regulates the primary xylem vessels secondary cell wall thickening pattern, affecting the transport of water.

Further, the Zm00001d013367 gene is used for regulating the primary xylem vessels secondary cell wall thickening pattern.

Further, the Zm00001d013367 gene is used to maintain native xylem ring structures.

Further, the ring-grained native xylem facilitates moisture transport while allowing the organ to elongate.

Compared with the prior art, the invention has the beneficial effects that:

1. compared with the research of model plants such as arabidopsis thaliana and the like, the method has more theoretical and practical significance on agricultural production for the function identification of the important gene Zm00001d013367 for regulating the development of the original wood parts of stems and leaves in the first crop corn in the world;

2. the alpha-tubulin coded by the Zm00001d013367 gene regulates and controls the secondary wall thickening mode of a primary xylem conduit in stems and leaves of the corn, regulates water transportation, and is favorable for breeding and cultivating the corn;

3. the Zm00001d013367 gene provided by the invention is used for maintaining the ring grain structure of the native xylem conduit, is favorable for water transportation, allows organs to stretch, and has guiding significance for breeding corn varieties with high economic yield and biological yield.

Drawings

In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the embodiments or the prior art will be briefly described below, it is obvious that the drawings in the following description are only some embodiments of the present invention, and for those skilled in the art, other drawings can be obtained according to the drawings without creative efforts.

FIG. 1 is a graph of the field corn WT, dos1 phenotype and diurnal stalk flow changes during the large flare period of example 1 of the present invention.

Wherein panel a represents the field phenotype of maize wild type, dos1 hybrids and homozygotes at about 40 days post-sowing under normal growth conditions, Scale bar 10 cm;

panel b shows the appearance of wild type leaves under high temperature weather conditions, Scale bar 10 cm;

panel c shows the appearance of the dos1 hybrid leaf under high temperature weather conditions, Scale bar 10 cm;

panel d shows the homozygous phenotype of dos1, Scale bar 5cm, approximately 15 days after sowing, under normal growth conditions;

panel e wild type and dos1 hybrid diurnal stem flow rates during large flare periods under normal growth conditions, with white and black sections of the abscissa representing day and night respectively;

FIG. 2 is a comparison of dos1 mutant native xylem with wild type in example 1 of the present invention;

wherein, the figure a shows SEM image of the xylem of the wild type stem internodes of the corn after transverse scanning observation and seeding for about 40 days;

FIG. b shows an SEM image of xylem between stem nodes of dos1 hybrid observed by transverse scanning about 40 days after sowing;

FIG. c shows SEM images of the xylem between the stem nodes of dos1 homozygote observed by transverse scanning about 40 days after sowing;

FIG. d is an SEM image of lengthwise scanning of xylem observed between wild type stem nodes of corn after about 40 days of sowing;

FIG. e shows an SEM image of xylem between stem nodes of dos1 hybrid observed by longitudinal scanning about 40 days after sowing;

FIG. f shows SEM images of xylem between stem nodes of dos1 homozygote after longitudinal scanning observation for about 40 days after sowing;

in fig. a-f, Scale bar 100 μm;

FIG. g shows a high resolution X-ray three dimensional microscopic imaging of the native xylem vessels in wild type leaves of maize;

FIG. h shows a high resolution X-ray three-dimensional microscopic imaging of the native xylem vessels in the dos1 hybrid leaf;

FIG. i shows a high resolution X-ray three-dimensional microscopic imaging of the native xylem vessels in the dos1 homozygote leaf;

in fig. g-i, Scale bar 75 μm.

Panel j shows the percentage of ring and thread in the xylem vessels native to the corn wild-type and dos1 hybrids;

panel k shows a comparison of maize wild type, dos1 hybrid and homozygote native xylem vessel diameters;

FIG. 3 is a graphical illustration of the pattern of cloning and expression of DOS1 in example 1 of the present invention;

wherein, FIG. a is a schematic diagram of the map-based cloning of DOS1 in example 1 of the present invention;

FIG. b is a schematic structural view of DOS1 gene in example 1 of the present invention;

FIG. c is a fluorescent and brightfield overlay of YFP-DOS1 leaf sheath transection of transgenic maize DOS1 pro;

FIG. d is a brightfield image of a transgenic maize DOS1pro: YFP-DOS1 leaf sheath transection;

FIG. e is a fluorescent and brightfield overlay of internode longitudinal cuts of YFP-DOS1 stem;

FIG. f is a brightfield view of internode longitudinal cuts of YFP-DOS1 stem segments of transgenic maize DOS1 pro;

in fig. c-f, Scale bar 15 μm;

FIG. g is a micrograph of microtubules in leaf epidermal cells of DOS1pro, YFP-DOS1 transgenic maize, Scale bar 15 μm;

FIG. h is a cross-sectional micrograph of the expression of DOS1mRNA from the base of the developed leaf of the shoot tip of a maize seedling analysed by in situ hybridization technique, Scale bar 10 μm.

