CN113774035A

CN113774035A - Cytochrome P450 enzyme and coding gene CsCYP2 and application thereof

Info

Publication number: CN113774035A
Application number: CN202111021550.8A
Authority: CN
Inventors: 张欣欣; 孙雪丽; 易干军
Original assignee: Pomology Research Institute Guangdong Academy of Agricultural Sciences
Current assignee: Pomology Research Institute Guangdong Academy of Agricultural Sciences
Priority date: 2021-09-01
Filing date: 2021-09-01
Publication date: 2021-12-10

Abstract

The cytochrome P450 enzyme CsCYP2 gene is cloned in citrus for the first time, the cytochrome P450 enzyme can respectively utilize geranyl linalool and nerolidol as substrates to catalyze the synthesis of TMTT and DMNT, and because the two substances of TMTT and DMNT can be induced and generated after a plant is invaded by phytophagous insects, the cytochrome P450 enzyme CsCYP2 can catalyze and synthesize TMTT and DMNT by utilizing the substrates, has the functions of repelling pests and inducing the defense reaction of adjacent plants, and can attract the natural enemies of corresponding pests to control the pests.

Description

Cytochrome P450 enzyme and coding gene CsCYP2 and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a cytochrome P450 enzyme, a coding gene CsCYP2 thereof and application thereof.

Background

Cytochrome P450 (hereinafter referred to as P450) is a heme oxidase system which is widely present in cells such as animals, plants, bacteria, fungi and the like and has a mixed function by being combined with cell organelle membranes such as endoplasmic reticulum, mitochondria, plastid, Golgi body and the like, is an ancient gene superfamily, and is one of the research focuses of the international academia in recent years. P450 was first discovered as a CO-binding protein and is named because its reduced form binds CO and then has a maximum absorption at a wavelength of 450 nm. P450 can catalyze a variety of reactions, even with substrates of similar chemical structure, exhibiting a variety of reaction types. P450 generally requires molecular oxygen and NADPH in these oxidative metabolisms, and has the common feature of adding an oxygen atom to the substrate molecule, and is therefore referred to as a monooxygenase system or hydroxylase or a Mixed Function Oxidase (MFO). Plant-derived P450 s also possess these oxidase activities. The type of reaction it catalyzes is extensive and complex, mainly: epoxidation of alkenyl groups, hydroxylation of alkyl groups, dealkylation of nitrogen, sulfur and oxygen sites, oxidation of hydrocarbon groups, peroxidation, desulfurization, oxidative carbon-carbon bond cleavage, oxidative deamination, dehalogenation and dehydrogenation, etc. over 10.

Many plants produce volatile chemicals after attack by pests, and these chemicals can either repel the pests or attract natural enemies of the pests for the purpose of indirect pest control. Among them, (E, E) -4, 8, 12-trimethyl-1, 3, 7, 11-tridecatetraene (TMTT) and (E) -4, 8-dimethyl-1, 3, 7-nonatriene (DMNT) are widely present in higher plants. The two substances can be induced and generated after the plant is attacked by phytophagous insects, have the functions of repelling pests and inducing the defense response of adjacent plants, and can attract the natural enemies of corresponding pests to achieve the effect of controlling the pests. At present, no report about cloning of cytochrome P450 gene capable of catalyzing and synthesizing TMTT and DMNT and identification of catalytic products in citrus of fruit trees is available.

Disclosure of Invention

In order to overcome the defects of the prior art, the cytochrome P450 enzyme CsCYP2 gene is obtained by cloning from citrus, and the P450 enzyme can be used for catalytically synthesizing TMTT and DMNT by utilizing geranyl linalool and nerolidol substrates, so that the purpose of preventing and controlling pests is achieved.

In order to achieve the purpose, the invention adopts the technical scheme that:

the invention provides cytochrome P450 enzyme, wherein the amino acid sequence of the P450 enzyme is shown as SEQ ID NO. 1, and the cytochrome P450 enzyme belongs to CYP82G family.

