CN113789267A - Marine-derived aspergillus terreus M7 with antibacterial effect and separation and application of secondary metabolite thereof - Google Patents

Abstract

The invention belongs to the technical field of microorganisms, and relates to separation and application of marine aspergillus terreus M7 with antibacterial effect and a secondary metabolite thereof; the strain is classified and named as Aspergillus terreus M7, and is preserved in China center for type culture Collection with the preservation number: CCTCC NO: M2021679, and the preservation date is 6 months and 7 days in 2021. Fermenting the strain with soybean solid culture medium, and separating and purifying by methanol extraction, silica gel G chromatography, Sephadex LH-20 gel column chromatography, silica gel H chromatography, and preparative liquid phase to obtain compound Terramide A. Terramide A has significant antibacterial activity against Acinetobacter baumannii ATCC19606 and has potential for development as an antibacterial agent.

Description

Marine-derived aspergillus terreus M7 with antibacterial effect and separation and application of secondary metabolite thereof

Technical Field

The invention belongs to the technical field of microorganisms, and relates to a method for extracting and separating secondary metabolites of Aspergillus terreus and application of the secondary metabolites.

Background

Many of the antibiotics currently used clinically are mostly derived from secondary metabolites of microorganisms or derivatives thereof. However, with the continuous development of natural microbial resources, the way to discover new species of microorganisms to develop new antibiotics has become more and more difficult. The frequent use of clinical antibiotics directly leads to the increasing resistance of existing antibiotics. Compared with land environment, marine environment has the characteristics of no illumination, low nutrition, high pressure, high salt content and low temperature. Due to the harsh conditions of marine survival, microorganisms, particularly fungi, living therein have evolved, through long-term natural selection, a more complex metabolic system compared to terrestrial fungi. Therefore, the marine microorganism is taken as a research material, so that the target hit probability of the active compound is greatly improved.

Aspergillus is widely studied for its abundant secondary metabolites. As a filamentous fungus which is widely distributed in a marine environment, the aspergillis has been evolved for a long time to adapt to the marine extreme environment. The abundant variety of secondary metabolites is one of the reasons that these Aspergillus fungi are very important for their ability to adapt to the environment. The secondary metabolites synthesized by these Aspergillus fungi exhibit a variety of different structural types, of which polyketides and alkaloids constitute the major part, and further terpenes, steroids, polypeptides, cyclic peptides, macrolides, anthraquinones and other types of compounds. Thus, the ability of the fungi to produce valuable secondary metabolites can be exploited to the greatest extent by various culture methods under laboratory conditions.

Disclosure of Invention

It is an object of the present invention to provide a method for fermentation of the Aspergillus terreus and isolation of the active secondary metabolites.

The invention also aims to provide the function of the secondary metabolite of the marine aspergillus fungus M7 in inhibiting acinetobacter baumannii 19606.

The technical scheme adopted by the invention for realizing the two purposes is as follows:

a Aspergillus terreus M7(Aspergillus terreus) is preserved in China center for type culture, with preservation time of 2021 year, 6 months and 7 days, and preservation number is CCTCC NO: M2021679.

According to a first aspect of the present invention, there is provided a process for the preparation of a secondary metabolite of aspergillus terreus, the process comprising:

(1) spore preparation:

inoculating glycerol tube of Aspergillus terreus M7 stored in-80 deg.C ultra-low temperature refrigerator on PDA plate, and culturing in dark at 28 deg.C for 3 days.

(2) Preparing a seed solution:

after single colonies were grown on PDA plates, spores and hyphae were scraped into 300ml of PDB liquid medium with a sterile inoculating loop, cultured at 200rpm, 28 ℃ for 4 days.

(3) Fermentation of bacterial strains

Inoculating the seed solution into solid fermentation culture medium at a ratio of 1ml seed solution/10 g culture medium, and standing for 30 days.

(4) Secondary metabolite extraction

Soaking the solid fermentation product in ethanol at a ratio of 10L/1kg, ultrasonic extracting for 30min, and vacuum filtering to obtain extractive solution. Leaching for three times. Removing liquid by rotary evaporation at 40 ℃ under reduced pressure, and mixing the extract with ethyl acetate 1:1, extracting for three times, and carrying out decompression rotary steaming on the extracted ethyl acetate at 40 ℃ to obtain a fermented extract.

