CN113905762A

CN113905762A - Drug target of idiopathic pulmonary fibrosis

Info

Publication number: CN113905762A
Application number: CN201980096731.1A
Authority: CN
Inventors: 汤楠; 武慧娟
Original assignee: National Institute of Biological Sciences Beijin
Current assignee: National Institute of Biological Sciences Beijin
Priority date: 2019-05-30
Filing date: 2019-05-30
Publication date: 2022-01-07
Also published as: AU2019448656A1; JP2022535797A; CA3141918A1; WO2020237588A1; KR20220011680A; JP2023133615A; EP3976110A1; US20220275055A1; AU2019448656B2; AU2024201372A1; EP3976110A4

Abstract

The invention provides a drug target for idiopathic pulmonary fibrosis and application thereof. The drug target is AREG signaling in AT2 cells of the lung. The drug targets can be used for screening drugs for treating and/or preventing pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF) in animals and humans.

Description

Drug target of idiopathic pulmonary fibrosis

Background

Fibrosis is the thickening and scarring of connective tissue caused by injury, and is characterized by the hyperproliferation of fibroblasts and the accumulation of extracellular matrix (ECM) components. Such diseases are commonly observed in organs including the lungs, liver and kidneys, leading to destruction of tissue structures and severe impairment of organ function^1,2. Indeed, fibrosis can occur in almost every organ and is a major cause of end-stage organ failure and death in a variety of chronic diseases³. Medicine for treating pulmonary fibrosisA common feature is the hyperproliferation of fibroblasts around the air sacs (alveoli) of the lungs⁴. Extensive biomedical research has established that an increase in the number of fibroblasts coupled with their excessive ECM deposition in the lung eventually leads to destruction of the alveolar structure, decreased lung compliance, and disruption of gas exchange function^5-7。

The most common type of pulmonary fibrosis is Idiopathic Pulmonary Fibrosis (IPF). This disorder ultimately affects the entire lung lobes, but it begins with a tiny fibrotic lesion that occurs in the peripheral region and progresses slowly inward, which fibrosis ultimately can lead to respiratory failure^8,9. IPF is a lethal disease with a median survival time of only 2-4 years from the time of diagnosis¹⁰. Scientifically, the mechanism and nature of the pathological progression of IPF is not fully understood, but several studies have shown that a specific subset of alveolar epithelial cells, alveolar type II (AT2) cells, have a role in IPF pathogenesis^4,11。

Pulmonary fibrosis patients have reduced lung compliance and disrupted gas exchange, ultimately leading to respiratory failure and death. It is estimated that 1 adult over 65 years old in the united states has IPF with a median survival time of 2-4 years. The incidence of IPF is estimated to be 3-5/100,000 in china, accounting for approximately 65% of all interstitial lung diseases. Diagnosis is usually between 50 and 70 years of age, with a ratio of men to women of 1.5 to 2: 1. The survival time of the patient is usually only 2-5 years.

At present, IPF is incurable. Two known drugs, nintedanib and pirfenidone, have similar effects on forced vital capacity at decreasing rates of over a year. Although both drugs showed a tendency to reduce mortality, both drugs did not show a significant increase in survival time. One of the main reasons is that there is currently no ideal drug target for pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in order to screen candidate drugs for the treatment of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF).

Disclosure of Invention

The invention relates to a drug target for idiopathic pulmonary fibrosis and application thereof. The drug target is AREG signaling in AT2 cells of the lung. The drug targets can be used for screening drugs for treating and/or preventing pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in animals and humans. The invention also provides a method of using the drug target for screening candidate drugs for the treatment of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in animals and humans.

In a first aspect, the present invention provides a drug target for idiopathic pulmonary fibrosis. The drug target is AREG signaling in AT2 cells of the lung, which is hereinafter referred to as an AREG target.

It was found in the present invention that AREG was detected in AT2 cells of all IPF samples, but not in AT2 cells of control lungs.

It was found in the present invention that no AREG signal could be detected in the control lungs of subjects with or without PNX. AREG signals could not be detected in AT2 cells from control lungs of subjects with or without PNX.

It was further found in the present invention that AREG could be detected in lung AT2 cells in which Cdc42AT2 gene was not effective. After PNX, expression levels of AREG gradually increased in lungs with Cdc42AT2 gene null lungs.

Thus, the level of expression of AREG was significantly upregulated in AT2 cells in both the developing mouse model of fibrosis and in patients with pulmonary fibrosis.

It was also found in the present invention that overexpression of AREG in AT2 cells was sufficient to induce pulmonary fibrosis.

Preferably, ectopic expression of AREGs in AT2 cells is sufficient to induce pulmonary fibrosis.

Preferably, the AREG target is AREG in AT2 cells from the lung of the subject.

Preferably, the AREG target is a receptor for AREG in AT2 cells from the lung of the subject.

Preferably, the AREG target is EGFR in fibroblasts from the lungs of the subject.

The present invention demonstrates that the intensity of EGFR signaling in α -SMA positive fibroblasts is dependent on the expression of AREG in AT2 cells.

The invention proves that the AREG expression level in AT2 cells of the lung of a subject is reduced, and the development of pulmonary fibrosis of Cdc42AT2 gene null mice is obviously weakened.

Thus, the present invention suggests that AREG and its receptor EGFR are therapeutic targets for the treatment of fibrosis.

Secondly, the present invention provides a method for producing transgenic mice overexpressing Areg AT2, wherein Areg is specifically overexpressed in lung AT2 cells.

Preferably, the method comprises the step of specifically inducing expression of Areg in AT2 cells after doxycycline treatment. Preferably, the transgenic mouse produced is Spc-rtTA; teto-Areg mice. Preferably, said Spc-rtTA; the teto-Areg mouse has a sequence consisting of SEQ ID NO: 18, the signature sequence shown.

Preferably, the following primer sequences can be used to identify the Spc-rtTA; teto-Areg mice:

forward direction: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19);

and (3) reversing: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

Third, the present invention provides a transgenic mouse in which AREG is specifically overexpressed in AT2 cells of the lung. The mouse is a transgenic mouse with Areg AT2 overexpressed.

Preferably, expression of Areg is specifically induced in AT2 cells following doxycycline treatment in the transgenic mice. Preferably, the transgenic mouse is Spc-rtTA; teto-Areg mice. Preferably, said Spc-rtTA; the teto-Areg mouse has a sequence consisting of SEQ ID NO: 18, the signature sequence shown.

Preferably, said Spc-rtTA; teto-Areg mice can be identified using the following primer sequences:

forward direction: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19);

and (3) reversing: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

Fourth, the present invention provides the use of AREG in AT2 cells of the lung and/or its receptor EGFR in fibroblasts as a drug target for the treatment of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in animals and humans.

Fifth, the invention provides the use of an AREG target or a transgenic mouse as described above for screening a medicament for the treatment of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in animals and humans.

Sixth, the present invention provides a use of a detection agent for AREG and/or a detection agent for its receptor EGFR in the manufacture of a diagnostic kit for the diagnosis of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in animals and humans.

Preferably, the kit is useful for a sample from a subject suspected of having pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF). The sample may be a biopsy. For example, the biopsy tissue may be lung tissue of the subject. Preferably, the biopsy tissue may be the lower, middle or upper part of the subject's lung lobes. A subject may be diagnosed as having severe pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), if AREG can be detected in the upper part of the subject's lung lobes. The most common type of pulmonary fibrosis is considered to be idiopathic pulmonary fibrosis, in which the fibrotic lesions begin at the periphery of the lobes and progress toward the center of the lobes, then the upper parts of the lobes, and ultimately lead to respiratory failure.

Seventh, the invention provides the use of a substance targeting AREG and/or its receptor in AT2 cells of the lung (e.g. EGFR in fibroblasts) in the manufacture of a medicament for the treatment of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in animals and humans.

Preferably, the agent is an inhibitor of AREG in AT2 cells of the lung, or an inhibitor of EGFR in fibroblasts of the lung.

The animal may be a mouse, rabbit, rat, dog, pig, horse, cow, sheep, monkey, or chimpanzee.

The present invention encompasses all combinations of the specific embodiments recited herein.

Drawings

Fig. 1 shows the construction of mouse strains in which Cdc42 gene was specifically deleted in AT2 cells.

Fig. 2 shows fragments of Cdc42 DNA sequence before and after exon 2 deletion of Cdc42 gene in AT2 cells.

Fig. 3 shows that the deletion of the Cdc42 gene in AT2 cells impaired differentiation of AT2 cells during alveolar regeneration or alveolar homeostasis after PNX.

Figure 4 shows the absence of Cdc42 in AT2 cells, resulting in progressive pulmonary fibrosis in PNX-treated mice.

Figure 5 shows the absence of Cdc42 in AT2 cells, resulting in progressive pulmonary fibrosis in aged mice that were not treated with PNX.