The invention also provides the coding gene CsCYP2 of the cytochrome P450 enzyme, and the nucleotide sequence of the CsCYP2 is shown as SEQ ID NO. 2.

The invention also provides a recombinant expression vector which comprises the gene CsCYP 2.

The invention also provides a recombinant bacterium, which comprises the gene CsCYP 2.

Specifically, the CsCYP2 gene is inserted into a multiple cloning site of a yeast eukaryotic expression vector (pYES2) to obtain a recombinant expression vector, and then the obtained recombinant expression vector is transformed into a yeast INVSC1 to obtain a recombinant bacterium.

The invention also provides application of the cytochrome P450 enzyme or the gene CsCYP2 or a recombinant expression vector or a recombinant bacterium in the synthesis of TMTT and/or DMNT.

The invention also provides application of the cytochrome P450 enzyme or the gene CsCYP2 or the recombinant expression vector or the recombinant bacterium in prevention and control of citrus pests.

The invention clones a gene CsCYP2 for coding cytochrome P450 enzyme in citrus, and identifies the function of catalyzing substrates geranyl linalool and nerolidol to synthesize TMTT and DMNT through heterologous expression in eukaryote Saccharomyces cerevisiae (Saccharomyces cerevisiae). The result shows that cytochrome P450 enzyme CsCYP2 heterologously expressed in the yeast can catalyze the synthesis of TMTT and DMNT by using geranyl linalool and nerolidol as substrates respectively. The cytochrome P450 enzyme CsCYP2 is prompted to catalyze the substrate to synthesize TMTT and DMNT, and the characteristic that the TMTT and DMNT can avoid pests or attract natural enemies of phytophagous pests is utilized, so that the purpose of preventing and controlling the pests is achieved.

Preferably, the gene CsCYP2 is overexpressed in a citrus plant through a transgenic technology, TMTT and/or DMNT is catalytically synthesized, and the purpose of preventing and controlling pests is achieved by utilizing the characteristic that TMTT and/or DMNT can avoid pests or attract natural enemies of phytophagous pests.

Preferably, the cytochrome P450 enzyme is expressed in vitro and catalyzes the synthesis of TMTT and DMNT, and then TMTT and/or DMNT are sprayed on citrus plants, so that the purpose of preventing and controlling pests is achieved by utilizing the characteristic that TMTT and/or DMNT can avoid pests or attract natural enemies of phytophagous pests.

The invention also provides a method for in vitro synthesis of TMTT and/or DMNT, which comprises the following steps: the cytochrome P450 enzyme is expressed in vitro by a yeast eukaryotic expression system, and then the synthesis of TMTT and/or DMNT is catalyzed by taking geranyl linalool and/or nerolidol as a substrate.

Compared with the prior art, the invention has the beneficial effects that:

the cytochrome P450 enzyme CsCYP2 gene is cloned in citrus for the first time, the cytochrome P450 enzyme can catalyze the synthesis of TMTT and DMNT by utilizing geranyl linalool and nerolidol substrates respectively, and because the two substances of TMTT and DMNT can be induced and generated after a plant is invaded by phytophagous insects, the cytochrome P450 enzyme CsCYP2 can catalyze the substrates to synthesize TMTT and DMNT, has the functions of repelling pests and inducing the defense reaction of adjacent plants, and can attract the natural enemies of corresponding pests to control the pests.

Drawings

FIG. 1 shows the GC-MS detection results of synthesizing TMTT from geranyl linalool catalyzed by cytochrome P450 enzyme CsCYP2 heterologously expressed in yeast (a is yeast for transforming pYES2-CsCYP 2; b is yeast for transforming empty vector pYES2 as negative control; c is TMTT standard as positive control);

FIG. 2 shows the GC-MS detection results of synthesizing DMNT from nerolidol catalyzed by cytochrome P450 enzyme CsCYP2 heterologously expressed in yeast (a is yeast for transforming pYES2-CsCYP2, b is yeast for transforming empty vector pYES2 as negative control, and c is DMNT standard product as positive control).