FIG. 4 shows maize material transformed with the DOS1 mutant gene of example 1 of the present invention (DOS1pro:: DOS1)^G586 ^/A586) A phenotype similar to the dos1 hybrid;

FIG. a shows transgenic acceptor material B104, wild-type gene (DOS1pro:: DOS1) and mutant gene (DOS1pro:: DOS1)^G586/A586) The phenotype of the transgenic material of (1), Scale bar ═ 10 cm;

FIG. b is an agarose gel electrophoresis image of the amplified DNA fragment containing the left border of the vector and the first half of the transgene in the transgenic material;

FIG. c is an agarose gel electrophoresis image of the amplified DNA fragment containing the second half of the transgene and the right border of the vector in the transgenic material;

FIG. d is an agarose gel electrophoresis image of simultaneously amplifying DNA fragments of the foreign gene and the endogenous gene containing the mutation site;

panel e is a plot of the fluorescence peaks of the transformed wild-type gene identified in c by sequencing, with the arrows indicating the mutation sites;

FIG. f is a graph of fluorescence peaks from sequencing to identify the mutated gene transformed in c, with arrows indicating the sites of mutation;

FIG. g is a fluorescence peak diagram of the exogenous wild-type gene and the endogenous gene transformed in the sequencing identification d, and an arrow marks a mutation site;

panel h is a fluorescence peak image of the exogenous mutant gene and the endogenous gene transformed in the sequencing identification d, and the arrows indicate the mutation sites.

Detailed Description

The following detailed description of specific embodiments of the invention is provided, but it should be understood that the scope of the invention is not limited to the specific embodiments. All other embodiments, which can be obtained by a person skilled in the art without any inventive step based on the embodiments of the present invention, are within the scope of the present invention. The experimental methods described in the examples of the present invention are all conventional methods unless otherwise specified.

Example 1

Biological material:

by means of methanesulfonic acid ethaneMutagenesis of maize inbred line B73 with ester (Ethyl Methane Sulfonate, EMS) to obtain a mutant dos1(Zm00001d013367) encoding the alpha-tubulin gene (Zm00001d013367)drought-overly-sensitive1). I.e., the mutants were from a library of mutants created by EMS mutagenesis of maize inbred line B73.

The vector pCM3300 used for the transgene was given by professor Guo rock, university of agriculture, China.

The dos1 mutant gene was not identified before the present application, i.e., it was not known which gene was mutated in the dos1 mutant.

The Zm00001d013367 gene (https:// www.maizegdb.org /), the genome nucleotide sequence of the gene is shown as SEQ ID NO.1, and the protein amino acid sequence P001 coded by the T001 is shown as SEQ ID NO. 2.

