CN113774029A - Cell model containing human APP and PSEN1 genes and construction method thereof - Google Patents
Cell model containing human APP and PSEN1 genes and construction method thereof Download PDFInfo
- Publication number
- CN113774029A CN113774029A CN202111098027.5A CN202111098027A CN113774029A CN 113774029 A CN113774029 A CN 113774029A CN 202111098027 A CN202111098027 A CN 202111098027A CN 113774029 A CN113774029 A CN 113774029A
- Authority
- CN
- China
- Prior art keywords
- cells
- cell
- app
- psen1
- human app
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4711—Alzheimer's disease; Amyloid plaque core protein
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
- G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2510/00—Genetically modified cells
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15021—Viruses as such, e.g. new isolates, mutants or their genomic sequences
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2740/00—Reverse transcribing RNA viruses
- C12N2740/00011—Details
- C12N2740/10011—Retroviridae
- C12N2740/15011—Lentivirus, not HIV, e.g. FIV, SIV
- C12N2740/15041—Use of virus, viral particle or viral elements as a vector
- C12N2740/15043—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2500/00—Screening for compounds of potential therapeutic value
- G01N2500/10—Screening for compounds of potential therapeutic value involving cells
Abstract
The invention provides a cell model containing humanized APP and PSEN1 genes and a construction method thereof, wherein lentivirus transfected cells are selected, humanized APP and PS1 are introduced into CHO cells to obtain a cell line with stable passage, and the lentivirus carries a green fluorescent protein gene, so that the cells can emit green fluorescent signals under a fluorescent microscope, the identifiability of the cells is increased, and the stability of exogenous genes of the cells is judged. In addition, cells carrying human APP and PS1 genes can stably secrete A beta 1-42 and A beta 1-40. Simulating the pathogenesis of AD cells to form a cell screening model, and being used for high-throughput screening of drugs capable of inhibiting the secretion of A beta 1-42 and A beta 1-40.
Description
Technical Field
The invention belongs to the technical field of drug screening models, and relates to a cell model containing humanized APP and PSEN1 genes and a construction method thereof.
Background
Alzheimer's Disease (AD) is an age-related degenerative disease of the central nervous system and is the most common cause of senile dementia. The pathogenesis of AD is quite complex and as yet unclear. At present, there are several hypotheses: the gene mutation hypothesis, the amyloid-beta deposition hypothesis, the synaptic dysfunction hypothesis, the Tau protein hyperphosphorylation hypothesis, the excitotoxic amino acid and immunoinflammation hypothesis, and the like, dominate the amyloid-beta cascade hypothesis. The increase in soluble β -amylase (a β) and excessive deposition of a β are major causative factors of AD. The hypothesis is that amyloid beta precursor protein (APP) is cleaved into a β by β secretase and γ secretase and released to the outside of cells, and the β is accumulated outside the cells, aged to form senile plaques and trigger a series of AD pathological symptoms, which in turn aggravate β amyloid production and deposition, thereby generating a cascade effect, resulting in neurofibrillary tangles and neuronal loss.
In the development of AD drugs, APP/PSEN1 transgenic mice are usually selected for pharmacodynamic analysis and mechanism research, but the transgenic mice are relatively expensive and are not suitable for large-scale screening work.
Disclosure of Invention
In view of the above technical problems, the present invention aims to provide a cell model containing human APP and PSEN1 genes and a method for constructing the same.
In order to achieve the purpose, the invention adopts the technical scheme that:
the invention provides a cell model containing human APP and PSEN1 genes, which is a cell line CHO-APP/PS1 constructed by introducing human APP and PSEN1 gene sequences by transfecting CHO cells with lentiviruses.
Preferably, the lentivirus is Lenti-APP/PS 1-GFP.
More preferably, the packaging system for the lentivirus is a three-plasmid system consisting of: pCMV-dR8, pmd2.g, pGPD; the packaging cells for lentivirus used 293T.