Detailed Description

The following further describes the embodiments of the present invention. It should be noted that the description of the embodiments is provided to help understanding of the present invention, but the present invention is not limited thereto. In addition, the technical features involved in the embodiments of the present invention described below may be combined with each other as long as they do not conflict with each other.

The experimental procedures in the following examples were carried out by conventional methods unless otherwise specified, and the test materials used in the following examples were commercially available by conventional methods unless otherwise specified.

Example 1 obtaining of Citrus cytochrome P450 enzyme and its encoding Gene CsCYP2

Extracting RNA of Citrus sweet orange (Citrus sinensis (L.) Osbeck) leaves by using an RNA extraction Kit (Biotake), carrying out reverse transcription by using a reverse transcription Kit PrimeScript RTReagent Kit (TaKaRa) by using the RNA as a template to obtain cDNA, and carrying out PCR amplification on CsCYP2-F and CsCYP2-R by using primers by using the cDNA as a template, wherein the reaction system is as follows: a50. mu.L system with high fidelity Taq enzyme 2 × Phanta Max Master Mix (Dye Plus) 25. mu.L, 2. mu.L each of CsCYP2-F and CsCYP2-R, 1. mu.L cDNA template, 20. mu.L water. The PCR reaction program is: pre-denaturation at 95 deg.C for 3min, denaturation at 95 deg.C for 15s, annealing at 50 deg.C for 15s, extension at 72 deg.C for 1min for 40s, and circulating for 35 times, and fully extending at 72 deg.C for 5 min. Finally, the full-length coding region sequence of the CsCYP2 gene is obtained by cloning the PCR product (the operation of gene cloning can be specifically found in molecular cloning experimental guidance compiled by J. SammBruke et al):

recovering a target fragment (a coding region sequence of a CsCYP2 gene) in a PCR product, connecting the recovered product with a pMD18-T vector (Takara) at 16 ℃ for 2h, then introducing the product into escherichia coli competent DH5 alpha (Sangon Biotech), screening and culturing on a solid LB culture medium (containing 50 mu g/mL ampicillin), picking out a monoclonal after overnight culture at 37 ℃, carrying out amplification culture on the picked monoclonal for 12h by using a liquid LB culture medium (containing 50 mu g/mL ampicillin) to extract a plasmid, carrying out PCR verification on CsCYP2-F and CsCYP2-R by using primers to verify positive clones to obtain a plasmid pMD18-T-CsCYP2, and sequencing the plasmid to obtain a full-length coding region sequence of the CYP2 gene. The coding region sequence of the CsCYP2 gene has the full length of 1563bp and codes 520 amino acid sequence proteins (namely P450 enzyme). Wherein the amino acid sequence of the CsCYP2 gene, the full-length nucleotide sequence of the coding region of the CsCYP2 gene, the CsCYP2-F and the CsCYP2-R are respectively as follows:

the amino acid sequence (SEQ ID NO:1) of the CsCYP2 gene is:

MDFISFKLPILELLALLILYFLWGIVAKSKNKSKKNTAPEPFGAWPLIGHLPLLIAEEPVCKILGAIADKYGPIYSLRLGKHPTLIVSSWEIVKDCFTTNDRVLATRPSIAAGKYLGYDNAVFALAPYGRYWRDIRKIATTDLLSSHRLELLKHVRYSEVDTFIKDLYSRCSENAFNPAKVVISKLIEQLTFNISLRLIAGKRFSAREFGEQGSEGWRINRAIKEATYLTGVFVLGDAIPWLEWIDFQGHIGSMRRTAKKIDDVIGNWLEEHAQRKLQGEGDFMDVLLSKIEDNTVMSGHTRDTVIKATALILIFTGSESTYLGIIWTLSLLLNHPKELKKAQEELDVHVGRDRWVNESDMKNLKYLRAIVKETLRIYPPGPVTGIREAMEDCEIGGYHVPKGTRLIVNVWKLHRDPRMWENPCEFRPERFLTTHADVDVNTQHFEYIPFSFGRRSCPGMTSGLQIVQLTLARILQGFDLATVGGIPVDMKEGLGIALPKLNPVEVVIKPRLSDDLYQRL；

the sequence of the coding region of the CsCYP2 gene (SEQ ID NO:2) is:

ATGGATTTTATTTCTTTCAAGCTACCAATTTTGGAGCTCTTAGCTTTGCTGATTCTTTATTTCTTATGGGGAATCGTAGCAAAATCCAAAAACAAAAGCAAGAAAAATACAGCCCCCGAACCATTTGGGGCATGGCCACTCATCGGCCATTTGCCTCTTCTGATTGCCGAAGAACCTGTTTGCAAAATACTCGGAGCCATTGCTGACAAATATGGCCCCATCTACTCCCTCAGGCTCGGCAAGCATCCAACGTTGATTGTGAGCAGTTGGGAAATTGTGAAGGATTGCTTCACTACCAATGACAGAGTTTTGGCCACAAGGCCAAGTATAGCAGCAGGCAAGTACTTGGGTTACGACAACGCCGTTTTTGCGCTTGCTCCCTACGGCCGGTACTGGCGTGATATTCGCAAAATAGCCACCACAGATCTGCTCTCCAGTCACCGGCTTGAATTGCTAAAGCACGTTCGCTACTCAGAAGTTGACACTTTCATCAAAGACTTGTACTCACGTTGCTCAGAAAACGCATTCAATCCTGCGAAGGTGGTGATCAGCAAGTTAATAGAACAACTGACTTTCAATATAAGCCTACGACTGATAGCCGGAAAGAGATTTTCAGCTAGAGAATTTGGTGAACAAGGCAGCGAGGGATGGCGTATCAATAGAGCCATAAAAGAAGCTACGTATCTGACAGGGGTTTTTGTTTTGGGAGATGCCATACCGTGGCTTGAATGGATTGATTTTCAGGGTCACATAGGCTCTATGCGGAGGACTGCAAAGAAAATTGACGACGTGATCGGCAACTGGCTTGAAGAACATGCCCAGAGAAAATTACAGGGTGAAGGTGACTTCATGGACGTGTTGCTATCGAAAATTGAAGACAATACTGTGATGAGTGGTCATACAAGGGATACTGTCATCAAGGCAACAGCTCTTATTCTAATATTTACAGGCTCAGAAAGCACATATCTCGGAATAATTTGGACACTGTCTTTGTTACTCAATCACCCGAAAGAGCTAAAGAAGGCACAGGAAGAGTTGGACGTCCATGTTGGAAGAGATAGATGGGTAAACGAGTCAGATATGAAGAACCTAAAATACCTTCGAGCCATTGTCAAAGAAACTCTGCGGATTTACCCACCGGGTCCTGTAACAGGAATTCGGGAAGCCATGGAAGATTGTGAAATTGGTGGCTATCATGTCCCGAAAGGCACGCGTTTGATCGTGAACGTATGGAAGCTGCACAGAGACCCTCGGATGTGGGAAAATCCGTGCGAGTTCAGACCAGAAAGGTTTCTGACAACTCATGCTGATGTTGATGTCAACACTCAACATTTTGAGTATATTCCGTTCAGCTTCGGAAGAAGATCGTGCCCTGGAATGACATCTGGCTTGCAGATTGTTCAATTAACGCTTGCTCGGATTCTTCAGGGGTTTGATTTGGCAACCGTGGGGGGTATACCCGTTGACATGAAGGAAGGCTTGGGCATTGCCTTGCCTAAACTGAACCCTGTTGAAGTTGTCATCAAACCGCGCCTTTCTGATGATCTTTATCAACGCCTCTGA；

the sequence of CsCYP2-F (SEQ ID NO:3) is:

ATGGATTTTATTTCTTTCAAGC；

the sequence of CsCYP2-R (SEQ ID NO:4) is:

TCAGAGGCGTTGATAAAG。

example 2 in vitro expression of cytochrome P450 enzyme CsCYP2 Yeast for catalyzing the Synthesis of TMTT and DMNT