SEQ ID NO.1：

ATGAGGGAGTGCATCTCGATCCACATCGGCCAGGCTGGTATCCAGGTCGGAAACGCGTGCTGGGAGCTG TACTGCCTCGAGCATGGCATTCAGGTAACGAACCGTCCATTTCCACTCCTGTTCTCGCGTTGTTGAGGTAGATCTGTACGGATCTGTACCGTCACATACATGTAGATCTATAATCGGTATGGGGGGATTTCGTCGTTCATGTGTGCCTGATTTGGTGTGGCTGAATCGCGGAAGAAATGGTATTTCAGATCGTTAGATCTGTACGGATCTGCTTGTATGTGACTGTGGCTACCCAGATCCCCGTTTGCTATGTCTGAACCGTAGATCCGTTAGAATGGTGTGGTTACAATTGTTTTTAACTGGAATTTTGATACGTAGCATCTGAATAGAGATCACCCCGAAATTGCACATTATTTTCCATTATCAATCTAGTAGTTAGGTATCGTAATTGTTGTTGGTTTTGCCTATGTGTTGTAGATCTGAACGCCCTGAAGTCGTTTAAATGTACTGTAAATCTGGATCTGTAAATTTTAATAGGCCATTTTCTTATTCACAGCTTATATGTCAGCCTTGATACAGATACAGTGCATTGTGCGTTTAATGTTAGTTTGATGTACATCATTTCGATCTGTTAATAGATCCGCAAAAAAAATTGTACACATTGGCGTTAGGCACGTAATCCATTTAGATTTTACTGTTTAGATCTGTTAGAAATGGGATGGAAGATGCCATGCTGTTTATTAACTGTTTAGATCCATTTTGATTTTACTGTTTAGATCTGTTAGAAATGGGATGGAAGATGCTATACTGTTTAGATCTGCAGGATAAATGTTGATGATTATTTGCATGTTTACAATCTATGAATAGTTATTCGAAACATGGCCATTGGTGCACGCGCTGCTGCCACTTTTAGATCGTGATGATCTGTCTGGTGTACTAGTGGCATGTAGTGTTTACGCTTCTAATGCATTTGAATTATATGTTCGACTTTTGTAAGTTGCATAAATAATGCGGCTATGACTGTTTTCTATTCAGGCTGATGGCCAGATGCCCGGTGACAAGACCATTGGGGGAGGTGATGATGCTTTCAACACCTTCTTCAGTGAGACTGGCGCTGGGAAGCACGTCCCCCGTGCTGTTTTTGTTGACCTTGAGCCCACTGTCATCGATGAGGTGAGGACTGGCACCTACCGCCAGCTCTTCCATCCTGAGCAGCTCATCAGTGGCAAGGAGGATGCAGCCAACAACTTCGCTCGTGGTCACTACACCAGTAAGTAATCTGATCGGATCTTAAGTTGGCATTGATCCCAGATATTCAATCTGTAATGAAAACCATACTTAAACTTGATTTGCTTGTCTTGCAGTTGGC AAGGAGATTGTTGACCTGTGCCTTGACCGCATCAGGAAGCTTGCAGATAATTGCACTGGTCTCCAGGGCTTCCTCGT CTTCAACGCTGTTGGTGGAGGAACGGGCTCTGGGCTTGGTTCTCTCCTCCTGGAGCGCCTGTCTGTTGACTATGGCA AGAAGTCCAAGCTCGGTTTCACCGTGTACCCATCCCCCCAGGTGTCCACATCCGTGGTTGAGCCATACAACAGTGTC CTGTCCACCCACTCTCTCCTCGAGCACACTGATGTTGCTGTCCTGCTCGACAATGAGGCCATCTATGACATCTGCCG CCGCTCCCTTGACATTGAGCGCCCAACCTACACCAACCTCAACAGGCTTGTCTCCCAGGTACTGTCTCTGTGTACTGTACTGGCTTTGGATTCAGTCTGATTTGTATTCTTGGCTTTTGTCTAACCATTGGCTCTTACTGATGTTGTTCAGGTC ATCTCATCCCTGACGGCTTCCCTGAGGTTCGATGGTGCTCTGAACGTTGATGTGAACGAGTTCCAGACCAACCTGGT GCCCTACCCGAGGATCCACTTCATGCTTTCGTCCTACGCTCCAGTCATTTCTGCTGAGAAGGCCTACCACGAGCAGC TGTCCGTGGCTGAAATCACCAACAGCGCCTTCGAGCCATCCTCCATGATGGCCAAGTGCGACCCCCGCCATGGCAAG TACATGGCATGCTGCCTCATGTACCGTGGTGATGTGGTTCCCAAGGACGTGAACGCTGCTGTGGCCACAATCAAGAC CAAGCGCACCATCCAGTTCGTGGACTGGTGCCCGACTGGCTTCAAGTGCGGAATCAACTACCAGCCTCCCAGCGTCG TCCCAGGCGGTGATCTGGCCAAGGTGCAGCGTGCCGTGTGTATGATCTCCAACTCCACCAGTGTTGTGGAGGTCTTC TCCCGCATTGACCACAAGTTCGACCTCATGTACGCCAAGCGCGCCTTCGTGCACTGGTACGTCGGTGAGGGTATGGA GGAGGGCGAGTTCTCCGAGGCTCGTGAGGATCTGGCGGCGCTTGAGAAGGACTACGAGGAGGTCGGTGCTGAGTTTG ACGAGGGTGAGGACGGCGACGAGGGTGACGAGTACTAG

Description of the drawings: the underlined sections indicate the sequences of the 4 exons and the remainder of the intron sequences of the Zm00001d013367 gene transcript T001.

SEQ ID NO.2：

MRECISIHIGQAGIQVGNACWELYCLEHGIQADGQMPGDKTIGGGDDAFNTFFSETGAGKHVPRAVFVDLEPTVIDEVRTGTYRQLFHPEQLISGKEDAANNFARGHYTIGKEIVDLCLDRIRKLADNCTGLQGFLVFNAVGGGTGSGLGSLLLERLSVDYGKKSKLGFTVYPSPQVSTSVVEPYNSVLSTHSLLEHTDVAVLLDNEAIYDICRRSLDIERPTYTNLNRLVSQVISSLTASLRFDGALNVDVNEFQTNLVPYPRIHFMLSSYAPVISAEKAYHEQLSVAEITNSAFEPSSMMAKCDPRHGKYMACCLMYRGDVVPKDVNAAVATIKTKRTIQFVDWCPTGFKCGINYQPPSVVPGGDLAKVQRAVCMISNSTSVVEVFSRIDHKFDLMYAKRAFVHWYVGEGMEEGEFSEAREDLAALEKDYEEVGAEFDEGEDGDEGDEY

Firstly, the corn gene DOS1 is important for the development of corn seedlings

The maize inbred lines B73 and dos1 are sown in the crop cultivation base of the Henan university for stress adaptation and improvement of national key laboratory crops in summer and planted in the Hainan cultivation base in winter.

