CN113789272B

CN113789272B - Saccharomyces cerevisiae suitable for brewing flower red fruit wine and application thereof

Info

Publication number: CN113789272B
Application number: CN202111215713.6A
Authority: CN
Inventors: 刘春凤; 李崎; 王壬; 王金晶; 钮成拓; 郑飞云; 许鑫
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-10-19
Filing date: 2021-10-19
Publication date: 2023-07-04
Anticipated expiration: 2041-10-19
Also published as: CN113789272A

Abstract

The invention discloses a saccharomyces cerevisiae suitable for brewing flower red fruit wine and application thereof, belonging to the technical field of bioengineering fermentation. The Saccharomyces cerevisiae (Saccharomyces cerevisiae) Wr-23 is preserved in China general microbiological culture Collection center (CGMCC) in the 26 th month of 2021, and the preservation number is CGMCC No.22960; the strain can adapt to the fermentation environment of the flower red juice, has fast fermentation speed and thorough fermentation, has plump mouthfeel after the fermentation wine is distilled and obvious flower red fruit fragrance typically, and has wide application prospect in industrialized preparation of fruit wine.

Description

Saccharomyces cerevisiae suitable for brewing flower red fruit wine and application thereof

Technical Field

The invention relates to a saccharomyces cerevisiae suitable for brewing flower red fruit wine and application thereof, belonging to the technical field of bioengineering fermentation.

Background

The Maojian flowers and red fruits are one of the characteristic non-matter cultural heritage of Li-Yang in Jiangsu province and are mainly distributed in Maojian villages in Li-Yang Xinchang areas. The Maojian flower has bright red color, round and moist head, nutrition and health, however, because of higher acidity, the direct eating is easy to cause discomfort of sensitive consumers; in addition, because the south plum rain season is longer, the risk of fruit drop of the red flowers and the difficulty of storage are indirectly increased, and the market value of the red flowers is reduced. The development of the flower red brewed wine has important significance for improving the added value of flower red fruit products and inheriting non-matter cultural heritage of Jiangsu province.

Saccharomyces cerevisiae belongs to the taxonomic kingdom of eukaryotes, the kingdom of fungi, the phylum ascomycota, the phylum Saccharomyces, the class of semi-ascomycetes, the order Saccharomyces, the family Saccharomyces, the genus Saccharomyces. Saccharomyces cerevisiae colonies are round, glossy, flat and clean in edge, and cells are cultivated in wort in small round or oval shapes. The proper growth temperature is 28-30 deg.c and the optimal pH value is 4-5. Saccharomyces cerevisiae plays a vital role in fruit wine fermentation, and flavor substances generated after fermentation of different yeasts are greatly different. At present, the production of various fruit wines in China lacks of special Saccharomyces cerevisiae, most of which use commercial active dry yeasts for brewing wine, and the fermentation of a large amount of commercial active dry yeasts can cause slow fermentation and loss of the characteristic flavor of the fruit wine, so that the screening of a special yeast suitable for fermentation of the red brandy is very important.

Disclosure of Invention

In order to solve the problems in the current fruit wine brewing, the invention provides a saccharomyces cerevisiae suitable for brewing flower red fruit wine and application thereof, and the technical scheme is as follows:

the first object of the invention is to provide a Saccharomyces cerevisiae (Saccharomyces cerevisiae) Wr-23 suitable for brewing flower red fruit wine, wherein the Saccharomyces cerevisiae has been preserved in China general microbiological culture Collection center with the preservation number of CGMCC No.22960 and the preservation address of North West road No. 1, no. 3 in the Korean region of Beijing city at the 26 th month of 2021.

A second object of the present invention is to provide a method for culturing Saccharomyces cerevisiae by inoculating Saccharomyces cerevisiae Wr-23 into YPD liquid medium for culturing.

In one embodiment of the present invention, the culture is performed at 20 to 30℃and 100 to 200 rpm.

A third object of the present invention is to provide a method for preparing a flower red fruit wine by using Saccharomyces cerevisiae Wr-23.