The invention also provides a construction method of a cell model containing the human APP and PSEN1 genes, which comprises the following steps:
1) constructing a lentivirus with an over-expressed human APP (WT)/PSEN1(PS1, WT) double-gene full-length sequence;
2) the composition is as follows: taking a three-plasmid system of pCMV-dR8, pMD2.G and pGPD as a lentivirus packaging system, adopting 293T as a packaging cell of the lentivirus, transfecting for 48h, collecting virus supernatant, filtering and concentrating;
3) inoculating the target cells to a 12-hole plate, and culturing overnight;
4) discarding the culture medium and adding 0.5mL polybrene culture medium mixture, adding 0.5mL corresponding virus into each well, and replacing the virus with the culture medium for the control cell wells; continuously culturing, collecting waste virus liquid after the lentivirus is infected for 16h, and continuously culturing by replacing 1mL of fresh culture medium;
5) observing the expression efficiency of GFP (green fluorescent protein) by a fluorescence microscope after the lentivirus is infected for 48 hours, replacing a fresh culture medium containing puromycin, screening a stably transformed cell strain, and replacing the fresh culture medium containing puromycin once every 2-3 days according to the cell state until control cells without virus infection are completely killed by the puromycin, thereby obtaining the stably transformed cell strain; finally, the cells are subjected to a round of monoclonal screening to obtain the target cell line CHO-APP/PS 1.
Preferably, step 1) comprises: primers were designed and synthesized based on the full-length sequence of the human APP (WT)/PS1(WT) double gene and the lentiviral vector sequence, and the synthetic primer sequences were as follows:
APP-F：CCTCCATAGAAGATTCTAGAATGCTGCCCGGTTTGGCACT，
APP-R：GATCGCAGATCCTTCTCGAGCTAGTTCTGCATCTGCTCAA；
PS1-F：CCTCCATAGAAGATTCTAGAATGACAGAGTTACCTGCACC，
PS1-R：GATCGCAGATCCTTCTCGAGCTAGATATAAAATTGATGGA。
preferably, 293T cells are seeded at 50% cell density the day before transfection in step 2).
Preferably, in step 2), the virus is concentrated by filtration through a 0.22 μm filter and using a millipore protein concentration column.
Preferably, in the step 4), the optimal final concentration of polybrene in the polybrene culture medium mixture is 10 μ g/mL.
Preferably, in step 5), the concentration of puromycin in the fresh medium containing puromycin is 10. mu.g/mL.
The invention also provides application of the cell model containing the human APP and PSEN1 genes in screening drugs capable of inhibiting secretion of A beta 1-42 and A beta 1-40.
According to the invention, lentivirus transfected cells are selected, human APP and PS1 are introduced into CHO cells, a cell line with stable passage can be obtained, and the lentivirus carries a green fluorescent protein gene, so that the cells can emit a green fluorescent signal under a fluorescent microscope, the identifiability of the cells is increased, and the stability of the exogenous gene of the cells is judged. In addition, cells carrying human APP and PS1 genes can stably secrete A beta 1-42 and A beta 1-40. Simulating the pathogenesis of AD cells to form a cell screening model, and being used for high-throughput screening of drugs capable of inhibiting the secretion of A beta 1-42 and A beta 1-40.
The invention has the beneficial effects that:
1. when a lentivirus transfection system is used for introducing the human gene into the CHO cell, the transfection efficiency is better, and the gene insertion copy number is relatively high. The exogenous gene is stable. Compared with the introduction of plasmids, the advantages of the method in the aspects are obvious.
2. After monoclonal screening, the stably expressed cell line can be continuously passed. Compared with cells screened by pure resistance, the method has the advantages of good uniformity and single genome background.
3. The cells carry fluorescent signals, and the stability of the exogenous genes can be judged according to the intensity of the fluorescent signals.
4. The cell line has been tested by the production of drug screening projects, and is used for cell efficacy experiments with stable results.
Drawings
FIG. 1 shows the results of the detection of the cell line CHO-APP/PS1 under a fluorescence microscope.
FIG. 2 shows the detection of the transcription level of the exogenous gene APP by fluorescent quantitative PCR.
FIG. 3 shows that the fluorescent quantitative PCR detects the transcription level of the foreign gene PSEN 1.