M obtained by mutagenesis, as shown in FIGS. 1a-d₂In generation materials, wilting mutants exist in one strain when field phenotype identification is carried out. Under the condition of soil non-drought, the upper leaves of the mutant have wilting, especially in the bellmouth period, the phenotype is obvious, and the lower leaves are normal. The selfing progeny of the wilting mutant can separate 3 phenotypes of normal, wilting and core, the core leaves of the core plant are tightly wrapped by the wilting leaves, and are shaped like a straw, and sometimes the core leaves are arched outwards like a bow, so that the life history can not be completed, and therefore, the mutant is bred and stored by a heterozygote. The phenotype of the coiled core plant generally appears on the 3 rd leaf, the phenotype of the wilting plant generally appears on the 7 th leaf and the 8 th leaf, if high-temperature dry weather occurs, the phenotype of the coiled core plant appears on the 2 nd leaf at the earliest time, and the phenotype of the wilting plant appears on the 5 th leaf and the 6 th leaf. Indicating that the mutant phenotype is advanced by high temperature dry weather, so the mutant is hypersensitive to drought and is named as dos1 (drop-over sensitivity 1).

In the morning or in rainy days with low air temperature and high air humidity, the transpiration rate of the dos1 hybrid plant is low, and no obvious wilting phenotype exists at the moment; if the temperature rises, the illumination is enhanced, the humidity is reduced, the transpiration is accelerated, and the young and tender leaves on the upper part of the plant gradually wither. With the growth, the original wilted leaves gradually return to normal, and the newly grown tender leaves return to normal until flowering, so that the plant is recovered to normal overall. The core phenotype of the dos1 homozygote cannot be recovered at night, the plant grows very slowly and far behind the wild type B73 and heterozygotes, and the final plant height generally does not exceed 20 cm.

As shown in fig. 1e, the stem Flow rate of corn stalks was measured using a Dynagage Flow 32-1K-wrap stem Flow meter system and Dynagage sensors, and it was found that the moisture transport rate of corn in the screw native xylem duct mutant hybrid was significantly lower than that of wild-type corn in the ring grain native xylem duct.

The measuring method comprises the following steps: at 45 days after sowing, the Flow of stem fluid between 3 rd nodes of randomly selected wild type and dos1 hybrid plants was measured using Dynagage Flow32-1K, 3 biological replicates. The cross-sectional area of the stem is calculated according to the calculation formula of the elliptical area. Stem flow data were collected every 3 minutes and the daily changes in plant stem flow rate were recorded.

Second, mutation of corn DOS1 gene influences mode of primary xylem secondary cell wall thickening

As shown in FIG. 2, the primary xylem secondary cell wall structure between the wild type and mutant dos1 stem nodes was significantly different as observed by Scanning Electron Microscope (SEM). The primary xylem vessel secondary cell wall of wild type plant stem is mainly in annular thickening mode (94%), spiral thickening is discontinuously distributed between annular thickening. The primary xylem secondary cell wall of the dos1 hybrid is thickened primarily in a spiral (82%) in a single or double helix. dos1 homozygote is a multi-strand spiral thickening pattern, highly compressed, forming a conduit with very short secondary cell walls. Dos1 hybrid and homozygote native xylem vessels were smaller in diameter compared to wild type. The method is characterized in that a high-resolution X-ray micro-computed tomography (X mu CT) technology is used for carrying out nondestructive detection on the native xylem catheter in the leaf, and obvious differences among the native xylem catheter of a wild corn, a dos1 heterozygote and a homozygote are also proved.

The preparation method of the sample observed by the scanning electron microscope comprises the following steps: corn stalk internodes were cut longitudinally or transversely into slices of about 1mm thickness, fixed with 2.5% glutaraldehyde solution for 24 hours, and the fixed samples were dehydrated with an ethanol gradient series of 30% ethanol-50% ethanol-70% ethanol-90% ethanol-absolute ethanol. Then in CO₂The samples were dried in a critical point drying system (EMITECH K850, uk). Finally, the dried samples were coated with gold particles using an ion coating machine (MSP-2S, usa). The treated samples were observed using an environmental scanning electron microscope (FEI QUANTA250, USA).

The preparation method of the high-resolution X-ray three-dimensional microscopic imaging sample comprises the following steps: corn leaves were cut longitudinally into strips approximately 1mm wide and fixed with 3% (v/v) glutaraldehyde. The fixed sample was dehydrated with an ethanol gradient series of 30% ethanol-50% ethanol-70% ethanol-90% ethanol-absolute ethanol. Subsequently, a gradient series of tert-butanol prepared with absolute ethanol, 30% tert-butanol-50% tert-butanol-70% tert-butanol-90% tert-butanol-pure tert-butanol, was used instead of ethanol. Finally, the samples were dried in a vacuum freeze dryer (CoolSafe 110, denmark).

Corn dry samples were phase-contrast imaged using 3.5GeV Wiggler-derived beam-line X-ray imaging, a third generation light source of Shanghai synchrotron radiation, and biomedical applications beam-line (BL13W 1). The polychromatic X-rays generated by the wiggler source beam are monochromatized by a twin crystal monochromator. The X-ray cross section was 5mm @30m @20 keV. The detector is an Optique Peter (model: MICRX016) containing 2048 x 2048 pixel CMOS of HAMAMATSU (model: ORCAFlash 4.0C 11440). The basic pixel is 6.5 μm, and the equivalent pixel can reach 0.325 μm after 20 times of optical zooming. Successive X-ray images were taken at a frame rate of 5 frames per second (fps) and an exposure time of 500 milliseconds using a 20X objective at a temperature of 25 c and a relative humidity of 39-57%. The photon energy of the CT was 15kev and the sample to detector distance was 70 mm. 1080 projections were collected during a 180 degree rotation, and the exposure time for each projection was 0.5 seconds. Projection phase recovery and slice reconstruction are performed using PITRE. Three-dimensional visualization is achieved by commercial software VGSTUDIO MAX 3.2. Finally, a three-dimensional image or video is synthesized using commercial software Amira.