(5) Separating and purifying

And sequentially carrying out silica gel G chromatography, Sephadex LH-20 gel column chromatography, silica gel H chromatography and preparative liquid phase separation and purification on the final fermentation extract to obtain the teramidea.

Preferably, in the step of fermenting the strain, the fermentation medium selected is soybean medium.

Preferably, in the step of fermenting the strain, the fermentation conditions selected are dark, 28 ℃ and 30 days.

Preferably, in the secondary metabolite extraction step, methanol is used as a leaching solution, the methanol can destroy cell walls and is beneficial to leaching of the secondary metabolites, ultrasonic extraction is more beneficial to destroying the cell walls, and extraction of the secondary metabolites is accelerated.

Preferably, in the separation and purification step, the silica gel G chromatographic column, the Sephadex LH-20 chromatographic column, the silica gel H chromatographic column, the preparative liquid phase and the eluent of the ODS column chromatographic column are sequentially as follows: dichloromethane-methanol, dichloromethane-methanol, methanol-water.

According to a second aspect of the present invention, there is provided a compound TeramideA isolated from the secondary metabolite of Aspergillus terreus mentioned above, which is a white solid and has the formula C₁₂H₂₂N₂O₄. The compound has obvious inhibiting effect on Acinetobacter baumannii ATCC19606, and the MIC value is 32 mu g/ml.

The invention has the beneficial effects that:

(1) the terramide A is obtained by separating and purifying secondary metabolites of aspergillus terreus from deep sea, has obvious bacteriostatic activity on acinetobacter baumannii 19606, and has the potential of being developed into an antibacterial agent of acinetobacter baumannii.

(2) Before a large amount of fermentation, the culture medium and the culture conditions are optimized, and the culture medium and the culture conditions with higher teramidea yield are selected for fermentation, so that more target products are obtained, the operation is simple, and the cost is low.

Drawings

FIG. 1 is a photograph of Aspergillus terreus M7 grown on MEA medium for 5 days;

FIG. 2 is a micrograph of the Aspergillus terreus M7 strain Gossypium hirsutum staining (magnification 40 times);

FIG. 3 shows the results of secondary metabolite activity of Aspergillus terreus M7 in different media and culture conditions;

FIG. 4 is an HPLC chromatogram of terramideA;

FIG. 5 is 1H-NMR of terramideA;

FIG. 6 is 13C-NMR of terramideA.

Detailed Description

The scheme of the invention is further illustrated by the following examples:

example 1: strain morphological identification and molecular biological identification

(1) Preparing a seed solution: the glycerol tube of the strain M7 isolated from the sponge sample derived from south sea stored in an ultra-low temperature freezer of-80 ℃ was inoculated on a PDA plate, and the culture was allowed to stand at 28 ℃ for 3 days. Preparing PDA plate (fungus culture medium: 5.0g potato extract powder, 20.0g glucose, 20.0g agar, seawater crystal 33.0g, H₂O1L; PH adjusted to 6.0), after significant hyphae had grown out, an appropriate amount of sterile water was added, hyphae were washed off with a sterile inoculating loop, and the spore suspension was inoculated into 200ml of PDB liquid medium (fungal medium: 10.0g of potato extract powder; 20.0g glucose; sea quartz 33.0 g; h₂O1L; pH was adjusted to 6.0), 28 ℃, 200rpm, 3 days.

And (3) morphological identification: the seed liquid was inoculated onto MEA plates (20.0g maltose extract; 1.0g peptone; 20.0g glucose; 0.005g CuSO) at 2ul per spot by a three-point method₄.5H₂O；0.01g ZnSO4.7H₂O; 20.0g agar; sea quartz 33.0 g; h₂O1L; adjusting the pH to 7.0-7.5). After the seed liquid is completely absorbed by the MEA culture medium, the seed liquid is inversely cultured for 5 days at 28 ℃ in a constant temperature incubator. Preparing hypha slide: by inserting into a piece, 1.0cm × 1.0cm coverslip is autoclaved, inserted at 45 ° to the vicinity of the inoculation point, and cultured in a constant temperature incubator at 28 ℃ for 5 days in an inverted manner.