In one embodiment of the invention, the Saccharomyces cerevisiae Wr-23 is inoculated into sterilized fermentation raw materials containing flower red or flower red fruit juice, and fermented at 20-30 ℃ to constant weight.

In one embodiment of the invention, the Saccharomyces cerevisiae Wr-23 is in final concentration in the fermentation systemDegree of not less than 10 ⁷ cfu/ml。

In one embodiment of the present invention, the fermentation time is 8 to 11d.

The fourth object of the invention is to provide a microbial agent containing the Saccharomyces cerevisiae Wr-23.

In one embodiment of the invention, the microbial agent is a solid or liquid agent.

In one embodiment of the invention, the preparation method of the solid microbial inoculum comprises the following steps: inoculating 200-600 mu L of Saccharomyces cerevisiae Wr-23 into 10-30 mL of YPD liquid culture medium, activating at 28deg.C for 2-3 generations until Saccharomyces cerevisiae Wr-23 reaches 10 ⁸ centrifuging at 5000-10000 rpm for 10-20 min when the viable count is above cfu/mL, removing supernatant, sequentially adding buffer solution and cryoprotectant in sterile environment until the cell concentration is not less than 10 ⁶ And (3) at cfu/mL, performing vacuum freeze drying treatment to obtain the solid microbial inoculum.

In one embodiment of the present invention, the cell concentration is not less than 10 ⁷ And (3) at cfu/mL, performing vacuum freeze drying treatment to obtain the solid microbial inoculum.

In one embodiment of the present invention, the buffer is physiological saline or 0.1-1M phosphate buffer with pH value of 5-8, and the protective agent is sucrose solution with concentration of 10-25% (w/v).

In one embodiment of the invention, the buffer is double distilled water and/or physiological saline or 0.2M phosphate buffer with pH value of 7, and the cryoprotectant is 15% -20% (w/v) sucrose solution.

In one embodiment of the invention, the preparation method of the liquid microbial inoculum comprises the following steps: 200-600 mu L of Saccharomyces cerevisiae Wr-23 is inoculated into 10-30 mL of YPD liquid culture medium, activated for 2-3 generations at 25-28 ℃, and the temperature of the Saccharomyces cerevisiae Wr-23 reaches 10 ⁸ When the number of viable bacteria is more than cfu/mL, centrifuging for 10-20 min at 5000-10000 rpm, removing supernatant, inoculating into a flower red fruit juice culture medium, and activating for 20-30 h at 25-28 ℃ at 150-200 rpm to obtain a liquid microbial inoculum.

The fifth object of the present invention is to provide a method for improving the fermentation efficiency of flower red fruit wine, wherein the Saccharomyces cerevisiae or the microbial agent is added into the fermentation raw material containing flower red or flower red fruit juice.

In one embodiment of the present invention, the concentration of yeast cells in the liquid microbial inoculum is not less than 10 ⁸ cfu/mL。

In one embodiment of the invention, the flower red juice culture medium has a sugar content of 150-200 g/L and titratable acid of 6.8-7.2 g/L.

The sixth object of the invention is to provide a method for improving the flavor of the flower red fruit wine, which is to add the saccharomyces cerevisiae or the microbial agent into a fermentation raw material containing flower red or flower red fruit juice, and ferment for 8-11 days to prepare the fruit wine.

The invention also protects the saccharomyces cerevisiae Wr-23 or microbial agent, or the method for preparing the flower red fruit wine, or the method for accelerating the fermentation of the flower red fruit wine, or the application of the method for improving the flavor of the flower red fruit wine in preparing fruit juice or alcoholic drinks.

The invention has the beneficial effects that:

the saccharomyces cerevisiae CGMCC NO.22960 provided by the invention is used for brewing the flower red fruit wine, can adapt to the fermentation environment of the flower red fruit juice, has fast fermentation speed and thorough fermentation, and has soft taste and strong fragrance of the fermented fruit wine and typical flower red fruit fragrance. Compared with the flower red fruit wine prepared by the commercial strain D254, the flower red fruit wine prepared by the saccharomyces cerevisiae has the advantages that the alcohol compounds in the fermented flower red fruit wine are increased by 52.70 percent, the ester compounds are increased by 17.35 percent, and the flower red fruit wine has good application prospect in industrial production.