1. Construction of expression vector of citrus cytochrome P450 enzyme CsCYP2 yeast

PCR was carried out using the plasmid pMD18-T-CsCYP2 sequenced correctly in example 1 as a template and the primer pairs pYES2-CsCYP2-F and pYES2-CsCYP2-R in the following reaction scheme: a50. mu.L system containing 25. mu.L of high fidelity Taq enzyme 2X Phanta Max Master Mix (Dye Plus), 2. mu.L each of pYES2-CsCYP2-F and pYES2-CsCYP2-R, 1. mu.L plasmid template, and 20. mu.L water. The PCR reaction program is: pre-denaturation at 95 deg.C for 3min, denaturation at 95 deg.C for 15s, annealing at 50 deg.C for 15s, extension at 72 deg.C for 1min for 40s, and circulating for 35 times, and fully extending at 72 deg.C for 5 min. Then, agarose electrophoresis was carried out to recover the PCR product using a DNA gel recovery kit (Tiangen), and to recover the restriction enzyme BamHI (Takar)a) The product of pYES2 vector (Invitrogen) was digested with the enzyme, and then the recombinant cloning kit was used

The two fractions were ligated together using the Ultra One Step Cloning Kit (Vazyme) according to the protocol described in the specification. The ligation products were transformed into E.coli competent DH 5. alpha. and screened on solid LB medium (containing 50. mu.g/mL ampicillin). After overnight culture at 37 ℃, single clones are picked up, the picked single clones are subjected to amplification culture for 12h by using a liquid LB culture medium (containing 50 mu g/mL ampicillin), plasmids are extracted by using a plasmid miniprep kit (Tiangen), and positive clones are verified by carrying out PCR on pYES2-CsCYP2-F and pYES2-CsCYP2-R by using primers to obtain a recombinant vector pYES2-CsCYP2 which is used for protein expression and has correct sequencing. Wherein the sequences of pYES2-CsCYP2-F and pYES2-CsCYP2-R are respectively shown as follows:

the sequence of pYES2-CsCYP2-F (SEQ ID NO:5) is:

CTTGGTACCGAGCTCGGATCCACAATGGATTTTATTTCTTTCAAGC；

the sequence of pYES2-CsCYP2-R (SEQ ID NO:6) is:

GCGGCCGTTACTAGTGGATCCTCAGAGGCGTTGATAAAG。

2. synthesis of TMTT and DMNT

(1) Enzymatic reaction:

plasmid pYES2-CsCYP2 was transformed into yeast competent INVSc1(Coolaber) with pYES2 empty as a control, and then plated on SD-Uracil solid medium and cultured in an incubator at 30 ℃ for 3 days. Then, single clones of yeast transformants of pYES2-CsCYP2 and pYES2 were picked up, cultured in 3mL of SD-Uracil liquid medium for 24-48h, and then expanded in 50mL of SD-Uracil liquid medium, and when cultured to OD₆₀₀When the concentration is 0.6, the cells are centrifuged at 3000rpm/min for 5min to remove the supernatant, the cells are resuspended in 50mL of sterile water, and the cells are centrifuged at 3000rpm/min for 5min to remove the supernatant. After repeated washing with sterile water for 3 times, the cells were resuspended in 50mL SC-Uracil broth (carbon source 30% galactose and raffinose), and then 20. mu.L of 1mM Nerolidol [ 3S) - (E) -Neolidol ] and 20. mu.L of 10mM geranyllinalool [ 3RS) - (E, E) -geranyllinalool ] were added to the cells inCulturing for 12h at 30 ℃ and 180rpm/min, inducing the CsCYP2 protein expression and catalyzing the substrate reaction. After 12h incubation, SPME cellulose heads (100. mu. mpolydimethylsiloxane fiber, Supelco) were inserted into the broth, and the product was collected by adsorption for 1h and then subjected to GC-MS assay.

(2) And (3) GC-MS determination:

inserting SPME cellulose head into the inlet connected to gas chromatography column (DB-5,60m × 0.25mm, film thickness 0.25 μm, J & W Scientific, Folsom, CA, USA) for non-split sampling for 5 min; the temperature gradient was first ramped from 50 deg.C (held for 5min) to 210 deg.C at a rate of 3 deg.C/min, then ramped from 210 deg.C to 230 deg.C at a rate of 10 deg.C/min, and finally ramped from 230 deg.C to 280 deg.C at a rate of 10 deg.C/min. The detector temperature was set at 250 ℃.