FIG. 6 shows α -SMA in the lungs of Cdc42AT2 gene null mice⁺Development of fibroblast foci.

FIG. 7 shows that AREG is strongly and specifically expressed in Cdc42AT2 gene null lung AT2 cells.

Figure 8 shows that AREG is strongly and specifically expressed in AT2 cells in human patients with pulmonary fibrosis.

FIG. 9 shows the sequence of teto-Areg.

FIG. 10 shows the expression of Areg at Spc-rtTA after doxycycline treatment; AT2 cells of teto-Areg mice were specifically induced. Overexpression of AREG in AT2 cells was sufficient to induce pulmonary fibrosis.

Fig. 11 shows fragments of Areg DNA sequence before and after deletion of exon 3 of the Areg gene in AT2 cells.

Fig. 12 shows that deletion of the Areg gene significantly attenuated the development of pulmonary fibrosis in the AT2 cells of the lungs with Cdc42AT2 gene null.

Figure 13 shows targeting AREG and its receptor EGFR for treatment of IPF and other fibrotic diseases.

Detailed Description

Descriptions of specific embodiments and examples are provided by way of illustration and not of limitation. Those skilled in the art will readily recognize that various noncritical parameters may be changed or modified to produce substantially similar results.

Idiopathic Pulmonary Fibrosis (IPF) is a chronic lung disease characterized by a progressive and irreversible decline in lung function. Symptoms typically include the gradual appearance of shortness of breath and dry cough. Other changes may include feeling tired and clubbing. Complications may include pulmonary hypertension, heart failure, pneumonia, or pulmonary embolism.

The alveolar epithelium of the lung consists of a combination of type I (AT1) and type II (AT2) alveolar cells. AT2 cells are alveolar stem cells and can differentiate into AT1 cells during alveolar homeostasis and post-injury repair^12,13. AT1 cells, which ultimately make up almost 95% of the alveolar surface in the adult lung, are large squamous cells that function as the thin epithelial portion of the air/blood barrier¹⁴. In IPF tissues, abnormally proliferating AT2 cells are usually located near the fibroblast foci¹⁵And, in clinical settings, mutations in genes affecting AT2 cell function are frequently found in IPF tissues^16,17. Furthermore, recent progress has been made by identifying molecular expression profiles of the IPF lung, where TGF signaling (common fibrotic signaling in many fibrotic diseases) is activated in AT2 cells¹⁸. These multiple lines of evidence taken together demonstrate that AT2 cells have a significant pathological impact in pulmonary fibrosis, but the physiological abnormalities of AT2 and the exact pathological mechanisms of progressive pulmonary fibrosis remain to be elucidated.

After administration of tamoxifen (tamoxifen) to animals, the recombinase driven by the Sftpc gene promoter (Spc-CreER) specifically deletes the gene in AT2 cells. The CreER mouse system is commonly used for the study of inducible gene knockouts.

Amphiregulin (AREG) is a member of the epidermal growth factor family. AREG is synthesized as a membrane-anchored precursor protein that acts directly on adjacent cells as a near-secreted factor. Upon proteolytic processing by cell membrane proteases (TACE/ADAM17), AREGs are secreted and act as autocrine or paracrine factors. AREG is a ligand for the Epidermal Growth Factor Receptor (EGFR), a transmembrane tyrosine kinase. By binding to EGFR, AREG can activate an important intracellular signaling cascade that controls cell survival, proliferation and differentiation^19-21。

Physiologically, AREG plays an important role in the development and maturation of mammary glands, skeletal tissue and oocytesBy using^20,22. Under normal conditions, AREG is expressed only at low levels in adult tissues other than placenta. However, chronic increases in AREG expression have been shown to be associated with certain pathological conditions. Elevated expression of AREG is associated with psoriasis-like skin phenotype and certain inflammatory conditions²³. Several studies have described the oncogenic activity of AREG in lung, breast, colorectal, ovarian and prostate cancers, as well as some blood and mesenchymal cancers^24,25. In addition, AREG may be involved in tolerance to several cancer treatments^26,27。

Studies have shown that TGF beta can activate the expression of AREG in bleomycin-induced pulmonary fibrosis mouse model²⁸. It has been shown that AREG expression levels are elevated in liver fibrosis, cystic fibrosis and polycystic kidney disease²³. It can therefore be hypothesized that during these fibrotic diseases, particularly Idiopathic Pulmonary Fibrosis (IPF), AREG may promote the growth and survival of fibrogenic cells. Scientifically speaking, however, the mechanism and nature of the pathological progression of IPF is not fully understood²⁹. Although AREG is presumed to play a role in IPF development, cells expressing AREG during progressive pulmonary fibrosis remain unknown. Furthermore, due to the lack of a mouse model of progressive pulmonary fibrosis, the role of targeting AREG in progressive pulmonary fibrosis is also unknown.

In one embodiment of the invention, it is shown that no AREG signal is detected in the control lungs of subjects with or without PNX, and further, no AREG signal is detected in AT2 cells of the control lungs of subjects with or without PNX.

In one embodiment of the invention, it was shown that AREG could be detected in the lung with PNX-treated Cdc42AT2 gene null or in AT2 cells of mice with aged Cdc42AT2 gene null. After PNX, AREG expression levels were gradually increased in lungs with Cdc42AT2 gene null lungs, noting that AREG was detected in AT2 cells of all IPF samples. Thus, the present invention shows for the first time that the expression level of AREG is significantly up-regulated in AT2 cells in progressive fibrosis mouse models and patients with pulmonary fibrosis.

In one embodiment of the invention, a transgenic mouse is generated in which AREG is specifically overexpressed in AT2 cells of the lung. The transgenic mice had significant fibrotic changes in the lungs.

In one embodiment of the invention, a transgenic mouse is generated in which both the Areg gene and the Cdc42 gene are null. This transgenic mouse is an Areg & Cdc42AT2 double gene null mouse. The lungs of Areg & Cdc42AT2 double gene null mice showed very little fibrosis AT day 21 post-PNX compared to the appearance of significant pulmonary fibrosis in the Cdc42AT2 gene null lungs. Thus, reducing the expression level of AREG significantly attenuated the development of pulmonary fibrosis in Cdc42AT2 gene null mice. Thus, the present invention proposes that AREG and its receptor EGFR are therapeutic targets for the treatment of fibrosis. AREG refers to AREG in AT2 cells of the lung and EGFR refers to EGFR on fibroblasts of the lung.

In one embodiment of the invention, it is shown that blocking AREG and its receptor EGFR may be a therapeutic approach to the treatment of IPF and other fibrotic diseases.

Examples

Method

Mouse and survival Curve recordings

Rosa26-CAG-mTmG (Rosa26-mTmG) and Cdc42 have been described previously^flox/floxMouse³⁰. All experiments were performed according to the recommendations in the national institute of bioscience laboratory animal care and use guidelines. To monitor the survival of mice, control and Cdc42AT2 gene null mice were weighed weekly after PNX treatment. Once the mice reached the predetermined endpoint criteria, the mice were sacrificed. We define the endpoint according to a predetermined criterion^31,32。

Constructing Spc-CreER; rtTA (Spc-CreER) knock-in mice. The CreERT2, p2a and rtTA elements were enzymatically linked and inserted into the endogenous Sftpc gene of mice. The insertion site is the stop codon of the endogenous Sftpc gene, followed by the creation of a new stop codon at the 3' end of rtTA. The CreERT2-p2a-rtTA fragment was inserted into the genome using CRISPR/Cas9 technology.

Construction of Areg^flox/floxMouse

Construction of Areg according to previous work^flox/floxMouse³³. Briefly, Areg exon 3 is anchored by loxp. Loxp1(GACACGGATCCATAACTTCGTATAATG TATGCTATACGAAGTTATCGAGTC (SEQ ID NO: 3)) was inserted into position 3704 of Areg DNA, and loxp2(CCGCGGATAACTTCGTATAATGT ATGCTATACGAAGTTATACTAGTCCAACG (SEQ ID NO: 4)) was inserted into position 4208 of Areg DNA. Exon 3 of the Areg gene was deleted after tamoxifen-induced Cre-loxP recombination, thereby blocking the function of Areg.