The morphological characteristics of the strain are as follows: after the colony surface is in a dense velvet shape or a flocculent shape after being inversely cultured on an MEA medium at 28 ℃ for 5 days, the color of the mycelium is white, the central area is slightly raised, the color of the edge area is white, and yellow pigment is generated (see figure 1). After the hypha slide is stained by cotton blue, the hypha is observed by a microscope (the magnification is 40 times), the hypha has septal hyphae, the conidium head is compact and straight column-shaped, the apical sac is hemispherical, and the conidium is small. Morphological characteristics similar to those of the Aspergillus terreus fungus (see FIG. 2).

(2) Molecular biological identification: mycelia on The MEA plate were picked, DNA was extracted using Nanjing engine plant genome DNA extraction kit, and The gene spacer sequences of housekeeping genes 5.8S rDNA and 28S rDNA (ITS) were amplified using this as a template.

The ITS PCR amplification primer sequences are shown below:

ITS1：5′-tccgtaggtgaacctgcgg-3′

ITS4：5′-tcctccgcttattgatatgc-3′

PCR conditions were as follows: pre-denaturation at 98 ℃ for 3 min; denaturation at 98 ℃ for 10s, annealing at 55 ℃ for 10s, and extension at 72 ℃ for 10s for 30 cycles; stretching for 5min at 72 ℃.

The sequencing result of the sequencing amplification sequence of the product amplified by the strain M7 through ITS1 and ITS4 primers by Nanjing Ongzhike Biotech Limited is as follows:

ggggctcgagtgcggggtctttatggcccacctcccacccgtgactattgtaccttgttgcttcggcgggcccgccagcgttgctggccgccggggggcgactcgcccccgggcccgtgcccgccggagaccccaacatgaaccctgttctgaaagcttgcagtctgagtgtgattctttgcaatcagttaaaactttcaacaatggatctcttggttccggcatcgatgaagaacgcagcgaaatgcgataactaatgtgaattgcagaattcagtgaatcatcgagtctttgaacgcacattgcgccccctggtattccggggggcatgcctgtccgagcgtcattgctgccctcaagcccggcttgtgtgttgggccctcgtcccccggctcccgggggacgggcccgaaaggcagcggcggcaccgcgtccggtcctcgagcgtatggggcttcgtcttccgctccgtaggcccggccggcgcccgccgacgcatttgtttgcaacttgtttttttccaggttgacctcggatcaggtagggatacccgctgaacttaagcatatcaataaagccggaggaaacgccgccggcc, respectively; and (4) passing the sequencing result through BLAST of an NCBI website, wherein the species with the highest similarity in the sequence comparison result is the similar species of the strain. The strain is subjected to sequence comparison, and the most similar species is Aspergillus terreus.

Example 2: fermentation of bacterial strains

(1) Preparing a seed solution: the preparation method is the same as that of example 1(1)

(2) Small-batch fermentation: inoculating the seed liquid into a rice solid culture medium, a corn solid culture medium and a soybean solid culture medium according to the proportion of 1ml/10g, wherein the culture time is 30 days; the culture conditions are light and dark respectively; the culture temperature was 28 ℃. Each set being two parallel.

Soaking the small-batch fermentation product in 3-time volume of ethanol overnight, ultrasonically leaching for 30min the next day, and vacuum filtering to obtain filtrate. This procedure was repeated three times. Mixing the obtained filtrates, rotary-steaming under reduced pressure to obtain fermented extract, and adding 3ml methanol to dissolve the extract to obtain fermented crude extract for antibacterial experiment.

The indicator bacteria selected for the bacteriostatic experiments were Escherichia coli (Escherichia coli), Klebsiella pneumoniae (Klebsiella aerogenes), Staphylococcus aureus (Staphylococcus aureus), Pseudomonas aeruginosa (Pseudomonas aeruginosa), Methicillin-resistant Staphylococcus aureus (MRSA), Methicillin-resistant Staphylococcus epidermidis (MRSE), Micrococcus luteus (Micrococcus luteus), Acinetobacter baumannii (Acinetobacter baumannii).

Activating indicator bacteria: the glycerol tube of the indicator bacterium stored at-80 ℃ was inoculated into 20ml of MHB liquid medium (2.0g beef powder; 1.5g soluble starch; 17.5g acid-hydrolyzed casein, pH adjusted to 7.5), cultured overnight at 37 ℃ and 200 rpm. Inoculating the activated indicator bacterium into 20ml of MHB liquid culture medium, culturing at 37 ℃ and 200rpm until OD600nm is approximately equal to 0.08-0.1, inoculating the indicator bacterium into a dish according to 100 mu L, and uniformly coating the indicator bacterium on an MHB culture plate; perforating the indicator bacteria-coated MHB plate with a sterile perforator having a diameter of about 6mm, and adding 30. mu.L of crude fermentation extract to each well; chloramphenicol at 100. mu.g/ml was used as a positive control, and methanol as a negative control. The culture was carried out in a 37 ℃ incubator for 18 h.