Thirdly, the corn DOS1 gene encodes tubulin necessary for the development of the protoxylem hydraulic structure

As shown in FIG. 3a, mutant dos1 and Mo17 were used to construct F₂And (3) positioning the mutant gene in the mutant dos1 by using a map-based cloning technology. The results show that: DOS1 was located between two SSR markers umc2036 and bnlg1660 (about 6 Mb). Backcrossing the mutant dos1 with a maize inbred line Mo17 for 6 generations and inbred for 1 generation to obtain a Near Isogenic Line (NILs) with a Mo17 background, and finding out the sequence of a Zm00001d013367 coding region in the mutant dos1 through whole genome re-sequencing analysisIn line T001, the 586 site is mutated by G: C → A: T, resulting in the change of the 196 th amino acid of protein P001 encoded by the gene from glutamic acid to lysine.

As shown in fig. 3b, DOS1(Zm00001d013367) encodes a highly conserved alpha-tubulin family member in maize. Because the mutant can generate mutation phenotype under normal conditions, no additional phenotype identification condition is required. Genetic statistical analysis shows that the mutant gene belongs to a codominant gene.

As shown in FIGS. 3c-h, the present invention further constructed pCM3300 vector (DOS1pro:: YFP-DOS1) of DOS1 gene containing self promoter and T001 coding sequence fused with Yellow Fluorescent Protein (YFP) and transferred into recipient inbred line B73-329. Confocal microscopy was used to observe the fused Yellow Fluorescent Protein (YFP) and thereby confirm that DOS1 protein is localized to the native xylem between the growing leaf sheath and stem node. The expression mode of DOS1 gene in the xylem development process is detected by using an in situ hybridization technology. The results show that the DOS1 mRNAsenti sense probe binds complementarily to the DOS1mRNA sequence at the site of leaf internal native xylem development during shoot apex development, i.e., DOS1 is strongly expressed in xylem-developing tissues.

The primers designed by fusing the yellow fluorescent protein comprise:

ZmTUA4InR primer (gene sequence is shown as SEQ ID NO. 10);

pri1-DOS1cDNAF primer (the gene sequence is shown as SEQ ID NO. 11);

pri2-DOS1cDNAR primer (gene sequence is shown in SEQ ID NO. 12);

pri3-YFP pRoF primer (the gene sequence is shown as SEQ ID NO. 13);

pri4-YFP ProR primer (the gene sequence is shown as SEQ ID NO. 14);

pri5-DOS1ORFF primer (the gene sequence is shown as SEQ ID NO. 15);

SEQ ID NO.10:

CGATCGGGGAAATTCGAGCTCCTAGTACTCGTCACCCTCGTCGC

SEQ ID NO.11:TGGAACCCTACACTGAGAACC

SEQ ID NO.12:AAGAACCGACAGAAACATAACA

SEQ ID NO.13:CAACAACACCATGGGATCCACCATGGTGAGC

SEQ ID NO.14:CTCCCTCATTCTAGAGGATCCGTTCAAGTCTTCT

SEQ ID NO.15:GATCCTCTAGAATGAGGGAGTGCATCTCGATCC

primers used for in situ hybridization:

DOS1-Long Probe-F primer (the gene sequence is shown in SEQ ID NO. 16);

DOS1-Long Probe-R + T7 primer (the gene sequence is shown as SEQ ID NO. 17);

DOS1-Short Probe-F primer (the gene sequence is shown in SEQ ID NO. 18);

DOS1-Short Probe-R + T7 primer (the gene sequence is shown as SEQ ID NO. 19);

SEQ ID NO.16:GACAAGACCATTGGGGGAGG

SEQ ID NO.17:

GTAATACGACTCACTATAGGGCGGCCTGCTCGAAGCAAGAAAAT

SEQ ID NO.18:TGTGCCACTGCTATCCTGTG

SEQ ID NO.19:

GTAATACGACTCACTATAGGGCGGCAACTCGTGTGCTGCTCTC

as shown in FIG. 4, the inventors further constructed pCM3300 vector containing the genomic sequence of the self promoter and the mutant gene (DOS1pro:: DOS1)^G586/A586) Transferred into a receptor inbred line B104, and a wild type gene (DOS1pro:: DOS1) is used as a control to obtain a transgenic corn with the phenotype consistent with DOS1, thereby confirming that the mutation of the Zm00001d013367 gene causes the related phenotype of the mutant. The relevant experimental procedures are briefly described below.