Construction of teto-Areg mice

Expression of Areg can be induced when mice are treated with doxycycline (Dox) before inserting a tetracycline response element into the CMV promoter-driven Areg. The sequence of the tetracycline-responsive element is shown below:

5’TCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGA3’(SEQ ID NO：5)。

a minimal CMV promoter was inserted before the Areg cDNA to allow Areg overexpression. The sequence of the CMV promoter is shown below:

5’GGTAGGCGTGTACGGTGGGAGGC CTATATAAGCAGAGCT3’(SEQ ID NO：6)。

the sequence of the Areg cDNA is shown below:

5’ATGAGAACTCCGCTGCTACCGCTGGCGCGCTCAGTGCTGTTGCTGCTGGTCTTAGGCTCAGGCCATTATGCAGCTGCTTTGGAGCTCAATGACCCCAGCTCAGGGAAAGGCGAATCGCTTTCTGGGGACCACAGTGCCGGTGGACTTGAGCTTTCTGTGGGAAGAGAGGTTTCCACCATAAGCGAAATGCCTTCTGGCAGTGAACTCTCCACAGGGGACTACGACTACTCAGAGGAGTATGATAATGAACCACAAATATCCGGCTATATTATAGATGATTCAGTCAGAGTTGAACAGGTGATTAAGCCCAAGAAAAACAAGACAGAAGGAGAAAAGTCTACAGAAAAACCCAAAAGGAAGAAAAAGGGAGGCAAAAATGGAAAAGGCAGAAGGAATAAGAAGAAAAAGAATCCATGCACTGCCAAGTTTCAGAACTTTTGCATTCATGGCGAATGCAGATACATCGAGAACCTGGAGGTGGTGACATGCAATTGTCATCAAGATTACTTTGGTGAACGGTGTGGAGAAAAATCCATGAAGACTCACAGCGAGGATGACAAGGACCTATCCAAGATTGCAGTAGTAGCTGTCACTATCTTTGTCTCTGCCATCATCCTCGCAGCTATTGGCATCGGCATCGTTATCACAGTGCACCTTTGGAAACGATACTTCAGGGAATATGAAGGAGAAACAGAAGAAAGAAGGAGGCTTCGACAAGAAAACGGGACTGTGCATGCCATTGCCTAG3’(SEQ ID NO：7)。

the tetracycline response element, CMV promoter and Areg cDNA were enzymatically ligated and inserted into the mouse genome. the sequence of teto-Areg is shown below:

5’TCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCGAGCTCGGTACCCGGGATGAGAACTCCGCTGCTACCGCTGGCGCGCTCAGTGCTGTTGCTGCTGGTCTTAGGCTCAGGCCATTATGCAGCTGCTTTGGAGCTCAATGACCCCAGCTCAGGGAAAGGCGAATCGCTTTCTGGGGACCACAGTGCCGGTGGACTTGAGCTTTCTGTGGGAAGAGAGGTTTCCACCATAAGCGAAATGCCTTCTGGCAGTGAACTCTCCACAGGGGACTACGACTACTCAGAGGAGTATGATAATGAACCACAAATATCCGGCTATATTATAGATGATTCAGTCAGAGTTGAACAGGTGATTAAGCCCAAGAAAAACAAGACAGAAGGAGAAAAGTCTACAGAAAAACCCAAAAGGAAGAAAAAGGGAGGCAAAAATGGAAAAGGCAGAAGGAATAAGAAGAAAAAGAATCCATGCACTGCCAAGTTTCAGAACTTTTGCATTCATGGCGAATGCAGATACATCGAGAACCTGGAGGTGGTGACATGCAATTGTCATCAAGATTACTTTGGTGAACGGTGTGGAGAAAAATCCATGAAGACTCACAGCGAGGATGACAAGGACCTATCCAAGATTGCAGTAGTAGCTGTCACTATCTTTGTCTCTGCCATCATCCTCGCAGCTATTGGCATCGGCATCGTTATCACAGTGCACCTTTGGAAACGATACTTCAGGGAATATGAAGGAGAAACAGAAGAAAGAAGGAGGCTTCGACAAGAAAACGGGACTGTGCATGCCATTGCCTAG3’(SEQ ID NO：18)。

at Spc-rtTA; expression of Areg was specifically induced in AT2 cells after doxycycline treatment in teto-Areg mice.

Primer sequences for sequencing the teto-Areg sequence:

forward direction: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19);

and (3) reversing: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

Lung resection (PNX)

Male mice, 8 weeks old, were injected with tamoxifen (dose: 75mg/kg) every other day for a total of 4 injections. On day 14 after the last dose of tamoxifen injection, mice were anesthetized and connected to a ventilator (Kent Scientific, Topo). The chest wall was incised at the fourth intercostal site and the left lung lobe removed.

Pulmonary function test

Use of invasive pulmonary function test System (DSI)

PFT controller) measures lung function parameters. Mice were first anesthetized and then endotracheal tubes were inserted into their trachea. Arterial compliance results were obtained from the resistance and compliance tests. Forced vital capacity results were obtained from the pressure volume test.

Hematoxylin and eosin (H & E) staining and immunostaining

Lungs were filled with 4% Paraformaldehyde (PFA) and fixed in 4% PFA for 24 hours at 4 ℃. The lungs were then cryoprotected in 30% sucrose and embedded in oct (tissue tek).

The H & E staining experiments followed standard H & E protocols. Briefly, slides were washed with water to remove OCT. Nuclei were stained with hematoxylin (Abcam, ab150678) for 2 min and cytoplasm with eosin (Sigma, HT110280) for 3 min. After the dehydration and clarification steps, the sections were sealed with neutral resin.

Immunofluorescence staining experiments followed the protocol previously described³⁴. Briefly, after OCT was removed, lung sections were blocked with 3% BSA/0.1% TritonX-100/PBS for 1 hour, and sections were incubated with primary antibody overnight at 4 ℃. After slides were washed 3 times with 0.1% TritonX-100/PBS, slides were incubated with secondary antibodies for 2 hours at room temperature.

Primary antibodies used herein are as follows:

secondary antibodies used herein are listed below:

for p-SMAD2 staining experiments, 1 XPase inhibitor (Bimake, B15002) was added to 4% PFA during tissue fixation. pSMAD2 staining was performed by tyramine signal amplification.

Human lung tissue was fixed with 4% PFA at 4 ℃ for 24 hours, cryoprotected in 30% sucrose and embedded in OCT. All experiments were performed with approval by the institutional review board of both the beijing life sciences institute and the beijing sunfriendly hospital.

And (5) carrying out statistical analysis. All data are presented as mean ± s.e.m. (as shown in the legend). The data presented in the figures were collected from multiple independent experiments performed on different days using different mice. Most of the data presented in the figures are based on at least three independent experiments, unless otherwise indicated. The inferred statistical significance of the differences between samples was assessed using the two-tailed unpaired Student's t-test.

Isolation of mouse AT2 cells

After injection of 4 doses of tamoxifen, lungs from Spc-CreER, Rosa26-mTmG mice were isolated as described previously²³. Briefly, anesthetized mice were filled with neutral protease (Worthington-Biochem, LS02111) and DNase I (Roche, 10104159001). In BD FACS Aria II and III devices, AT2 cells were sorted directly based on GFP fluorescence using single cell selection mode.

Quantitative RT-PCR (qPCR)

Total RNA was isolated from whole lung or primary AT2 cells using the Zymo Research RNA miniprep kit (R2050). Two-step cDNA Synthesis kit (Takara, Cat. No. 6210A/B) was used, as followsThe manufacturer's proposal was to perform the reverse transcription reaction. qPCR Using CFX96 Touch^TMAnd (4) carrying out real-time PCR detection by a system. The mRNA levels of the target genes were normalized to Gapdh mRNA levels. Primers used for qPCR are listed below.

Primers used for qPCR are listed below.

AREG ELISA

The AREG concentration of whole lung lysates was determined using a mouse AREG immunoassay kit (R & D Systems, DY 989). Specifically, whole lung lobes were ground in liquid nitrogen and then lysed using cell lysis buffer. The lung lysate is then added to the wells of the microplate used. After the reaction, the absorbance at 450nm was measured. Human AREG immunoassay kit (abnova, B0RB01090J00018) was used to detect the AREG concentration of human lung tissue lysates. Briefly, human lung tissue was ground in liquid nitrogen and then lysed using cell lysis buffer. The lung lysate is then added to the wells of the microplate used. After the reaction, the absorbance at 450nm was measured. All experiments were performed with approval by the institutional review board of both the beijing life sciences institute and the beijing sunfriendly hospital.

Primer sequences for sequencing fragments of Cdc42 DNA sequence before and after exon 2 of the deletion of Cdc 42:

forward direction: CTGCCAACCATGACAACCTAA (SEQ ID NO: 1);

and (3) reversing: AGACAAAACAACAAGGTCCAG (SEQ ID NO: 2).

Primer sequences for sequencing Areg DNA sequence fragments preceding and following exon 3 of the deletion Areg:

forward direction: AAACAAAACAAGCTGAAATGTGG (SEQ ID NO: 14);

and (3) reversing: AAGGCCTTTAAGAACAAGTTGT (SEQ ID NO: 15).

Example 1 construction and characterization of Cdc42AT2 Gene null mice

To construct an animal model of progressive pulmonary fibrosis, Cdc42AT2 gene null mice were generated by specific knock-out of the Cdc42 gene in alveolar type II cells (AT 2).