Preservation of biological materials

The Saccharomyces cerevisiae Wr-23 provided by the invention is named as Saccharomyces cerevisiae Saccharomyces cerevisiae in taxonomy, and is preserved in China general microbiological culture Collection center (CGMCC) No.22960 in the year 2021 and 26, and the preservation address is North Chen West Lu No. 1 and No. 3 in the Korean region of Beijing city.

Drawings

FIG. 1 is a diagram of strain gas production;

FIG. 2 is a Chalk agar plate screen;

FIG. 3 is a Biggy agar plate screen;

FIG. 4 is a gel sugar electrophoresis diagram of a yeast 18S rDNA PCR product;

FIG. 5 is a construction of a phylogenetic tree of yeast strains based on 18S rDNA sequencing.

Detailed Description

For the purpose of making the objects, technical solutions and advantages of the present invention more apparent, the embodiments of the present invention will be described in further detail with reference to the accompanying drawings.

Culture medium used in strain selection and performance determination in the examples of the present invention:

YPD Medium (g/L): glucose 20.0, peptone 20.0, yeast powder 10.0

YPD Medium plates, inclined plane (g/L): glucose 20.0, peptone 20.0, yeast powder 10.0, agar powder 20.0.

Commercial Biggy agar medium: qingdao sea Bo Biotechnology Co., ltd.

Chalk agar medium: 0.3% of yeast powder, 18% of glucose, 0.3% of calcium carbonate and 1.5% of agar

Fermentation medium: the sugar content of the red flower juice is 200g/L, and the titratable acid is 7.12g/L.

Example 1: screening and identification of Saccharomyces cerevisiae

In this example, the strain was screened as follows:

1. bacterial separation

Squeezing 3-5 fructus Polygoni orientalis to obtain juice, adjusting sugar degree to 22 ° Brix, pouring into sterile triangular flask, and naturally fermenting in a constant temperature incubator at 28deg.C. In the later stage of natural fermentation, 2mL of the bacterial liquid is taken and serially diluted by 0.85% physiological saline for 7 concentration gradients, the diluted bacterial liquid is evenly coated on an antibacterial YPD plate containing 25mg/L ampicillin and 100mg/L streptomycin sulfate, the bacterial liquid is cultured for 2 days at 28 ℃, and the growth condition of bacterial colonies is observed. Each group of three are parallel. Single colonies with characteristics of typical yeasts in the cultured plates were picked up and subjected to secondary streak separation in YPD plates. The isolated saccharomycete single colony is cultured, then connected into a glycerol pipe for preservation at the temperature of minus 80 ℃ and numbered.

2. Primary screening of strains

The strain preserved by the glycerol tube is inoculated into a YPD liquid test tube, activated for 18-24 hours at 28 ℃ and 180r/min, respectively inoculated into a flower red fruit juice liquid culture medium containing Du's tubule in an inoculum size of 5%, cultured for 48 hours at 20 ℃, and the strain with fast fermentation speed is reserved for the next stage of screening according to the bubble generation condition in the culture medium. As shown in FIG. 1, FIG. 1 shows the red flower juice medium containing Dunaliella salina after 48h of culture.

Due to the high concentration of solutes in juice, yeast is subjected to a large osmotic stress, which leads to an increase in the concentration of acetic acid in the product. This feature was determined by spotting 5 μl of inoculum on Chalk agar (0.3% yeast powder, 18% glucose, 0.3% calcium carbonate, 1.5% agar) medium. The acetogenic capacity of yeast is determined by the size of the transparent ring. After 3d incubation at 28 ℃, yeasts are classified according to the following scale: halo < 1mm, +; halo is 1mm to 3mm, ++; the halo is greater than 3mm and, ++, and. The results of the strain culture are shown in FIG. 2.