FIG. 4 shows ELSIA measurement of the amount of A.beta.1-42 secreted from cells.
FIG. 5 shows ELSIA measurement of the amount of A.beta.1-40 secreted from cells.
Detailed Description
In order to more clearly illustrate the present invention, the present invention will be described in further detail below with reference to examples and the accompanying drawings. It is to be understood by persons skilled in the art that the following detailed description is illustrative and not restrictive, and is not to be taken as limiting the scope of the invention.
Examples
First, main material
Chinese hamster ovary cell line (CHO): shanghai Rich and Henry Biotech Co., Ltd., China; 293T: shanghai Rich and Henry Biotech Co., Ltd., China; serum-free cell cryopreservation solution: shanghai Rich and Henry Biotech Co., Ltd., China; 1640 culture medium, PBS, pancreatin, fetal calf serum, Gibico USA; penicillin streptomycin: gibco, usa; cell culture consumables: corning, usa; DEPC water, TE buffer: shanghai Biotechnology engineering, Inc., China; anhydrous ethanol: bio-engineering (shanghai) incorporated, china; isopropyl alcohol: bio-engineering (shanghai) incorporated, china; plasmid macrodrawing kit: MN, Germany; agar powder for bacterial culture (agar): amresco corporation, usa; tryptone for bacterial culture: OXOID Inc., UK; yeast extract for bacterial culture: OXOID Inc., UK; trans5 α competent cells: beijing Quanji Biotech, Inc., China; DNA extraction kit: axygen, usa; KOD Plus: TOYOBO, japan; primer synthesis and sequencing: jinweizhi, China; DNA gel recovery kit: axygen, usa; and (3) recombinase: nuozan, china; 0.22um filter: millipore, usa; puromycin: solibao, china.
Second, main instrument
The biological safety cabinet: hai, china; a cell culture box: thermo corporation, usa; medical refrigeration and freezing box: midicine Mitsubishi Low temperature science and technology, Inc., China; desk-top low temperature high speed centrifuge, refrigerated centrifuge: heraeus, germany; an ice maker: xiamen national instruments scientific instruments ltd, china; a magnetic stirrer: shanghai balance instrument factory; electronic balance, electronic shaking table: sartorius, germany; a micropipette: thermo corporation, usa; constant temperature bacteria incubator: shanghai laboratory instruments Ltd, China; VX 200-vortex mixer: labnet corporation, USA; high-pressure sterilizing pot, water bath: hirayama corporation, japan; -80 ℃ vertical ultra low temperature refrigerator: ESCO corporation, singapore; run glue system and gel imaging system: Bio-Rad, Canada; inverted phase contrast microscopy: olympus corporation, japan; a water purifier: millpore corporation, usa; low-temperature ultracentrifuge: eppendorf Centrifuge, germany; NanoDrop 2000 micro-UV spectrophotometer: thermo, usa; a PCR instrument: Bio-Rad, Canada.
Third, preparation method
1. Cell culture
Chinese Hamster Ovary (CHO) cell line cultured in 1640 medium (10% fetal bovine serum, 1% double antibody) under 5% CO295% humidity and constant temperature of 37 ℃; 293T cells were cultured in DMEM high-glucose medium (10% fetal bovine serum, 1% double antibody) under 5% CO295% humidity and 37 ℃.
2. Cell passage
1) When Chinese hamster ovary cell lines (CHO) grow to about 80% density, passages can be performed when the CHO is in logarithmic growth phase. PBS was washed 1 time to remove residual serum, 1mL of 0.25% EDTA-trypsin was added to allow the pancreatin to spread evenly over the bottom of the dish, and the dish was placed in an incubator for digestion. Taking out the culture dish after 1-2min, placing under a microscope for observation, and adding equal volume of complete culture solution to terminate pancreatin digestion after the adherent cells retract, become round and bright. Adherent cells are carefully blown to form a cell suspension, transferred into a 15mL sterile centrifuge tube, centrifuged at 800rpm for 5min, the supernatant is removed, and the cell pellet is resuspended in a corresponding volume of complete medium according to the size of the culture dish. Subculturing approximate 1/4-1/5 cells, gently shaking culture dish by cross method to disperse cells uniformly, placing at 37 deg.C and 5% CO2The incubator continues to culture.