For specific deletion of the Cdc42 gene in AT2 cells, mice bearing the Spc-CreER allele were flanked with a loxp site (floxed) in Cdc42 (Cdc 42)^flox/flox) Mice were crossed (fig. 1A). In Cdc42^flox/floxIn mice, exon 2 of the Cdc42 gene (which contains the translation initiation exon of the Cdc42 gene) is flanked by two loxp sites. In Spc-CreER; cdc42^flox/floxIn mice, exon 2 of the Cdc42 gene in AT2 cells was specifically deleted by Cre/loxp-mediated recombination after tamoxifen treatment (fig. 1B). Spc-CreER; cdc42^flox/floxThe mouse was named Cdc42AT2 gene null mouse.

Fragments of Cdc42 DNA sequence before and after deletion of exon 2 of Cdc42 gene are shown in fig. 2.

We performed PNX on control and Cdc42AT2 gene null mice and analyzed alveolar regeneration and differentiation of AT2 cells on day 21 post-PNX (fig. 3A). As shown in fig. 3A, 200 μm lung sections of control and Cdc42AT2 gene null mice were immunostained with antibodies against GFP, Pdpn and Prospc. On day 21 post-PNX, many newly differentiated AT1 cells and newly formed alveoli were observed in the control lung without prosthesis implantation (fig. 3B). However, in the Cdc42AT2 gene null lung, few AT2 cells differentiated into AT1 cells AT day 21 post-PNX and no new alveoli were formed (fig. 3B). It was observed that the alveoli in the peripheral region of the Cdc42AT2 gene null lung were severely over-stretched (fig. 3B).

Under normal steady state conditions, AT2 cells slowly self-renew and differentiate into AT1 cells to establish new alveoli. To examine whether Cdc42 was required for AT2 cell differentiation during homeostasis, we deleted the Cdc42 gene in AT2 cells AT2 months of age of mice, and analyzed the fate of AT2 cells up to 12 months of age of mice. Lungs from control and non-PNX treated Cdc42 gene null mice were collected at 12 months (fig. 3C). The images show 200 μm Z-projections of lung sections of maximum intensity stained with antibodies to GFP, Pdpn and Prospc. In the lungs of 12-month-old control mice, we observed the formation of many new alveoli (fig. 3D). However, in the lungs of 12-month old Cdc42 gene null mice (not undergoing PNX), we observed enlarged alveoli and no formation of any new AT1 cells (fig. 3D).

Following PNX, Cdc42AT2 gene null and control mice were observed for longer periods of time (fig. 4A). Surprisingly, some Cdc42AT2 gene null mice showed significant weight loss and increased respiration rates AT day 21 post-PNX. In fact, AT day 60 post-PNX, nearly 50% of PNX-treated Cdc42AT2 gene null mice reached the predetermined health criteria of end-point euthanasia (fig. 4B), and by day 180 post-PNX, about 80% of PNX-treated Cdc42AT2 gene null mice reached their end-point (fig. 4B).

H & E staining of post-PNX control and Cdc42AT2 gene null mice revealed severe fibrosis in the lungs AT their end-points in Cdc42AT2 gene null mice (fig. 4D compared to fig. 4C). To determine the time points when Cdc42AT2 gene null mice began to develop pulmonary fibrosis after PNX, the lungs of Cdc42AT2 gene null mice were analyzed using H & E staining AT various time points after PNX (fig. 4D). Before day 21 post-PNX, the subpleural region of the lungs, where some Cdc42AT2 genes were null, showed evidence of tissue thickening (fig. 4D). Before the endpoint, dense fibrosis had progressed to the center of the lung where most of the Cdc42AT2 gene was null (fig. 5D). Our observations in post-PNX and aged Cdc42 gene null mice resemble the characteristic progression of IPF, in which fibrotic lesions first develop in the periphery of the lungs and then progress inwards towards the center of the lung lobes.

In addition to the detection of strong immunofluorescence signals for type I collagen in these dense fibrotic regions of the lungs of Cdc42AT2 gene null mice (fig. 4E), we also observed that in Cdc42AT2 gene null mice, the proportion of type I collagen expressing regions in each lung lobe increased gradually following PNX (fig. 4F). Our qPCR analysis also showed a gradual increase in type I collagen mRNA expression levels from day 21 post-PNX (fig. 4G). Furthermore, a gradual decrease in lung compliance was observed in PNX-treated Cdc42AT2 gene null mice from day 21 post-PNX as compared to their PNX-treated control mice (fig. 4H), an interesting finding in view of the fact that a decrease in lung compliance is known to often occur as the lungs become fibrotic.

Since impaired AT2 differentiation and increased alveolar enlargement were found in Cdc42AT2 gene null mice AT 12 months of age (fig. 3D), lungs of PNX-untreated controls and Cdc42AT2 gene null mice from 10 months of age to 24 months of age were analyzed (fig. 5A). Even if the control mice reached 24 months of age, no fibrotic changes were ever observed in the lungs of the control mice (fig. 5B). We did not see significant fibrosis changes until Cdc42AT2 gene null mice reached 10 months of age (fig. 5C). It was also observed that fibrosis had begun to develop significantly in the pleural region of Cdc42AT2 gene null lung before 12 months and progressed towards the center of the lung after 12 months (fig. 5C).

Fibroblasts foci are considered to be a relevant morphological marker of progressive pulmonary fibrosis and are considered to be sites of initiation and/or persistence of the fibrotic response in progressive pulmonary fibrosis³⁵. Fibroblast foci containing proliferating alpha-SMA⁺A fibroblast. On day 21 post-PNX, lungs of Cdc42AT2 gene null mice were stained with antibodies against a-SMA (fig. 6A). It was observed that some α -SMA in the relatively normal alveolar region of the Cdc42AT2 gene null lung⁺Fibroblasts begin to aggregate near the AT2 cell cluster (region 1, fig. 6A). And the dense fibrotic region of the lung is filled with alpha-SMA⁺Fibroblasts (area 2, fig. 6A). Furthermore, by immunostaining with antibodies directed against both α -SMA and the proliferation marker Ki67, we showed that α -SMA was 21 days post PNX⁺Cell proliferation of cells was dramatically increased in the lungs of Cdc42AT2 gene null mice. These results indicate that the propagated α -SMA⁺Fibroblasts promoted the development of pulmonary fibrosis in Cdc42AT2 null mice (fig. 6B).

Overall, the loss of Cdc42 in AT2 cells in PNX-treated mice led to progressive pulmonary fibrosis. In addition, this progressive pulmonary fibrosis phenotype also begins around 12 months of age, occurring in Cdc42AT2 gene null mice that were not treated with PNX. All these results demonstrate that the deletion of Cdc42 in AT2 cells leads to IPF-like progressive pulmonary fibrosis in mice, thus establishing a mouse model of IPF-like progressive pulmonary fibrosis, which can be used to study human IPF disease.

Example 2 sequence characterization of Cdc42AT2 Gene null mice

For Spc-CreER, Cdc42^flox/-Mice were subjected to genome purification and PCR amplification. The flox and gene null bands of Cdc42 were then purified and sequenced using primers as described below:

CTGCCAACCATGACAACCTAA(SEQ ID NO：1)；

AGACAAAACAACAAGGTCCAG(SEQ ID NO：2)。

a fragment of Cdc42 DNA sequence before or after deletion of exon 2 of Cdc42 gene is shown in figure 2.

Example 3 following PNX treatment, Amphiregulin (AREG) was strongly expressed in Cdc42AT2 gene null lung AT2 cells

In the Cdc42AT2 gene null fibrosis model, Cdc42AT2 gene null lungs began to show fibrotic changes on day 21 post-PNX (fig. 4D). We have characterized controls after PNX treatment and Cdc42 gene null AT2 cells (fig. 7A). Areg was observed to be one of the most up-regulated genes on day 21 post-PNX in AT2 cells with Cdc42AT2 gene null lungs by both RNA sequencing analysis and quantitative pcr (qpcr) (fig. 7B). By immunostaining, it was observed that AREG could be detected in AT2 cells of Cdc42AT2 gene null lungs on day 21 post-PNX (fig. 7C). At day 21 post-PNX, no AREG signal could be detected in control lungs (fig. 7C), consistent with the information of human tissue mapping, i.e. AREG expression was below detectable levels in adult lung tissue. In addition, AREG signal was specifically detected in AT2 cells. The expression of AREG protein in the lung null for the Cdc42AT2 gene was measured by AREG ELISA kit. It was observed that the expression level of AREG gradually increased from day 21 after PNX to day 60 after PNX in the lungs of Cdc42AT2 gene null mice (FIG. 7D).