The GC-MS detection results are shown in figures 1 and 2, and the cytochrome P450 enzyme CsCYP2 heterologously expressed in the yeast can catalyze the synthesis of TMTT (figure 1) and DMNT (figure 2) by using geranyl linalool and nerolidol as substrates respectively.

Because the TMTT and the DMNT can be induced and generated after the plant is invaded by phytophagous insects, the TMTT and the DMNT have the functions of inducing the defense response of adjacent plants and avoiding pests, and can attract the corresponding natural enemies of the pests to achieve the effect of controlling the pests. Meanwhile, the compounds also have the functions of attracting pollinating insects, inducing defense response of adjacent plants, avoiding pests and the like. Therefore, the TMTT and the DMNT can be synthesized through an enzymatic reaction mode, and the damage of pests to the citrus can be avoided through spraying the TMTT and the DMNT to the citrus. The plant overexpression vector carrying the CsCYP2 gene can also be introduced into the calluses or epicotyls of citrus through a transgenic technology to create plants with high expression of two terpene homologues of TMTT and DMNT, so that a new idea and a new method are provided for green prevention and control of citrus pests.

The embodiments of the present invention have been described in detail, but the present invention is not limited to the described embodiments. It will be apparent to those skilled in the art that various changes, modifications, substitutions and alterations can be made in these embodiments without departing from the principles and spirit of the invention, and the scope of protection is still within the scope of the invention.

Sequence listing

<110> research institute of fruit trees of Guangdong province academy of agricultural sciences

<120> cytochrome P450 enzyme, and coding gene CsCYP2 and application thereof

<160> 6

<170> SIPOSequenceListing 1.0

<210> 1

<211> 520

<212> PRT

<213> P450 enzyme (Citrus sinensis (L.) Osbeck)