2) When the 293T cell density is about 80%, the passage can be carried out when the cell is in a logarithmic growth phase. PBS was washed 1 time to remove residual serum, 1mL of 0.25% EDTA-trypsin was added to allow the pancreatin to spread evenly over the bottom of the dish, and the dish was placed in an incubator for digestion. Taking out the culture dish after 1-2min, observing under microscope, and observingAfter the parietal cells retract, become round and bright, an equal volume of complete culture solution is added to stop the pancreatin digestion. Adherent cells are carefully blown to form a cell suspension, transferred into a 15mL sterile centrifuge tube, centrifuged at 800rpm for 5min, the supernatant is removed, and the cell pellet is resuspended in a corresponding volume of complete medium according to the size of the culture dish. Subculturing approximate 1/4-1/5 cells, gently shaking culture dish by cross method to disperse cells uniformly, placing at 37 deg.C and 5% CO2The incubator continues to culture.
3. Construction of a human APP (WT)/PSEN1(PS1, WT) double-gene full-length sequence over-expressed lentivirus
Primers were designed and synthesized based on the full-length sequence of the human APP (WT)/PS1(WT) double gene and the lentiviral vector sequence, and the synthetic primer sequences were as follows:
APP-F:CCTCCATAGAAGATTCTAGAATGCTGCCCGGTTTGGCACT
APP-R:GATCGCAGATCCTTCTCGAGCTAGTTCTGCATCTGCTCAA
PS1-F:CCTCCATAGAAGATTCTAGAATGACAGAGTTACCTGCACC
PS1-R:GATCGCAGATCCTTCTCGAGCTAGATATAAAATTGATGGA
placing the synthesized powder in a centrifuge for 5min at 12000rpm to make the powder in the tube gather at the bottom of the centrifuge tube, adding ddH2O dissolved in 100. mu.M.
4. Lentiviral packaging
The lentivirus packaging system is a three-plasmid system and comprises the following components: pCMV-dR8, pMD2.G, pGPD. We used 293T as packaging cells for lentivirus, and seeded 293T cells at 50% cell density the day before transfection. Transfection procedure according to Hieff TransTMLiposomal transformation Reagent (Shanghai assist, Sheng Biotech Co., Ltd.) description. Taking a 6cm dish as an example, the plasmid components to be transfected are as follows:
pCMV-dR8 2.5μg
pMD2.G 2.5μg
pGPD 1.25μg
after 48h of transfection, the virus supernatant was collected, filtered through a 0.22 μm filter, and concentrated using millipore protein concentration column for virus concentration, which could be used for target cell infection later.
5. Lentiviral infection of target cells CHO:
1) preparing target cells: the target cells in good state are inoculated in a 12-well plate, the density of the inoculated cells is different according to the growth speed of the cells, the cell confluence rate is generally ensured to be between 20 and 40 percent when the slow virus infection is carried out on the next day, and the cells are cultured overnight (one more hole is needed to be arranged as a control cell hole without virus).
2) Lentivirus infection of cells of interest: preparing a complete culture medium and polybrene mixture, wherein the concentration of polybrene is the optimum final concentration obtained by searching and is 10 mu g/mL; the medium was discarded and 0.5mL polybrene medium mixture was added, 0.5mL of the corresponding virus per well (control cell wells with medium instead of virus); and (4) continuing culturing, collecting waste virus liquid after the lentivirus is infected for 16h, and replacing 1mL of fresh culture medium for continuing culturing.
6. Culture and screening of stable transgenic cell strain
After the lentivirus infection for 48 hours, the expression efficiency of GFP can be observed by a fluorescence microscope, and the stable transfected cell line is selected by replacing the fresh medium containing the appropriate puromycin concentration (10. mu.g/mL). And then replacing the fresh culture medium containing puromycin every 2-3 days according to the cell state until the control cells without virus infection are completely killed by the puromycin, thus obtaining the stable cell strain. Finally, the cells are subjected to a round of monoclonal screening, and finally the target cell line CHO-APP/PS1 is obtained.