Example 4 robust expression of AREG in AT2 cells in patients with pulmonary fibrosis

As shown in example 3, a positive correlation between the expression level of AREG and the progression of pulmonary fibrosis was observed in Cdc42AT2 gene null mice. The expression level of AREG in 2 donors and 3 IPF lungs was analyzed. Strikingly, it was observed that AREG was detected in AT2 cells (cells expressing HTII-280) of all IPF samples, but not in AT2 cells of donor lungs (fig. 8A). Expression of AREG in the lungs of IPF patients and autoimmune-induced pulmonary fibrosis patients was measured by the AREG ELISA kit. It was found that the expression level of AREG was significantly elevated in the lungs of IPF patients and autoimmune-induced pulmonary fibrosis patients (fig. 8B).

Taken together, these results show that the expression level of AREG is significantly upregulated in AT2 cells in both progressive fibrosis mouse models and pulmonary fibrosis patients.

Example 5 overexpression of AREG in AT2 cells is sufficient to induce pulmonary fibrosis

Generation of teto-Areg mice

The tetracycline response element was inserted before the CMV promoter-driven Areg so that expression of Areg could be induced when mice were treated with doxycycline (Dox). The sequence of the tetracycline-responsive element is shown below:

a minimal CMV promoter was inserted before the Areg cDNA in order to overexpress Areg. The sequence of the CMV promoter is shown below:

5’GGTAGGCGTGTACGGTGGGAGG CCTATATAAGCAGAGCT3’(SEQ ID NO：6)。

the sequence of the Areg cDNA is shown below:

the tetracycline response element, CMV promoter and Areg CDNA were enzymatically linked and inserted into the mouse genome. the sequence of teto-Areg is shown below:

5 'TCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGTTTACCACTCCCTATCAGTGATAGAGAAAAGTGAAAGTCGAGCTCGGTACCCGGGTCGAGGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCTCGTTTAGTGAACCGTCAGATCGCCTGGAGACGCCATCCACGCTGTTTTGACCTCCATAGAAGACACCGGGACCGATCCAGCCTCCGCGGCCCCGAATTCGAGCTCGGTACCCGGGATGAGAACTCCGCTGCTACCGCTGGCGCGCTCAGTGCTGTTGCTGCTGGTCTTAGGCTCAGGCCATTATGCAGCTGCTTTGGAGCTCAATGACCCCAGCTCAGGGAAAGGCGAATCGCTTTCTGGGGACCACAGTGCCGGTGGACTTGAGCTTTCTGTGGGAAGAGAGGTTTCCACCATAAGCGAAATGCCTTCTGGCAGTGAACTCTCCACAGGGGACTACGACTACTCAGAGGAGTATGATAATGAACCACAAATATCCGGCTATATTATAGATGATTCAGTCAGAGTTGAACAGGTGATTAAGCCCAAGAAAAACAAGACAGAAGGAGAAAAGTCTACAGAAAAACCCAAAAGGAAGAAAAAGGGAGGCAAAAATGGAAAAGGCAGAAGGAATAAGAAGAAAAAGAATCCATGCACTGCCAAGTTTCAGAACTTTTGCATTCATGGCGAATGCAGATACATCGAGAACCTGGAGGTGGTGACATGCAATTGTCATCAAGATTACTTTGGTGAACGGTGTGGAGAAAAATCCATGAAGACTCACAGCGAGGATGACAAGGACCTATCCAAGATTGCAGTAGTAGCTGTCACTATCTTTGTCTCTGCCATCATCCTCGCAGCTATTGGCATCGGCATCGTTATCACAGTGCACCTTTGGAAACGATACTTCAGGGAATATGAAGGAGAAACAGAAGAAAGAAGGAGGCTTCGACAAGAAAACGGGACTGTGCATGCCATTGCCTAG 3' (SEQ ID NO: 18) (FIG. 9).

The primer sequences used to sequence the teto-Areg sequence are shown below:

forward direction: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19);

and (3) reversing: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

To assess the function of elevated AREG expression in AT2 cells, transgenic mice were generated that overexpress AREG AT2, where AREG can be specifically overexpressed in AT2 cells. First, transgenic mice were generated that expressed Areg under the control of a tetracycline-responsive promoter element (tetO). Crossing a mouse with an Spc-rtTA allele with a mouse with a teto-Areg allele to obtain a mouse with an Spc-rtTA; progeny mice of teto-Areg. When the Spc-rtTA; the teto-Areg mice, when exposed to the tetracycline analogue doxycycline (Dox), specifically induced expression of Areg in AT2 cells. Spc-rtTA; the teto-Areg mouse was named Areg^AT2OEMouse (fig. 10A).

Areg^AT2OEMice were treated with water containing Dox for 21 days (fig. 10B). Then collect Areg with or without Dox treatment^AT2OELungs of mice were used for analysis. qPCR analysis showed that Areg was treated with Dox^AT2OEExpression of Areg mRNA was significantly induced in AT2 cells of mice (fig. 10C). H&E staining shows Dox-treated Areg^AT2OEThe lungs of mice had significant fibrotic changes (fig. 10D). Many cells in the fibrotic region expressed high levels of α -SMA (fig. 10E).

These results indicate for the first time that ectopic expression of AREGs in AT2 cells is sufficient to induce pulmonary fibrosis.

Example 6 construction of Areg AT2 Gene null mice

Generating Areg^flox/floxMice: areg^flox/floxMice were generated according to previous work³³. Briefly, Areg exon 3 is anchored by loxp. Loxp1(GACACGGATCCATAACTTCGTATAATGTATGCTATACGAAGTTATCGAGTC (SEQ ID NO: 3)) was inserted into Areg DNA at position 3704, and lox was addedp2(CCGCGGATAACTTCGTATAATGTATGCTATACGAAGTTATACTAGTCCAACG (SEQ ID NO: 4)) was inserted into position 4208 of Areg DNA. Areg exon 3 is deleted after tamoxifen-induced Cre-loxP recombination, thus blocking Areg function.

Fragments of Areg DNA sequence before or after deletion of exon 3 of the Areg gene are shown in fig. 11.

Example 7 deletion of Areg Gene in Cdc42AT2 Gene null cells significantly slowed the development of pulmonary fibrosis

Considering the fibrotic function of AREGs in AT2 cells, it was evaluated whether reducing expression of AREGs in Cdc42AT2 gene null lung in Cdc42AT2 gene null cells would attenuate the progression of fibrosis. Areg flox mice were generated in which two loxp sites flank exon 3 of the Areg gene. Mice in which the Areg gene was deleted throughout the body were analyzed. Areg^-/-The mice were viable and fertile, indicating that the Areg gene is not essential for the survival and development of the mice. After several generations of hybridization, we obtained Areg&Cdc42AT2 double gene null mice in which both Areg and Cdc42 genes were deleted in AT2 cells.

Then, the effect of deletion of the Areg gene in Cdc42AT2 gene null cells was investigated. Control, Cdc42AT2 gene null and Areg & Cdc42AT2 double gene null mice were exposed to 4 doses of tamoxifen 14 days prior to PNX (fig. 12A). The lungs of these mice were analyzed at various time points after PNX. AT day 21 post-PNX, qPCR analysis showed no increase in Areg expression levels in Areg & Cdc42 dual gene null AT2 cells AT day 21 post-PNX, confirming the deletion of the Areg gene in this AT2 cell (fig. 12B).

AREGs bind to EGFR, which can activate phosphorylation of EGFR. alpha-SMA was examined by immunostaining experiments using antibodies against GFP (labeled AT2 cells), p-EGFR and alpha-SMA⁺p-EGFR expression in fibroblasts. Strong expression of p-EGFR was observed in α -SMA positive fibroblasts in lungs null with Cdc42AT2 gene (fig. 12C). In Areg&Not only was much less positive formation of α -SMA detected in the Cdc42AT2 double gene null lungsFibroblasts, and decreased expression level of p-EGFR was observed (FIG. 12C). This confirms that the intensity of EGFR signaling in α -SMA positive fibroblasts is dependent on the expression of AREG in AT2 cells. Furthermore, on day 21 post PNX, Areg&Cdc42AT2 double gene null lungs showed little fibrosis compared to significant pulmonary fibrosis in Cdc42AT2 gene null lungs (fig. 12D). The survival curves also show that Areg&Cdc42AT2 double gene null mice had significantly longer lifespan than Cdc42AT2 gene null mice (fig. 12E).

Taken together, these results demonstrate that reducing the expression level of AREG in AT2 cells significantly attenuated the development of pulmonary fibrosis in Cdc42AT2 gene null mice. These results also indicate that AREG and its receptor EGFR are therapeutic targets for the treatment of fibrosis.