<400> 1

Met Asp Phe Ile Ser Phe Lys Leu Pro Ile Leu Glu Leu Leu Ala Leu

1 5 10 15

Leu Ile Leu Tyr Phe Leu Trp Gly Ile Val Ala Lys Ser Lys Asn Lys

20 25 30

Ser Lys Lys Asn Thr Ala Pro Glu Pro Phe Gly Ala Trp Pro Leu Ile

35 40 45

Gly His Leu Pro Leu Leu Ile Ala Glu Glu Pro Val Cys Lys Ile Leu

50 55 60

Gly Ala Ile Ala Asp Lys Tyr Gly Pro Ile Tyr Ser Leu Arg Leu Gly

65 70 75 80

Lys His Pro Thr Leu Ile Val Ser Ser Trp Glu Ile Val Lys Asp Cys

85 90 95

Phe Thr Thr Asn Asp Arg Val Leu Ala Thr Arg Pro Ser Ile Ala Ala

100 105 110

Gly Lys Tyr Leu Gly Tyr Asp Asn Ala Val Phe Ala Leu Ala Pro Tyr

115 120 125

Gly Arg Tyr Trp Arg Asp Ile Arg Lys Ile Ala Thr Thr Asp Leu Leu

130 135 140

Ser Ser His Arg Leu Glu Leu Leu Lys His Val Arg Tyr Ser Glu Val

145 150 155 160

Asp Thr Phe Ile Lys Asp Leu Tyr Ser Arg Cys Ser Glu Asn Ala Phe

165 170 175

Asn Pro Ala Lys Val Val Ile Ser Lys Leu Ile Glu Gln Leu Thr Phe

180 185 190

Asn Ile Ser Leu Arg Leu Ile Ala Gly Lys Arg Phe Ser Ala Arg Glu

195 200 205

Phe Gly Glu Gln Gly Ser Glu Gly Trp Arg Ile Asn Arg Ala Ile Lys

210 215 220

Glu Ala Thr Tyr Leu Thr Gly Val Phe Val Leu Gly Asp Ala Ile Pro

225 230 235 240

Trp Leu Glu Trp Ile Asp Phe Gln Gly His Ile Gly Ser Met Arg Arg

245 250 255

Thr Ala Lys Lys Ile Asp Asp Val Ile Gly Asn Trp Leu Glu Glu His

260 265 270

Ala Gln Arg Lys Leu Gln Gly Glu Gly Asp Phe Met Asp Val Leu Leu

275 280 285

Ser Lys Ile Glu Asp Asn Thr Val Met Ser Gly His Thr Arg Asp Thr

290 295 300

Val Ile Lys Ala Thr Ala Leu Ile Leu Ile Phe Thr Gly Ser Glu Ser

305 310 315 320

Thr Tyr Leu Gly Ile Ile Trp Thr Leu Ser Leu Leu Leu Asn His Pro

325 330 335

Lys Glu Leu Lys Lys Ala Gln Glu Glu Leu Asp Val His Val Gly Arg

340 345 350

Asp Arg Trp Val Asn Glu Ser Asp Met Lys Asn Leu Lys Tyr Leu Arg

355 360 365

Ala Ile Val Lys Glu Thr Leu Arg Ile Tyr Pro Pro Gly Pro Val Thr

370 375 380

Gly Ile Arg Glu Ala Met Glu Asp Cys Glu Ile Gly Gly Tyr His Val

385 390 395 400

Pro Lys Gly Thr Arg Leu Ile Val Asn Val Trp Lys Leu His Arg Asp

405 410 415

Pro Arg Met Trp Glu Asn Pro Cys Glu Phe Arg Pro Glu Arg Phe Leu

420 425 430

Thr Thr His Ala Asp Val Asp Val Asn Thr Gln His Phe Glu Tyr Ile

435 440 445

Pro Phe Ser Phe Gly Arg Arg Ser Cys Pro Gly Met Thr Ser Gly Leu

450 455 460

Gln Ile Val Gln Leu Thr Leu Ala Arg Ile Leu Gln Gly Phe Asp Leu

465 470 475 480

Ala Thr Val Gly Gly Ile Pro Val Asp Met Lys Glu Gly Leu Gly Ile

485 490 495

Ala Leu Pro Lys Leu Asn Pro Val Glu Val Val Ile Lys Pro Arg Leu

500 505 510

Ser Asp Asp Leu Tyr Gln Arg Leu

515 520

<210> 2

<211> 1563

<212> DNA/RNA

<213> CsCYP2 gene (Citrus sinensis (L.) -Osbeck)