Zm00001d013367 gene genome sequence (full length 2494bp) was amplified and sequenced with primers TUA4gDNA-S (gene sequence shown in SEQ ID NO. 3) and TUA4gDNA-A (gene sequence shown in SEQ ID NO. 4) (Zhengzhou division, Kyoto Biotechnology Ltd., Beijing, http:// www.tsingke.net/shop)).

Construction of recombinant vector pCM 3300: (1) vector pCM3300 (donated by professor Guo rock, university of agriculture, China) was digested with Spe I and Sac I, and the linearized vector was recovered for use. (2) Firstly, primers TUA4promoter-6S (gene sequence is shown as SEQ ID NO. 5) and TUA4promoter-6A (gene sequence)Shown as SEQ ID NO. 6) to pre-amplify the segment containing Zm00001d013367 gene promoter as a template, and then amplifying by using primers ZmTUA4promInF (the gene sequence is shown as SEQ ID NO. 7) and ZmTUA4promInR (the gene sequence is shown as SEQ ID NO. 8) to obtain the promoter segment. (3) The genome segment containing Zm00001d013367 is pre-amplified by using primers TUA4gDNA-S and TUA4gDNA-A and is used as a template, and then a ZmTUA4InF (the gene sequence is shown as SEQ ID NO. 9) and a ZmTUA4InR (the gene sequence is shown as SEQ ID NO. 10) are amplified to obtain a Zm00001d013367 genome segment. (4) By commercialization

The pCM3300 linear vector, promoter fragment and Zm00001d013367 genomic fragment were homologously recombined with the MultiS One Step Cloning Kit (C113-02, http:// www.vazyme.com /) to obtain a recombinant vector of pCM 3300. The genetic transformation of the corn is completed by crop stress adaptation and improvement of national key laboratory corn transgenic platform and Beijing Bomeixing Okojic.

SEQ ID NO.3:CAGGCTGTCGTTCCGTTCTA

SEQ ID NO.4:AAGGCGTAAGTAAGCATTGAGG

SEQ ID NO.5:CCACAACCGACCCCAACATT

SEQ ID NO.6:TTCCGACCTGGATACCAGCC

SEQ ID NO.7:

CGGATCCATTTAAATACTAGTCCACAACCGACCCCAACA

SEQ ID NO.8:CACTCCCTCATGGTGTTGTTGAACGGGGGGAGCGGC

SEQ ID NO.9:TTCAACAACACCATGAGGGAGTGCATCTCGATCC

While preferred embodiments of the present invention have been described, additional variations and modifications in those embodiments may occur to those skilled in the art once they learn of the basic inventive concepts. Therefore, it is intended that the appended claims be interpreted as including preferred embodiments and all such alterations and modifications as fall within the scope of the invention.

It will be apparent to those skilled in the art that various changes and modifications may be made in the present invention without departing from the spirit and scope of the invention. Thus, if such modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include such modifications and variations.