Example 8 sequence characterization of Areg AT2 Gene null mice

For Spc-CreER, Areg^flox/-Mice were subjected to genome purification and PCR amplification. Then, the dreg flox and gene null bands were purified and sequenced using the following primers:

AAACAAAACAAGCTGAAATGTGG(SEQ ID NO：14)；

AAGGCCTTTAAGAACAAGTTGT(SEQ ID NO：15)。

example 9 targeting AREG and its receptor EGFR to treat IPF and other fibrotic diseases

Considering the fact that EGFR can be activated by AREG in α -SMA positive fibroblasts (fig. 12C), the effect of inhibiting the activity of the AREG receptor EGFR on the progression of pulmonary fibrosis was investigated. The PNX-treated Cdc42AT2 gene null mice were treated with PBS alone or with the EGFR inhibitor gefitinib (Gefitnib) from day 6 post-PNX to day 30 post-PNX (fig. 13A). Gefitinib treatment was also found to significantly inhibit the development of fibrosis in the lungs of mice null for the Cdc42AT2 gene (fig. 13B).

Taken together, these results demonstrate that blocking AREG and its receptor EGFR is an ideal therapeutic approach for treating IPF and other fibrotic diseases.

Reference documents:

1 Wynn, T.A. fibrotic Cellular and molecular mechanisms (Cellular and molecular mechanisms of fibrosis), The Journal of pathology 214,199-210, doi:10.1002/path.2277(2008).

2 Wynn, T.A. & Ramalingam, t.r. mechanism of fibrosis: therapeutic translation of fibrotic diseases (Mechanisms of fibrosis: thermal transformation for fibrous disease), Nature medicine 18,1028-1040, doi:10.1038/nm.2807(2012).

3 Mehal, w.z., Iredale, J. & Friedman, s.l. wipe-off fibrosis: express ways to the core of fibrosis core (Scafine fibrosis: express to the core of fibrosis), Nature media 17,552 and 553, doi:10.1038/nm0511-552(2011).

4 Barkauskas, C.E. & Noble, P.W. Cellular mechanisms of tissue fibrosis.7. novel insights into the Cellular mechanisms of pulmonary fibrosis (Cellular mechanisms of tissue fibrosis.7.New insights into the Cellular mechanisms of pulmonary fibrosis), American journel of physiology.cell physiology 306, C987-996, doi:10.1152/ajpcell.00321.2013(2014).

5 Rock, J.R., et al, Multiple mechanistic populations contribute to pulmonary fibrosis, but there is no evidence of epithelial to mesenchymal conversion (Multiple structural publications control to pulmonary fibrosis with out evidence for epithelial to mesenchymal transition), Proceedings of the National Academy of Sciences of the United States of America 108, E1475-1483, doi: 10.1073/pnas.1117908 (2011).

6 Gross, T.J. & Hunninghake, G.W. Idiopathic pulmonary fibrosis (Idiopathic pulmonary fibrosis), New England Journal of Medicine 345, 517-.

7 Vyalov, S.L., Gabbiani, G. & Kapanci, Y. Rat alveolar myofibroblasts obtain expression of alpha-smooth muscle actin during bleomycin-induced pulmonary fibrosis (Rat alveolaria myoblasts access alpha-smooth muscle actin-induced pulmonary fibrosis), The American journeal of Pathology 143,1754(1993).

8 King Jr, t.e., Pardo, a. & Selman, m. Idiopathic pulmonary fibrosis (Idiopathic pulmonary fibrosis), The Lancet 378, 1949-.

9 Plantier, L, et al, Ectopic airway epithelial cell differentiation in bronchiolized distal air space in idiopathic pulmonary fibrosis (Ectopic respiratory epithelial cell differentiation in branched pulmonary fibrosis), Thorax 66,651-657, doi:10.1136/thx.2010.151555(2011).

10 Steele, M.P. & Schwartz, D.A. Molecular mechanisms in progressive idiopathic pulmonary fibrosis (Molecular mechanisms in progressive idiopathic pulmonary fibrosis), Annual review of medicine 64, 265. 276. doi: 10.1146/annurev-med-042711. 142004(2013).

11 Camelo, a., Dunmore, r., Sleeman, M.A. & Clarke, d.l. epithelium in idiopathic pulmonary fibrosis: breaking The barrier (The epithelium in ionic transdermal across fibers: breaking The barrier), Frontiers in pharmacological 4,173, doi:10.3389/fphar.2013.00173(2014).

12 Barkauskas, C.E., et al, Type 2alveolar cells are stem cells in The adult lung (Type 2 alveolars cells arm cells in adult lung), The Journal of clinical involvement 123, 3025. 3036, doi:10.1172/JCI68782(2013).

13 Desai, T.J., Brownfield, D.G. & Krasnow, M.A. Alveolar progenitor and stem cells in lung development, turnover and cancer (Alveolar promoter and stem cells in lung maintenance, renewal and cancer), Nature 507, 190-.

Morphological study of 14 Haies, d.m., Gil, J. & Weibel, e.r. rat lung cells: I. the number and size characteristics of the parenchymal cell population (morphological study of rat Long cells: I.Numerical and dimensional characterization of pathological cell placement), American Review of Respiratory Disease 123,533-541(1981).

15 Selman, M. & Pardo, a. idiopathic pulmonary fibrosis: an epithelial/fibroblast crosstalk disorder (Idiopathic pulmonary/fibrotic cross-talk disorder), Respiratory research 3,3(2001).

16 Kropski, J.A., Blackwell, T.S. & Loyd, J.E. The genetic basis of idiopathic pulmonary fibrosis (The genetic basic of idiopathic pulmonary fibrosis), European Respiratory Journal 45, 1717-.

17 Goodwin, A.T. & Jenkins, G. intramolecular typing of pulmonary fibrosis (Molecular endtyping of pulmonary fibrosis), Chest 149, 228-.

18 Xu, Y, et al, Single cell RNA sequencing identified the diversification of epithelial cells in idiopathic pulmonary fibrosis (Single-cell RNA sequencing assays subversions of epithelial cells in pathological pulmonary fibrosis), JCI insight 1(2016).

19 Sternlicht, M.D. & Sunnorborg, S.W. ADAM 17-amphiregulin-EGFR axis in mammary gland development and cancer (The ADAM 17-ampheregulin-EGFR axis in mammary definition and cancer), Journal of mammary gland biology and neoplasma 13,181-194(2008).

20 Berasain, C. & Avila, M.A. cell and developmental biology monograph (sensiars in cell & developmental biology), 31-41(Elsevier).

21 Sternlicht, M.D., et al, Mammary duct morphogenesis requires paracrine activation of stromal EGFR by ADAM17-dependent shedding of epithelial amphiregulin (mammalian product biology research activity of structural EGFR via ADAM17-dependent mapping of epithelial amphetamine), Development 132,3923-3933(2005).

22 Macias, H. & Hinck, L. Mammary gland development (Mammary gland development), Wiley Interdisciplineary Reviews: development Biology 1, 533-.

23 (! Inactive references!!!!!!!.

24 Busser, B., Sancey, L., Brambilla, E., Coll, J. & Hurbin, A. multiple roles of amphiregulin in human cancers (The multiple roles of ampheregulin in human Cancer), Biochimica et Biophysica Acta (BBA) -Reviews on Cancer 1816, 119-.

25 Chen, Z, et al, Aberrantly activated AREG-EGFR signaling is required for the growth and survival of mucoepidermoid carcinoma cells positive for CRTC 1-MAML 2 fusions (Abserrantly activated AREG-EGFR signaling is required for the growth and survival of the growth and preservation of CRTC 1-MAML 2 fusion-positive mucosal cancer cells), Oncogene 33,3869(2014).

26 Busser, B.et al, Amphiregulin promotes resistance to gefitinib by modulating Ku70 acetylation in non-small cell lung carcinoma cells (Ampheiegulin proteins resistance to gefitinib in non-cellular cancer cells by regulating Ku70 acetylation), Molecular Therapy 18, 536-phase 543(2010).

27 Wang, x., massi, S., Phung, S. & Chen, S. amphiregulin' S role in exemestane resistant breast cancer cells: evidence of autocrine loops (The role of ampheregulin exemestane-resistant research cells: evidence of an autocrine loop), Cancer research 68, 2259-.

28 Zhou, Y, et al, Amphiregulin, a ligand of the epidermal growth factor receptor, plays an essential role in the pathogenesis of transforming growth factor beta-induced pulmonary fibrosis (Ampheirulin, an epidermal growth factor receptor ligand, a plant growth alcohol in the pathogenesis of transforming growth factor beta-induced pulmonary fibrosis), Journal of Biological Chemistry 287, 41991-induced pulmonary fibrosis (2012).

29 Steele, M.P. & Schwartz, D.A. Molecular mechanisms of progressive idiopathic pulmonary fibrosis (Molecular mechanisms in progressive idiopathic pulmonary fibrosis), annular review of media 64,265-276(2013).

30 Chen, L.et al, Cdc42 deficiency results in Sonic hedgehog-independent whole forebrain malformations (Cdc42 definitional cities mice Sonic-independent holosensory phally), Proceedings of the National Academy of Sciences 103,16520-16525(2006).