<400> 2

atggatttta tttctttcaa gctaccaatt ttggagctct tagctttgct gattctttat 60

ttcttatggg gaatcgtagc aaaatccaaa aacaaaagca agaaaaatac agcccccgaa 120

ccatttgggg catggccact catcggccat ttgcctcttc tgattgccga agaacctgtt 180

tgcaaaatac tcggagccat tgctgacaaa tatggcccca tctactccct caggctcggc 240

aagcatccaa cgttgattgt gagcagttgg gaaattgtga aggattgctt cactaccaat 300

gacagagttt tggccacaag gccaagtata gcagcaggca agtacttggg ttacgacaac 360

gccgtttttg cgcttgctcc ctacggccgg tactggcgtg atattcgcaa aatagccacc 420

acagatctgc tctccagtca ccggcttgaa ttgctaaagc acgttcgcta ctcagaagtt 480

gacactttca tcaaagactt gtactcacgt tgctcagaaa acgcattcaa tcctgcgaag 540

gtggtgatca gcaagttaat agaacaactg actttcaata taagcctacg actgatagcc 600

ggaaagagat tttcagctag agaatttggt gaacaaggca gcgagggatg gcgtatcaat 660

agagccataa aagaagctac gtatctgaca ggggtttttg ttttgggaga tgccataccg 720

tggcttgaat ggattgattt tcagggtcac ataggctcta tgcggaggac tgcaaagaaa 780

attgacgacg tgatcggcaa ctggcttgaa gaacatgccc agagaaaatt acagggtgaa 840

ggtgacttca tggacgtgtt gctatcgaaa attgaagaca atactgtgat gagtggtcat 900

acaagggata ctgtcatcaa ggcaacagct cttattctaa tatttacagg ctcagaaagc 960

acatatctcg gaataatttg gacactgtct ttgttactca atcacccgaa agagctaaag 1020

aaggcacagg aagagttgga cgtccatgtt ggaagagata gatgggtaaa cgagtcagat 1080

atgaagaacc taaaatacct tcgagccatt gtcaaagaaa ctctgcggat ttacccaccg 1140

ggtcctgtaa caggaattcg ggaagccatg gaagattgtg aaattggtgg ctatcatgtc 1200

ccgaaaggca cgcgtttgat cgtgaacgta tggaagctgc acagagaccc tcggatgtgg 1260

gaaaatccgt gcgagttcag accagaaagg tttctgacaa ctcatgctga tgttgatgtc 1320

aacactcaac attttgagta tattccgttc agcttcggaa gaagatcgtg ccctggaatg 1380

acatctggct tgcagattgt tcaattaacg cttgctcgga ttcttcaggg gtttgatttg 1440

gcaaccgtgg ggggtatacc cgttgacatg aaggaaggct tgggcattgc cttgcctaaa 1500

ctgaaccctg ttgaagttgt catcaaaccg cgcctttctg atgatcttta tcaacgcctc 1560

tga 1563

<210> 3

<211> 22

<212> DNA/RNA

<213> CsCYP2-F(Artificial Sequence)

<400> 3

atggatttta tttctttcaa gc 22

<210> 4

<211> 18

<212> DNA/RNA

<213> CsCYP2-R(Artificial Sequence)

<400> 4

tcagaggcgt tgataaag 18

<210> 5

<211> 46

<212> DNA/RNA

<213> pYES2-CsCYP2-F(Artificial Sequence)

<400> 5

cttggtaccg agctcggatc cacaatggat tttatttctt tcaagc 46

<210> 6

<211> 39

<212> DNA/RNA

<213> pYES2-CsCYP2-R(Artificial Sequence)

<400> 6

gcggccgtta ctagtggatc ctcagaggcg ttgataaag 39

Claims

1. A cytochrome P450 enzyme, wherein the amino acid sequence of the P450 enzyme is represented by SEQ ID NO. 1, and the cytochrome P450 enzyme belongs to the CYP82G family.

2. The cytochrome P450 enzyme encoding gene CsCYP2 of claim 1, wherein the nucleotide sequence of said CsCYP2 is represented by SEQ ID NO. 2.

3. A recombinant expression vector comprising the gene CsCYP2 according to claim 2.

4. A recombinant bacterium comprising the gene CsCYP2 according to claim 2.

5. Use of the cytochrome P450 enzyme according to claim 1 or the gene CsCYP2 according to claim 2 for the synthesis of TMTT and/or DMNT.

6. Use of the cytochrome P450 enzyme according to claim 1 or the gene CsCYP2 according to claim 2 for controlling citrus pests.

7. The use of claim 6, wherein the gene CsCYP2 of claim 2 is overexpressed in citrus plants by transgenic technology, TMTT and/or DMNT are catalytically synthesized, and the characteristics of TMTT and/or DMNT for repelling pests or attracting natural enemies of phytophagous pests are utilized to achieve the purpose of pest control.

8. The use according to claim 6, wherein the cytochrome P450 enzyme of claim 1 is expressed in vitro and catalyzes the synthesis of TMTT and DMNT, and then the characteristic that TMTT and/or DMNT attract natural enemies of phytophagous pests is utilized to achieve pest control by spraying TMTT and/or DMNT to citrus plants.

9. A method for in vitro synthesis of TMTT and/or DMNT, wherein the cytochrome P450 enzyme of claim 1 is expressed in vitro by a yeast eukaryotic expression system, and the synthesis of TMTT and/or DMNT is catalyzed by geranyl linalool and/or nerolidol as a substrate.