7. Model validation
1) As shown in FIG. 1, under a fluorescence microscope, the cells were detected to emit green fluorescence signals upon excitation.
2) The transcription level of the exogenous gene was detected by fluorescent quantitative PCR, as shown in FIGS. 2 and 3, indicating that both were highly transcribed.
3) ELSIA measures the secretion amounts of A.beta.1-42 and A.beta.1-40 in cells, and as a result, as shown in FIGS. 4 and 5, it was determined that the cells stably secrete A.beta.1-42 and A.beta.1-40.
According to the invention, human APP (Ensembllatabase: HGNC: 620) and PS1 (Ensembllatabase: HGNC: 9508) gene sequences are introduced by transfecting CHO cells with lentivirus (Lenti-APP/PS1-GFP), and a cell line CHO-APP/PS1 capable of stably expressing the two genes is successfully constructed. The viral vector carries the GFP gene itself, so that a green fluorescent signal can be detected under a fluorescent microscope as long as the virus successfully transfects the cells. The ELISA kit is used for detecting the cell culture supernatant, and the cells can be detected to stably secrete Abeta 1-42 and Abeta 1-40. Therefore, the modified cell can be used as a model for screening and inhibiting the secretion of the A beta 1-42 and the A beta 1-40.
8. Applications of
The fluorescent cell drug screen model co-expressing the human APP and PSEN1 genes can be applied to early cell level screening of AD treatment drugs.
If a drug research and development company prepares a certain drug, different groups can be designed, and finally whether the drug can effectively reduce the amount of the cells secreting the A beta 1-42 and the A beta 1-40 can be detected.
The group design is as follows:
1. normal control group (without drug addition)
2. Positive drug group (adding positive drug)
3. Solvent group (only adding medicine solvent)
4. Drug 1 low dose group to be tested
5. Medium-dose group of test drugs 1
6. High dose group of test drug 1
7. Drug 2 Low dose group to be tested
8. Test drug 2 medium dose group
9. Test drug 2 high dose group
The cell model constructed by the invention can be used for efficiently screening the drugs capable of effectively inhibiting cells from secreting A beta 1-42 and A beta 1-40, thereby providing reliable screening data for further researching and developing drugs for treating AD in the later period.
It should be understood that the above-mentioned embodiments of the present invention are only examples for clearly illustrating the present invention, and are not intended to limit the embodiments of the present invention, and it will be obvious to those skilled in the art that other variations or modifications may be made on the basis of the above description, and all the embodiments of the present invention are not exhaustive, and all the obvious variations or modifications which are introduced in the technical scheme of the present invention are within the scope of the present invention.
Claims (10)
1. The cell model containing human APP and PSEN1 genes is a cell line CHO-APP/PS1 constructed by transfecting CHO cells with lentiviruses and introducing human APP and PSEN1 gene sequences.
2. The cell model containing human APP and PSEN1 genes according to claim 1, wherein the lentivirus is Lenti-APP/PS 1-GFP.
3. The cell model containing human APP and PSEN1 genes according to claim 1, wherein the packaging system for lentiviruses is a three-plasmid system consisting of: pCMV-dR8, pmd2.g, pGPD; the packaging cells for lentivirus used 293T.