31 Council, N.R. Guide for the care and use of laboratory animals (National academyes Press,2010).

Guidelines for assessing the health and condition of mice (Guidelines for assessing the health and condition of mice), Resource 28(1999).

33 Luetteke, N.C. et al, Targeted inactivation of EGF and amphiregulin genes revealed a distinct role for EGF receptor ligands in mouse mammary gland development (Targeted activation of the EGF and amyloid genes replacement functions for EGF receptor ligands in mouse mammary gland development), development126,2739-2750(1999).

34 Wang, Y, et al, the alveolar type I cell population is composed of two distinct subtypes differing in cell fate (Pulmonary alveolar type I cell position constraints of two discrete subtypes in cell faces), Proceedings of the National Academy of Sciences,201719474(2018).

35 Lynch, d.a. et al, diagnostic criteria for idiopathic pulmonary fibrosis: fisher Society of science (Diagnostic criterion for anatomical pulmonary disease White Paper), The Lancet Respiratory Medicine 6,138-153, doi:10.1016/s2213-2600(17)30433-2(2018).

Sequence listing

<110> Beijing institute of Life sciences

<120> drug targets of idiopathic pulmonary fibrosis

<130> RYP1918235.1

<160> 22

<170> PatentIn version 3.5

<210> 1

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 1

ctgccaacca tgacaaccta a 21

<210> 2

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 2

agacaaaaca acaaggtcca g 21

<210> 3

<211> 51

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 3

gacacggatc cataacttcg tataatgtat gctatacgaa gttatcgagt c 51

<210> 4

<211> 52

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 4

ccgcggataa cttcgtataa tgtatgctat acgaagttat actagtccaa cg 52

<210> 5

<211> 271

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 5

tccctatcag tgatagagaa aagtgaaagt cgagtttacc actccctatc agtgatagag 60

aaaagtgaaa gtcgagttta ccactcccta tcagtgatag agaaaagtga aagtcgagtt 120

taccactccc tatcagtgat agagaaaagt gaaagtcgag tttaccactc cctatcagtg 180

atagagaaaa gtgaaagtcg agtttaccac tccctatcag tgatagagaa aagtgaaagt 240

cgagtttacc actccctatc agtgatagag a 271

<210> 6

<211> 39

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 6

ggtaggcgtg tacggtggga ggcctatata agcagagct 39

<210> 7

<211> 747

<212> DNA

<213> mouse (Mus musculus)

<400> 7

atgagaactc cgctgctacc gctggcgcgc tcagtgctgt tgctgctggt cttaggctca 60

ggccattatg cagctgcttt ggagctcaat gaccccagct cagggaaagg cgaatcgctt 120

tctggggacc acagtgccgg tggacttgag ctttctgtgg gaagagaggt ttccaccata 180

agcgaaatgc cttctggcag tgaactctcc acaggggact acgactactc agaggagtat 240

gataatgaac cacaaatatc cggctatatt atagatgatt cagtcagagt tgaacaggtg 300

attaagccca agaaaaacaa gacagaagga gaaaagtcta cagaaaaacc caaaaggaag 360

aaaaagggag gcaaaaatgg aaaaggcaga aggaataaga agaaaaagaa tccatgcact 420

gccaagtttc agaacttttg cattcatggc gaatgcagat acatcgagaa cctggaggtg 480

gtgacatgca attgtcatca agattacttt ggtgaacggt gtggagaaaa atccatgaag 540

actcacagcg aggatgacaa ggacctatcc aagattgcag tagtagctgt cactatcttt 600

gtctctgcca tcatcctcgc agctattggc atcggcatcg ttatcacagt gcacctttgg 660

aaacgatact tcagggaata tgaaggagaa acagaagaaa gaaggaggct tcgacaagaa 720

aacgggactg tgcatgccat tgcctag 747

<210> 8

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 8

aaggtcggtg tgaacggatt tgg 23

<210> 9

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 9

cgttgaattt gccgtgagtg gag 23

<210> 10

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 10

gcagatacat cgagaacctg gag 23

<210> 11

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 11

ccttgtcatc ctcgctgtga gt 22

<210> 12

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 12

cctcagggta ttgctggaca ac 22

<210> 13

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 13

cagaaggacc ttgtttgcca gg 22

<210> 14

<211> 23

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 14

aaacaaaaca agctgaaatg tgg 23

<210> 15

<211> 22

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 15

aaggccttta agaacaagtt gt 22

<210> 16

<211> 1128

<212> DNA

<213> mouse (Mus musculus)

<400> 16

tgttctattt taaagtacag gtaatcatgc atgagaagtc aaaaccttta aaactgtcaa 60

acagtgggct gctgtgtgtg gcatttgctg ccaaccatga caacctaagt tcaacttaag 120

agcccaacaa tggaaaaaga ccccttcaag ttgtcctctg ccatctacac atacaccaaa 180

gcaggacaca ggtatgtaca gaattcataa cttcgtataa tgtatgctat acgaagttat 240

gttcgaacga agttcctatt ctctagaaag tataggaact tcgctagact agtacgcgtg 300

tacaccttgt aattgctgct ctgagcaagt tgccattttt tctttttaga ggttttcagt 360

catagcagta atgctagttc tggtttgagt ggctgagcct gttgctaggg gaaaaaagta 420

tggatttaaa cataaatcaa taaaataatt gtctttaatt tcttcttagg acaagatcta 480

atttgaaata ttaaaagtgg atacaaaact gtttccgaaa tgcagacaat taagtgtgtt 540

gttgttggtg atggtgctgt tggtaaaaca tgtctcctga tatcctacac aacaaacaaa 600

ttcccatcgg aatatgtacc aactgtaagt ataaaggctt tttactagca aaagattgta 660

atgtagtgtc tgtccattgg aaaacacttg gcctgcctgc agtatttttg actgtcttgc 720

cctttaaaaa aaattaaatt ttactacctt tattactttg tggggtgtgt gttataactt 780

cgtataatgt atgctatacg aagttatggt accgaattca gtttctggac cttgttgttt 840

tgtcttaagt atcaaagtag aacagtgacc gatatattcc ttttattttt ttttttcttc 900

cctgagactg ggtttctctg tgtagccctt gctgttctgt aactcactct gtgagtggcc 960

tcaaactcag agatccgcct gccttgggca aggaaggtgc tataaaaaga gtctcgtgtg 1020

gtatatgaag tatagtttgt gaaagctgct tcagtgtgag cacacacgca ttatatgcaa 1080

gaccaattgc agcccgaaga atactctaaa aaatgactca ctgcccag 1128

<210> 17

<211> 561

<212> DNA

<213> mouse (Mus musculus)

<400> 17

tgttctattt taaagtacag gtaatcatgc atgagaagtc aaaaccttta aaactgtcaa 60

acagtgggct gctgtgtgtg gcatttgctg ccaaccatga caacctaagt tcaacttaag 120

agcccaacaa tggaaaaaga ccccttcaag ttgtcctctg ccatctacac atacaccaaa 180

gcaggacaca ggtatgtaca gaattcataa cttcgtataa tgtatgctat acgaagttat 240

ggtaccgaat tcagtttctg gaccttgttg ttttgtctta agtatcaaag tagaacagtg 300

accgatatat tccttttatt tttttttttc ttccctgaga ctgggtttct ctgtgtagcc 360

cttgctgttc tgtaactcac tctgtgagtg gcctcaaact cagagatccg cctgccttgg 420

gcaaggaagg tgctataaaa agagtctcgt gtggtatatg aagtatagtt tgtgaaagct 480

gcttcagtgt gagcacacac gcattatatg caagaccaat tgcagcccga agaatactct 540

aaaaaatgac tcactgccca g 561

<210> 18

<211> 1204

<212> DNA

<213> mouse (Mus musculus)