(3) Large-batch fermentation: seed liquid was prepared as in example 1 (1). According to the bacteriostatic activity of the small batch fermentation product of example 2(2), soybean solid medium was selected for mass fermentation. Preparing 5kg of soybean solid fermentation medium, 50g per tank, subpackaging in 100 fermentation tanks, and autoclaving at 121 deg.C for use. Inoculating the seed liquid at 5 ml/tank, culturing at 28 deg.C in dark for 30 days. Soaking the mass fermentation product in 3 times volume of ethanol overnight, ultrasonically leaching for 30min the next day, and vacuum filtering to obtain filtrate. This procedure was repeated three times. Mixing the obtained filtrates, performing rotary evaporation under reduced pressure to obtain filtrate, extracting with ethyl acetate, and performing rotary evaporation under reduced pressure to obtain fermented extract for subsequent separation and purification.

Example 3: separation and purification of target compound

(1) Dissolving the fermented extract with methanol, mixing with silica gel G (100-200 mesh), separating with silica gel G chromatographic column, gradually eluting with dichloromethane-methanol with gradient CH₂Cl₂、CH₂Cl₂-MeOH(80:1)、CH₂Cl₂-MeOH(60:1)、CH₂Cl₂-MeOH(40:1)、CH₂Cl₂-MeOH(20:1)、CH₂Cl₂MeOH (10: 1). Acinetobacter baumannii (Acinetobacter baumannii) is taken as an indicator bacterium to carry out active component screening. Active component screening is detailed in 2 (2). The active components are combined for further separation.

(2) The combined active components are dissolved by methanol and then are put into a Sephadex LH-20 gel column for further purification. And (3) screening active components of the sample after passing through the column by taking Acinetobacter baumannii (Acinetobacter baumannii) as an indicator bacterium. Active component screening is detailed in 2 (2). The active components are combined for further separation.

(3) Dissolving the combined active components with methanol, mixing with silica gel G (100-200 mesh), separating with silica gel H chromatographic column, and separating with CH₂Cl₂Stepwise elution with MeOH, gradient CH₂Cl₂、CH₂Cl₂-MeOH(80:1)、CH₂Cl₂-MeOH(60:1)、CH₂Cl₂-MeOH(50:1)、CH₂Cl₂-MeOH(40:1)、CH₂Cl₂-MeOH(30:1)、CH₂Cl₂MeOH (20: 1). Acinetobacter baumannii (Acinetobacter baumannii) is taken as an indicator bacterium to carry out active component screening. Active component screening is detailed in 2 (2). The active components are combined for further separation.

(4) The combined active fractions were purified by semi-preparative HPLC using MeOH-H₂O (55:45) to obtain the target compound.

The target compound obtained by the above separation is white solid with molecular formula of C₁₂H₂₂N₂O₄And has the following structure:

example 3: MIC assay for antibacterial activity of compounds

(1) Activating indicator bacteria: a glycerol tube of Acinetobacter baumannii ATCC19606 stored at-80 ℃ was inoculated into 20ml of MHB liquid medium (2.0g of beef powder; 1.5g of soluble starch; 17.5g of acid-hydrolyzed casein, pH adjusted to 7.5), cultured overnight at 37 ℃ and 200 rpm. The activated indicator bacteria are inoculated into 20ml of MHB liquid culture medium and cultured at 37 ℃ and 200rpm until OD600nm is approximately equal to 0.08-0.1.

(2) Diluting bacterial liquid: adding MHB liquid culture medium, adjusting the concentration of bacteria to an absorbance equal to 0.3(1 x 10)⁸CFU/ml), 1000-fold dilution to 1 x 10^5-5*10⁵CFU/ml。

(3) MIC gradient dilution: in a 96-well plate, 196. mu.l of the above-mentioned bacterial suspension was added in the first row, 100. mu.l of the above-mentioned bacterial suspension was added in the second to tenth rows, 98. mu.l of the above-mentioned bacterial suspension was added in the eleventh row, and a blank medium was added in the twelfth row.