Sequence listing

<110> university of Henan, three-membered research institute of Henan university

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 2494

<212> DNA

<213> corn

<400> 1

atgagggagt gcatctcgat ccacatcggc caggctggta tccaggtcgg aaacgcgtgc 60

tgggagctgt actgcctcga gcatggcatt caggtaacga accgtccatt tccactcctg 120

ttctcgcgtt gttgaggtag atctgtacgg atctgtaccg tcacatacat gtagatctat 180

aatcggtatg gggggatttc gtcgttcatg tgtgcctgat ttggtgtggc tgaatcgcgg 240

aagaaatggt atttcagatc gttagatctg tacggatctg cttgtatgtg actgtggcta 300

cccagatccc cgtttgctat gtctgaaccg tagatccgtt agaatggtgt ggttacaatt 360

gtttttaact ggaattttga tacgtagcat ctgaatagag atcaccccga aattgcacat 420

tattttccat tatcaatcta gtagttaggt atcgtaattg ttgttggttt tgcctatgtg 480

ttgtagatct gaacgccctg aagtcgttta aatgtactgt aaatctggat ctgtaaattt 540

taataggcca ttttcttatt cacagcttat atgtcagcct tgatacagat acagtgcatt 600

gtgcgtttaa tgttagtttg atgtacatca tttcgatctg ttaatagatc cgcaaaaaaa 660

attgtacaca ttggcgttag gcacgtaatc catttagatt ttactgttta gatctgttag 720

aaatgggatg gaagatgcca tgctgtttat taactgttta gatccatttt gattttactg 780

tttagatctg ttagaaatgg gatggaagat gctatactgt ttagatctgc aggataaatg 840

ttgatgatta tttgcatgtt tacaatctat gaatagttat tcgaaacatg gccattggtg 900

cacgcgctgc tgccactttt agatcgtgat gatctgtctg gtgtactagt ggcatgtagt 960

gtttacgctt ctaatgcatt tgaattatat gttcgacttt tgtaagttgc ataaataatg 1020

cggctatgac tgttttctat tcaggctgat ggccagatgc ccggtgacaa gaccattggg 1080

ggaggtgatg atgctttcaa caccttcttc agtgagactg gcgctgggaa gcacgtcccc 1140

cgtgctgttt ttgttgacct tgagcccact gtcatcgatg aggtgaggac tggcacctac 1200

cgccagctct tccatcctga gcagctcatc agtggcaagg aggatgcagc caacaacttc 1260

gctcgtggtc actacaccag taagtaatct gatcggatct taagttggca ttgatcccag 1320

atattcaatc tgtaatgaaa accatactta aacttgattt gcttgtcttg cagttggcaa 1380

ggagattgtt gacctgtgcc ttgaccgcat caggaagctt gcagataatt gcactggtct 1440

ccagggcttc ctcgtcttca acgctgttgg tggaggaacg ggctctgggc ttggttctct 1500

cctcctggag cgcctgtctg ttgactatgg caagaagtcc aagctcggtt tcaccgtgta 1560

cccatccccc caggtgtcca catccgtggt tgagccatac aacagtgtcc tgtccaccca 1620

ctctctcctc gagcacactg atgttgctgt cctgctcgac aatgaggcca tctatgacat 1680

ctgccgccgc tcccttgaca ttgagcgccc aacctacacc aacctcaaca ggcttgtctc 1740

ccaggtactg tctctgtgta ctgtactggc tttggattca gtctgatttg tattcttggc 1800

ttttgtctaa ccattggctc ttactgatgt tgttcaggtc atctcatccc tgacggcttc 1860

cctgaggttc gatggtgctc tgaacgttga tgtgaacgag ttccagacca acctggtgcc 1920

ctacccgagg atccacttca tgctttcgtc ctacgctcca gtcatttctg ctgagaaggc 1980

ctaccacgag cagctgtccg tggctgaaat caccaacagc gccttcgagc catcctccat 2040

gatggccaag tgcgaccccc gccatggcaa gtacatggca tgctgcctca tgtaccgtgg 2100

tgatgtggtt cccaaggacg tgaacgctgc tgtggccaca atcaagacca agcgcaccat 2160

ccagttcgtg gactggtgcc cgactggctt caagtgcgga atcaactacc agcctcccag 2220

cgtcgtccca ggcggtgatc tggccaaggt gcagcgtgcc gtgtgtatga tctccaactc 2280

caccagtgtt gtggaggtct tctcccgcat tgaccacaag ttcgacctca tgtacgccaa 2340

gcgcgccttc gtgcactggt acgtcggtga gggtatggag gagggcgagt tctccgaggc 2400

tcgtgaggat ctggcggcgc ttgagaagga ctacgaggag gtcggtgctg agtttgacga 2460

gggtgaggac ggcgacgagg gtgacgagta ctag 2494

<210> 2

<211> 451

<212> PRT

<213> corn

<400> 2

Met Arg Glu Cys Ile Ser Ile His Ile Gly Gln Ala Gly Ile Gln Val

1 5 10 15

Gly Asn Ala Cys Trp Glu Leu Tyr Cys Leu Glu His Gly Ile Gln Ala

20 25 30

Asp Gly Gln Met Pro Gly Asp Lys Thr Ile Gly Gly Gly Asp Asp Ala

35 40 45

Phe Asn Thr Phe Phe Ser Glu Thr Gly Ala Gly Lys His Val Pro Arg

50 55 60

Ala Val Phe Val Asp Leu Glu Pro Thr Val Ile Asp Glu Val Arg Thr

65 70 75 80

Gly Thr Tyr Arg Gln Leu Phe His Pro Glu Gln Leu Ile Ser Gly Lys

85 90 95

Glu Asp Ala Ala Asn Asn Phe Ala Arg Gly His Tyr Thr Ile Gly Lys

100 105 110

Glu Ile Val Asp Leu Cys Leu Asp Arg Ile Arg Lys Leu Ala Asp Asn

115 120 125

Cys Thr Gly Leu Gln Gly Phe Leu Val Phe Asn Ala Val Gly Gly Gly

130 135 140

Thr Gly Ser Gly Leu Gly Ser Leu Leu Leu Glu Arg Leu Ser Val Asp

145 150 155 160

Tyr Gly Lys Lys Ser Lys Leu Gly Phe Thr Val Tyr Pro Ser Pro Gln

165 170 175

Val Ser Thr Ser Val Val Glu Pro Tyr Asn Ser Val Leu Ser Thr His

180 185 190

Ser Leu Leu Glu His Thr Asp Val Ala Val Leu Leu Asp Asn Glu Ala

195 200 205

Ile Tyr Asp Ile Cys Arg Arg Ser Leu Asp Ile Glu Arg Pro Thr Tyr

210 215 220

Thr Asn Leu Asn Arg Leu Val Ser Gln Val Ile Ser Ser Leu Thr Ala