<400> 18

tccctatcag tgatagagaa aagtgaaagt cgagtttacc actccctatc agtgatagag 60

aaaagtgaaa gtcgagttta ccactcccta tcagtgatag agaaaagtga aagtcgagtt 120

taccactccc tatcagtgat agagaaaagt gaaagtcgag tttaccactc cctatcagtg 180

atagagaaaa gtgaaagtcg agtttaccac tccctatcag tgatagagaa aagtgaaagt 240

cgagtttacc actccctatc agtgatagag aaaagtgaaa gtcgagctcg gtacccgggt 300

cgaggtaggc gtgtacggtg ggaggcctat ataagcagag ctcgtttagt gaaccgtcag 360

atcgcctgga gacgccatcc acgctgtttt gacctccata gaagacaccg ggaccgatcc 420

agcctccgcg gccccgaatt cgagctcggt acccgggatg agaactccgc tgctaccgct 480

ggcgcgctca gtgctgttgc tgctggtctt aggctcaggc cattatgcag ctgctttgga 540

gctcaatgac cccagctcag ggaaaggcga atcgctttct ggggaccaca gtgccggtgg 600

acttgagctt tctgtgggaa gagaggtttc caccataagc gaaatgcctt ctggcagtga 660

actctccaca ggggactacg actactcaga ggagtatgat aatgaaccac aaatatccgg 720

ctatattata gatgattcag tcagagttga acaggtgatt aagcccaaga aaaacaagac 780

agaaggagaa aagtctacag aaaaacccaa aaggaagaaa aagggaggca aaaatggaaa 840

aggcagaagg aataagaaga aaaagaatcc atgcactgcc aagtttcaga acttttgcat 900

tcatggcgaa tgcagataca tcgagaacct ggaggtggtg acatgcaatt gtcatcaaga 960

ttactttggt gaacggtgtg gagaaaaatc catgaagact cacagcgagg atgacaagga 1020

cctatccaag attgcagtag tagctgtcac tatctttgtc tctgccatca tcctcgcagc 1080

tattggcatc ggcatcgtta tcacagtgca cctttggaaa cgatacttca gggaatatga 1140

aggagaaaca gaagaaagaa ggaggcttcg acaagaaaac gggactgtgc atgccattgc 1200

ctag 1204

<210> 19

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 19

gtacccggga tgagaactcc g 21

<210> 20

<211> 21

<212> DNA

<213> Artificial sequence

<220>

<223> Artificial sequence

<400> 20

gccggatatt tgtggttcat t 21

<210> 21

<211> 987

<212> DNA

<213> mouse (Mus musculus)

<400> 21

ctctatgtca tgcgaggtcc agtacatcta actacaggca tacctaggta aaagaattca 60

agtggcatgc aacagaggtt actgtgcact gcccgataga ggacacggat ccataacttc 120

gtataatgta tgctatacga agttatcgag tcgctattct gtgcagcttt atcatgtgtg 180

tgttgcttta attaatgagg ccaaagtagc tctcagtgct gtgatttctg ggtctcacgt 240

aacccaaatc attttgaaga cgaaaagaga acgtgggcag tcgtaaatct aatcttactt 300

tgtcaaactt cctttctctc cagttgaaca ggtgattaag cccaagaaaa acaagacaga 360

aggagaaaag tctacagaaa aacccaaaag gaagaaaaag ggaggcaaaa atggaaaagg 420

cagaaggaat aagaagaaaa agaatccatg cactgccaag tttcagaact tttgcattca 480

tggcgaatgc agatacatcg agaacctgga ggtggtgaca tgcaagtagg tttgtttcct 540

acacaacacc tgaaatcccc atcaatagaa actattcact tttccagtgt gtaaaccaag 600

gatttcatga gccaacatta tgtttgtaca ggcaattaaa atataagcat gtaaatcccg 660

cggataactt cgtataatgt atgctatacg aagttatact agtccaacgg aaaaaagatt 720

cttagcttaa aggctgtaac aaatagcttt atggctactg gtgcacagta tcattttatt 780

ataaatatta tatgtatgca atgtatatat atatgtgcct gtacatatat tttaagcctt 840

aaaaaaaact taaagtattt atcacacaac ttttcatgtt gttctaatgt ccccaaaccc 900

tctcaacgca ctaaaactaa actaaatgat agaggaatgt attagctgtg acaccaggag 960

tcaaagtcat cgcttggtcc taaaaga 987

<210> 22

<211> 430

<212> DNA

<213> mouse (Mus musculus)

<400> 22

ctctatgtca tgcgaggtcc agtacatcta actacaggca tacctaggta aaagaattca 60

agtggcatgc aacagaggtt actgtgcact gcccgataga ggacacggat ccataacttc 120

gtataatgta tgctatacga agttatcgag tcgaaaaaag attcttagct taaaggctgt 180

aacaaatagc tttatggcta ctggtgcaca gtatcatttt attataaata ttatatgtat 240

gcaatgtata tatatatgtg cctgtacata tattttaagc cttaaaaaaa acttaaagta 300

tttatcacac aacttttcat gttgttctaa tgtccccaaa ccctctcaac gcactaaaac 360

taaactaaat gatagaggaa tgtattagct gtgacaccag gagtcaaagt catcgcttgg 420

tcctaaaaga 430

Claims

1. A drug target for idiopathic pulmonary fibrosis that is AREG signaling in AT2 cells of an animal or human lung.

2. The drug target of claim 1, wherein AREG is detected in AT2 cells of the lungs of animals and humans with Idiopathic Pulmonary Fibrosis (IPF) and is not expressed in AT2 cells of normal lungs of animals or humans.

3. The drug target of claim 1, wherein AREG is detected in Cdc42AT2 gene null lung AT2 cells and after PNX, the expression level of AREG is elevated in Cdc42AT2 gene null lung AT2 cells.

4. The drug target of claim 1, wherein the expression level of AREG is up-regulated in AT2 cells of the lungs of an animal or human afflicted with progressive fibrosis.

5. The pharmaceutical target according to any one of claims 1 to 4, wherein AREG signaling in AT2 cells of the lungs of the animal or human is an AREG target.

6. The drug target of claim 5, wherein the AREG target is AREG in AT2 cells from the lungs of an animal or human.

7. The drug target of claim 5, wherein the AREG target is a receptor for AREG in AT2 cells of the lungs of an animal or human.

8. The pharmaceutical target of claim 5, wherein the AREG target is EGFR in fibroblasts of the lung of an animal or human.

9. The drug target of claim 8, wherein the intensity of EGFR signaling in α -SMA positive fibroblasts is dependent on the expression of AREG in AT2 cells.

10. The drug target of claim 1, wherein the drug target reduces the expression level of AREG in AT2 cells of the lung of an animal or human.

11. A method of producing a transgenic mouse in which Areg is overexpressed in AT2 cells, wherein Areg is specifically overexpressed in AT2 cells of the lung of the mouse.

12. The method of claim 11, wherein the method comprises the step of specifically inducing expression of Areg in AT2 cells after doxycycline treatment.

13. The method of claim 11 or 12, wherein the transgenic mouse produced is Spc-rtTA; teto-Areg mice.

14. The method of claim 13, wherein the Spc-rtTA; the teto-Areg mouse has the amino acid sequence of SEQ ID NO: 18, and (b) a signature sequence shown in 18.

15. For identifying Spc-rtTA produced in claim 14; a primer sequence pair for a teto-Areg mouse, wherein the primer sequence pair has the following sequence:

forward direction: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19);

and (3) reversing: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

16. A transgenic mouse in which AREG is specifically overexpressed in AT2 cells of the lung.

17. The transgenic mouse of claim 16, wherein the transgenic mouse is a transgenic mouse over-expressed by Areg AT 2.

18. The transgenic mouse of claim 16 or 17, wherein the transgenic mouse is Spc-rtTA; teto-Areg mice.

19. The transgenic mouse of claim 18, wherein the Spc-rtTA; the teto-Areg mouse has a sequence consisting of SEQ ID NO: 18, and (b) a signature sequence shown in 18.

20. The transgenic mouse of claim 19, wherein the Spc-rtTA; teto-Areg mice can be identified using the following primer sequences:

forward direction: GTACCCGGGATGAGAACTCCG (SEQ ID NO: 19);

and (3) reversing: GCCGGATATTTGTGGTTCATT (SEQ ID NO: 20).

21. Use of AREG in AT2 cells of the lung and/or its receptor EGFR in fibroblasts as a drug target for the treatment of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in animals and humans.

22. Use of an AREG target or transgenic mouse as claimed in the preceding claims for screening a medicament for the treatment of pulmonary fibrosis, particularly Idiopathic Pulmonary Fibrosis (IPF), in an animal or human.

Use of a detector of AREG and/or of its receptor EGFR for the manufacture of a diagnostic kit for the diagnosis of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in an animal or human.

24. Use according to claim 23, wherein the kit is for a sample of an animal or human suspected to suffer from pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF).

25. Kit according to claim 24, wherein the sample is a biopsy, such as lung tissue from an animal or human, preferably from the lower, middle or upper part of the lobes of the animal or human.

26. Use according to claim 25, wherein AREG is detected in the upper part of the lung lobes from an animal or human being, said animal or human being is diagnosed with severe pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF).

27. Use of a substance that targets AREG and/or its receptor in AT2 cells of the lung, for example EGFR in fibroblasts, in the manufacture of a medicament for the treatment of pulmonary fibrosis, in particular Idiopathic Pulmonary Fibrosis (IPF), in an animal or human.

28. The use of claim 27, wherein the agent is an inhibitor of AREG in AT2 cells of the lung or an inhibitor of EGFR in fibroblasts of the lung.

29. The pharmaceutical target according to any one of claims 1 to 10, and the use according to any one of claims 22 to 28, wherein the animal is a mouse, rabbit, rat, dog, pig, horse, cow, sheep, monkey, or chimpanzee.