(4) Adding medicine: the prepared compound mother liquor with a concentration of 3.2mg/ml was added in 4. mu.l to the first column, and chloramphenicol with a concentration of 5mg/ml was added in 2. mu.l to the eleventh column.

(5) Dilution by multiple times: pipette 100. mu.l from the first row of wells, add to the second row, and dilute sequentially by two-fold dilution to the tenth row.

(6) Culturing: the 96-well plate was placed in an incubator at 37 ℃ and subjected to static culture for 18 hours. The lowest concentration of compound to clarify the medium is the MIC of the compound to acinetobacter baumannii ATCC 19606.

The bacteriostatic results show that the MIC of the compound to Acinetobacter baumannii ATCC19606 is 32 mu g/ml.

Sequence listing

<110> university of Chinese pharmacy

<120> separation and application of aspergillus terreus M7 with antibacterial effect and secondary metabolite thereof from ocean

<160> 3

<170> SIPOSequenceListing 1.0

<210> 1

<211> 19

<212> DNA

<213> ITS1(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 1

tccgtaggtg aacctgcgg 19

<210> 2

<211> 20

<212> DNA

<213> ITS4(2 Ambystoma laterale x Ambystoma jeffersonianum)

<400> 2

tcctccgctt attgatatgc 20

<210> 3

<211> 598

<212> DNA

<213> sequencing results (2 Ambystoma laterale x Ambystoma jeffersonanium)

<400> 3

ggggctcgag tgcggggtct ttatggccca cctcccaccc gtgactattg taccttgttg 60

cttcggcggg cccgccagcg ttgctggccg ccggggggcg actcgccccc gggcccgtgc 120

ccgccggaga ccccaacatg aaccctgttc tgaaagcttg cagtctgagt gtgattcttt 180

gcaatcagtt aaaactttca acaatggatc tcttggttcc ggcatcgatg aagaacgcag 240

cgaaatgcga taactaatgt gaattgcaga attcagtgaa tcatcgagtc tttgaacgca 300

cattgcgccc cctggtattc cggggggcat gcctgtccga gcgtcattgc tgccctcaag 360

cccggcttgt gtgttgggcc ctcgtccccc ggctcccggg ggacgggccc gaaaggcagc 420

ggcggcaccg cgtccggtcc tcgagcgtat ggggcttcgt cttccgctcc gtaggcccgg 480

ccggcgcccg ccgacgcatt tgtttgcaac ttgttttttt ccaggttgac ctcggatcag 540

gtagggatac ccgctgaact taagcatatc aataaagccg gaggaaacgc cgccggcc 598

Claims (5)

1. A Aspergillus terreus M7(Aspergillus terreus) is preserved in China center for type culture, with preservation time of 2021 year, 6 months and 7 days, and preservation number is CCTCC NO: M2021679.

2. A method for preparing terramide A from Aspergillus terreus CCTCC NO: M2021679 as claimed in claim 1

The method is characterized by comprising the following steps:

(1) culturing Aspergillus (Aspergillus terreus M7) with preservation number (CCTCC NO: M2021679) in a culture medium to obtain a seed solution;

(2) culturing the strain seed liquid in a fermentation culture medium;

(3) adding the extracting solution to extract secondary metabolites, and concentrating under reduced pressure to obtain fermented extract;

(4) the extract is subjected to ethyl acetate extraction, silica gel G chromatography, Sephadex LH-20 gel column chromatography, silica gel H chromatography and preparative liquid phase separation and purification in sequence to obtain the terramide A.

3. The production method according to claim 2,

in the step (1), the strain culture medium is a PDB liquid culture medium;

in the step (2), the fermentation medium is a soybean fermentation medium, and the culture condition is 28 ℃, dark and static culture for 30 days;

in the step (3), the extracting solution is ethanol, and the extracting mode is soaking overnight and ultrasonic treatment for 30 minutes;

in the step (4), the ratio of ethyl acetate extraction to extraction liquid is 1:1, and the extraction is carried out for 3 times;

in the step (4), the mobile phase of the silica gel column chromatography is methanol and chloroform, and gradient elution is adopted; the mobile phase of Sephadex LH-20 gel column chromatography is methanol.

Use of teramide a for the preparation of an antibacterial medicament.

5. Use of teramide a for the preparation of an antibacterial drug according to claim 4, characterized in that said strain is acinetobacter baumannii ATCC 19606.

Images