225 230 235 240

Ser Leu Arg Phe Asp Gly Ala Leu Asn Val Asp Val Asn Glu Phe Gln

245 250 255

Thr Asn Leu Val Pro Tyr Pro Arg Ile His Phe Met Leu Ser Ser Tyr

260 265 270

Ala Pro Val Ile Ser Ala Glu Lys Ala Tyr His Glu Gln Leu Ser Val

275 280 285

Ala Glu Ile Thr Asn Ser Ala Phe Glu Pro Ser Ser Met Met Ala Lys

290 295 300

Cys Asp Pro Arg His Gly Lys Tyr Met Ala Cys Cys Leu Met Tyr Arg

305 310 315 320

Gly Asp Val Val Pro Lys Asp Val Asn Ala Ala Val Ala Thr Ile Lys

325 330 335

Thr Lys Arg Thr Ile Gln Phe Val Asp Trp Cys Pro Thr Gly Phe Lys

340 345 350

Cys Gly Ile Asn Tyr Gln Pro Pro Ser Val Val Pro Gly Gly Asp Leu

355 360 365

Ala Lys Val Gln Arg Ala Val Cys Met Ile Ser Asn Ser Thr Ser Val

370 375 380

Val Glu Val Phe Ser Arg Ile Asp His Lys Phe Asp Leu Met Tyr Ala

385 390 395 400

Lys Arg Ala Phe Val His Trp Tyr Val Gly Glu Gly Met Glu Glu Gly

405 410 415

Glu Phe Ser Glu Ala Arg Glu Asp Leu Ala Ala Leu Glu Lys Asp Tyr

420 425 430

Glu Glu Val Gly Ala Glu Phe Asp Glu Gly Glu Asp Gly Asp Glu Gly

435 440 445

Asp Glu Tyr

450

<210> 3

<211> 20

<212> DNA

<213> Artificial sequence

<400> 3

caggctgtcg ttccgttcta 20

<210> 4

<211> 22

<212> DNA

<213> Artificial sequence

<400> 4

aaggcgtaag taagcattga gg 22

<210> 5

<211> 20

<212> DNA

<213> Artificial sequence

<400> 5

ccacaaccga ccccaacatt 20

<210> 6

<211> 20

<212> DNA

<213> Artificial sequence

<400> 6

ttccgacctg gataccagcc 20

<210> 7

<211> 39

<212> DNA

<213> Artificial sequence

<400> 7

cggatccatt taaatactag tccacaaccg accccaaca 39

<210> 8

<211> 36

<212> DNA

<213> Artificial sequence

<400> 8

cactccctca tggtgttgtt gaacgggggg agcggc 36

<210> 9

<211> 34

<212> DNA

<213> Artificial sequence

<400> 9

ttcaacaaca ccatgaggga gtgcatctcg atcc 34

<210> 10

<211> 44

<212> DNA

<213> Artificial sequence

<400> 10

cgatcgggga aattcgagct cctagtactc gtcaccctcg tcgc 44

<210> 11

<211> 21

<212> DNA

<213> Artificial sequence

<400> 11

tggaacccta cactgagaac c 21

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence

<400> 12

aagaaccgac agaaacataa ca 22

<210> 13

<211> 31

<212> DNA

<213> Artificial sequence

<400> 13

caacaacacc atgggatcca ccatggtgag c 31

<210> 14

<211> 34

<212> DNA

<213> Artificial sequence

<400> 14

ctccctcatt ctagaggatc cgttcaagtc ttct 34

<210> 15

<211> 33

<212> DNA

<213> Artificial sequence

<400> 15

gatcctctag aatgagggag tgcatctcga tcc 33

<210> 16

<211> 20

<212> DNA

<213> Artificial sequence

<400> 16

gacaagacca ttgggggagg 20

<210> 17

<211> 44

<212> DNA

<213> Artificial sequence

<400> 17

gtaatacgac tcactatagg gcggcctgct cgaagcaaga aaat 44

<210> 18

<211> 20

<212> DNA

<213> Artificial sequence

<400> 18

tgtgccactg ctatcctgtg 20

<210> 19

<211> 43

<212> DNA

<213> Artificial sequence

<400> 19

gtaatacgac tcactatagg gcggcaactc gtgtgctgct ctc 43

Claims

1. The application of the corn Zm00001d013367 gene in regulation and control of the development of native xylem and water transportation thereof is characterized in that the nucleotide sequence of the Zm00001d013367 gene is shown as SEQ ID NO.1, and the amino acid sequence of the encoded protein is shown as SEQ ID NO. 2.

2. The use of the maize Zm00001d013367 gene in the regulation of xylem development and water transport in accordance with claim 1, wherein the protein encoded by the Zm00001d013367 gene is an α -tubulin.

3. The use of the maize Zm00001d013367 gene in regulating the development of primary xylem and its water transport according to claim 2, wherein the α -tubulin regulates the primary xylem vessels secondary cell wall thickening pattern, affecting water transport.

4. The use of the maize Zm00001d013367 gene in the regulation of primary xylem development and its water transport according to claim 3, wherein the Zm00001d013367 gene is used to regulate the primary xylem vessels secondary cell wall thickening pattern.

5. The use of the maize Zm00001d013367 gene in regulating the development of native xylem and its water transport according to claim 4, wherein the Zm00001d013367 gene is used to maintain the native xylem ring structure.

6. The use of the maize Zm00001d013367 gene in regulating the development of native xylem and its moisture trafficking according to claim 5, wherein the ring-grain native xylem facilitates moisture trafficking while allowing organ elongation.