The ability of yeast to produce hydrogen sulfide is related to off-flavors in the fermented product, negatively affecting the fruit wine, and the formation of hydrogen sulfide during fermentation is strain dependent. This feature was determined by spotting 5. Mu.L of inoculum on commercial medium Biggy agar. The ability of yeast to produce hydrogen sulfide is judged by the color of the colony. After 2d incubation at 28 ℃, yeasts are classified according to the following scale: white, +; light brown, ++; dark brown, ++ - +, the results of the strain culture are shown in FIG. 3.

The results of screening the strains for fermentation ability, volatile acid production and hydrogen sulfide production ability are shown in Table 1.

TABLE 1 screening results for strains

In the strain isolation test, 88 strains were isolated from the natural fermentation broth of the flower red juice. Depending on the screening criteria, there were 73 strains that did not produce bubbles or produced bubbles that did not fill Du Shixiao tubes after 48h of resting at 20 ℃, which means they could ferment slowly or even not ferment sugar. For acetic acid production, 48 strains produced transparent circles below 3mm, which is a low-acetogenic strain. The ability of yeasts to produce hydrogen sulfide was evaluated by pigmentation of strains on a Biggy agar medium, 30 of which formed white or light brown colonies, classified as low-hydrogen sulfide-producing strains. After three plate screens, only strains 18, 57, 58 and 59 have quick fermentation speed, low hydrogen sulfide production and low acid volatility. These 4 strains were selected to ferment the flower red fruit wine and the ability of these strains to ferment the flower red fruit wine was further evaluated.

3. Secondary screening of strains

Inoculating 4 potential Saccharomyces cerevisiae strains obtained by primary screening into a red flower juice culture medium, and measuring basic physicochemical indexes of the fruit wine after fermentation by taking commercial Saccharomyces cerevisiae D254 as a reference, wherein the measuring method is referred to GB/T15038-2006 general analysis method for grape wine and fruit wine, and the results are shown in Table 2.

TABLE 2 basic physicochemical index

The weight loss of the red flower fruit juice after 10d inoculation and fermentation is stable, and the red flower fruit wine is centrifugally separated. As can be seen from Table 2, at the same fermentation time, the flower and red fruit wines fermented by the

strains

58, 59 were the highest in alcoholicity and the lowest in total sugar content in the fruit wine. Compared with commercial bacteria D254, the

strains

58 and 59 have faster fermentation speed and more thorough fermentation. Meanwhile, the volatile acid content in the fruit wine is obviously different, the volatile acid content of the fermented flower-red fruit wine of the screened strain is lower than that of commercial bacteria, and particularly the volatile acid content in the flower-red fruit wine fermented by 58 and 59 is the lowest.

4. Sensory evaluation

The fermented flower red fruit wine of the above 5 strains was subjected to sensory evaluation by 11 members having fruit wine evaluation experience to evaluate the ability of these yeast strains to produce high quality flower red fruit wine, and the average of the sensory scores is shown in table 3.

Table 3 sensory evaluation score

As shown in Table 3, the sensory evaluation total score of the fermented flower-red fruit wine of the selected strains 11, 57, 58 and 59 is higher than that of the commercial strain D254, the sensory score of the strain 59 is highest, and the physicochemical index and the sensory evaluation result of the fermented flower-red fruit wine are comprehensively obtained, so that the strain 59 is most suitable for brewing the flower-red fruit wine.

6. Identification of species

The slant deposited strain 59 was selected and cultured in 10mL of YPD medium at 28℃and 150rpm for 24 hours. Proper amount of culture solution is taken for centrifugation for 1min, supernatant is discarded, bacterial DNA is extracted by using a yeast DNA extraction kit, genomic DNA is amplified by using yeast 18s universal primers ITS1 and ITS4, and PCR products are detected by using 2% agarose gel electrophoresis (as shown in FIG. 4) and sequencing is performed.

ITS1：TCCGTAGGTGAACCTGCGG(SEQ ID No.1)，

ITS4：TCCTCCGCTTATTGATATGC(SEQ ID No.2)。

The determined 18srDNA sequence was aligned with the sequences of yeasts in GenBank by BLAST, and as shown in FIG. 5, strain 59 was identified as a strain of Saccharomyces cerevisiae and was renamed as Saccharomyces cerevisiae Wr-23.

Example 2: application of Saccharomyces cerevisiae Wr-23 in flower red fruit wine fermentation

Cleaning fructus Polygoni orientalis, cutting, squeezing, and adding 0.03% of vitamin C for color protection. Adding pectase to the red flower juice according to the proportion of 0.00%, 0.05%, 0.1%, 0.2% and 0.3%, treating at 55deg.C for 2h, inactivating enzyme at 65deg.C for 10min, filtering/centrifuging, measuring indexes such as turbidity, juice yield, sugar degree, pH, etc., and determining the preferred adding amount of pectase. The results of the study are shown in Table 4.

TABLE 4 fruit juice index detection results at different pectase addition levels

As can be seen from table 4: the addition of pectase has an important effect on clarifying the red flower juice, the light transmittance of a sample without pectase is only 18.18%, and after the pectase is added, the light transmittance of the juice is improved by 3-4 times, and the juice yield is improved by more than 4.37%. When the adding amount of pectase is more than 0.05%, the juice yield is stable, and in order to ensure the taste of the finished wine, the adding amount of pectase of 0.05% is selected as a follow-up research parameter.

Treating with pectase at 55deg.C for 1 hr, 1.5 hr, 2 hr, 2.5 hr, and 3 hr respectively at 65deg.C for 10min, filtering/centrifuging, and examining the influence of different pectase action time on indexes such as turbidity, juice yield, sugar degree, pH, etc. of fruit juice to determine the optimal action time of pectase. The results are shown in Table 5.

TABLE 5 fruit juice index detection results at different pectase action times

As can be seen from table 5: the light transmittance of the fruit juice is gradually increased along with the extension of the action time of the pectase, and the action time of the pectase is increased by 12.80 percent compared with the light transmittance of the fruit juice in the action time of 0 h; the juice yield and sugar degree are not greatly changed after the action for 1h by combining with other detection indexes, and the optimal action time of the pectase is 1h because the fruit juice is required to be fermented and filtered after fermentation later and the production efficiency and the production energy efficiency are considered.

The preparation process is determined to obtain the safflower fruit juice with sugar content of 100g/L, white granulated sugar is used for regulating the initial sugar degree to 200g/L, 5% of Saccharomyces cerevisiae Wr-23 is inoculated, and the final concentration of Saccharomyces cerevisiae Wr-23 in a fermentation system is 10 ⁷ cfu/ml, fermentation at 23℃for 10d. Fermentation knotAfter the bundling, the volatile flavor substances in the flower red fruit wine were quantitatively analyzed, and the results are shown in table 5.

The GC-MS analysis comprises the following specific steps:

sample pretreatment extraction conditions: in a 20mL headspace bottle, 8m flower red fruit wine sample, 3.0g NaCl was added, preheated at 45℃for 5min, and extracted for 60min. After extraction is completed, the extraction head is inserted into a sample inlet, desorption is carried out for 5min, GC-MS analysis is carried out, and the volatile compounds are quantified by an external standard method.

The analysis conditions were: GC conditions: PEG.20m elastic quartz capillary column, 30ITI X0.25 in x0.25 Ixm; the carrier gas is high-purity helium, and the constant flow is 0.8 mL.min ^-1 The method comprises the steps of carrying out a first treatment on the surface of the Heating program: starting at 180deg.C, holding for 2min at 3deg.C ^-1 Heating to 230 ℃, and keeping for 10min; the temperature of the sample inlet is 250 ℃, and the temperature of the sample outlet is 200 ℃; the detection voltage is 350V. MS conditions: EI ion source, emission current is 200 muA, electron energy is 70eV, and scanning range is 20-550U.

TABLE 6 quantitative analysis of Main volatile Compounds in flower red fruit wine

The results of quantitative determination of 8 alcohols, 16 esters, 2 terpenes and 4 fatty acids in the red flower fruit wine are shown in table 6. There are significant differences in the different yeast fermented flower and red fruit wines. Isoamyl alcohol, phenethyl alcohol, n-propanol and isobutanol are main alcohol compounds in the red flower fruit wine, accounting for more than 97.78% of the total alcohol. Ethyl acetate and ethyl lactate are the main ester compounds in the red flower fruit wine, accounting for more than 95.02% of the total esters. Wherein the total amount of volatile compounds in the yeast Wr-23 fermented flower red fruit wine is the highest. Compared with the fermentation of commercial bacteria D254, the alcohol compounds in the Wr-23 fermented flower red fruit wine are increased by 52.70 percent, and the ester compounds are increased by 17.35 percent.

Example 3: preparation of microbial agent of Saccharomyces cerevisiae Wr-23

Inoculating 200-600 mu L of Saccharomyces cerevisiae Wr-23 into 10-30 mL of YPD liquid culture medium, activating at 28deg.C for 2-3 generations until Saccharomyces cerevisiae Wr-23 reaches 10 ⁸ centrifuging at 5000-10000 rpm for 10-20 min when the viable count is above cfu/mL, removing supernatant, sequentially adding buffer solution (physiological saline or 0.2M phosphate buffer solution with pH value of 7) and cryoprotectant (sucrose solution with pH value of 15% -20% (w/v)) under aseptic environment, and keeping cell concentration at not lower than 10 ⁷ And (3) at cfu/mL, performing vacuum freeze drying treatment to obtain the solid microbial inoculum.

Example 4: application of microbial agent in preparation of fruit juice

For specific embodiment, see example 2, the microbial agent is diluted by water and then added into a fermentation system, and the fermentation is carried out for 10 days at 25 ℃ to obtain the flower-red fruit wine.

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Jiangnan

<120> a strain of Saccharomyces cerevisiae suitable for brewing flower red fruit wine and application thereof

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 19

<212> DNA

<213> Synthesis

<400> 1

tccgtaggtg aacctgcgg 19

<210> 2

<211> 20

<212> DNA

<213> Synthesis

<400> 2

tcctccgctt attgatatgc 20

Claims

1. Saccharomyces cerevisiaeSaccharomyces cerevisiae) The method is characterized in that the saccharomyces cerevisiae is preserved in China general microbiological culture collection center (CGMCC) of China general microbiological culture Collection center (China general microbiological culture collection center) for type culture collection of the saccharomyces cerevisiae in the year 07 of 2021 and the 26 of the year 07, and the preservation number is CGMCC No.22960.

2. A method for preparing a flower red fruit wine, which is characterized in that the flower red fruit wine is prepared by using the saccharomyces cerevisiae according to claim 1.

3. The method according to claim 2, wherein the saccharomyces cerevisiae is added into a fermentation raw material containing flower red or flower red fruit juice, and the fermentation is carried out at 20-30 ℃ to obtain flower red fruit wine.

4. A method according to claim 3, wherein the final concentration of saccharomyces cerevisiae in the fermentation system is not less than 10 ⁷ cfu/ml。

5. The method of claim 4, wherein the fermentation is performed for 8 to 11 days.

6. A microbial agent, wherein the microbial agent comprises the saccharomyces cerevisiae according to claim 1.

7. The microbial agent of claim 6, wherein the microbial agent is a solid or liquid agent.

8. A method for improving the fermentation efficiency of flower red fruit wine, which is characterized in that the saccharomyces cerevisiae according to claim 1 or the microbial agent according to claim 6 or 7 is added into a fermentation raw material containing flower red or flower red fruit juice.

9. A method for improving the flavor of flower red fruit wine is characterized in that the saccharomyces cerevisiae as claimed in claim 1 or the microbial agent as claimed in any one of claims 6-7 is inoculated into a fermentation raw material containing flower red or flower red fruit juice, and the fermentation is carried out for 8-11 days to prepare the fruit wine.

10. The saccharomyces cerevisiae of claim 1, or the application of the microbial agent of claim 6-7 in preparing fruit wine.