4. The construction method of the cell model containing the human APP and PSEN1 genes comprises the following steps:
1) constructing a lentivirus with an over-expressed human APP (WT)/PSEN1(PS1, WT) double-gene full-length sequence;
2) the composition is as follows: taking a three-plasmid system of pCMV-dR8, pMD2.G and pGPD as a lentivirus packaging system, adopting 293T as a packaging cell of the lentivirus, transfecting for 48h, collecting virus supernatant, filtering and concentrating;
3) inoculating the target cells to a 12-hole plate, and culturing overnight;
4) discarding the culture medium and adding 0.5mL polybrene culture medium mixture, adding 0.5mL corresponding virus into each well, and replacing the virus with the culture medium for the control cell wells; continuously culturing, collecting waste virus liquid after the lentivirus is infected for 16h, and continuously culturing by replacing 1mL of fresh culture medium;
5) observing the expression efficiency of GFP (green fluorescent protein) by a fluorescence microscope after the lentivirus is infected for 48 hours, replacing a fresh culture medium containing puromycin, screening a stably transformed cell strain, and replacing the fresh culture medium containing puromycin once every 2-3 days according to the cell state until control cells without virus infection are completely killed by the puromycin, thereby obtaining the stably transformed cell strain; finally, the cells are subjected to a round of monoclonal screening to obtain the target cell line CHO-APP/PS 1.
5. The method for constructing the cell model containing the human APP and PSEN1 genes, as claimed in claim 4, wherein step 1) comprises: primers were designed and synthesized based on the full-length sequence of the human APP (WT)/PS1(WT) double gene and the lentiviral vector sequence, and the synthetic primer sequences were as follows:
APP-F:CCTCCATAGAAGATTCTAGAATGCTGCCCGGTTTGGCACT，
APP-R:GATCGCAGATCCTTCTCGAGCTAGTTCTGCATCTGCTCAA；
PS1-F:CCTCCATAGAAGATTCTAGAATGACAGAGTTACCTGCACC，
PS1-R:GATCGCAGATCCTTCTCGAGCTAGATATAAAATTGATGGA。
6. the method for constructing a cell model containing human APP and PSEN1 genes as claimed in claim 4, wherein 293T cells are seeded at a cell density of 50% the day before transfection in step 2).
7. The method for constructing a cell model containing human APP and PSEN1 genes according to claim 4 or 6, wherein in step 2), the cell model is filtered through a 0.22 μm filter and virus concentration is performed by using a millipore protein concentration column.
8. The method for constructing the cell model containing the human APP and PSEN1 genes, according to claim 4, wherein in step 4), the optimal final concentration of polybrene in the polybrene culture medium mixture is 10 μ g/mL.
9. The method for constructing a cell model containing human APP and PSEN1 genes, as claimed in claim 4 or 8, wherein the concentration of puromycin in the fresh culture medium containing puromycin in step 5) is 10 μ g/mL.
10. Use of the cell model of any one of claims 1-3 containing human APP and PSEN1 genes for screening drugs that inhibit secretion of a β 1-42 and a β 1-40.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111098027.5A CN113774029A (en) | 2021-09-18 | 2021-09-18 | Cell model containing human APP and PSEN1 genes and construction method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111098027.5A CN113774029A (en) | 2021-09-18 | 2021-09-18 | Cell model containing human APP and PSEN1 genes and construction method thereof |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113774029A true CN113774029A (en) | 2021-12-10 |
Family
ID=78852186
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111098027.5A Pending CN113774029A (en) | 2021-09-18 | 2021-09-18 | Cell model containing human APP and PSEN1 genes and construction method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113774029A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009059239A2 (en) * | 2007-11-02 | 2009-05-07 | Mayo Foundation For Medical Education And Research | REDUCING Aβ42 LEVELS AND Aβ AGGREGATION |
| CN108728492A (en) * | 2017-04-19 | 2018-11-02 | 辽宁琦润生物科技有限公司 | A kind of preparation method of gene mutation and fusion positive reference product |
| CN109776665A (en) * | 2019-02-02 | 2019-05-21 | 首都医科大学宣武医院 | Alzheimer disease new mutation, its surely turn cell model and medical usage |
-
2021
- 2021-09-18 CN CN202111098027.5A patent/CN113774029A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009059239A2 (en) * | 2007-11-02 | 2009-05-07 | Mayo Foundation For Medical Education And Research | REDUCING Aβ42 LEVELS AND Aβ AGGREGATION |
| CN108728492A (en) * | 2017-04-19 | 2018-11-02 | 辽宁琦润生物科技有限公司 | A kind of preparation method of gene mutation and fusion positive reference product |
| CN109776665A (en) * | 2019-02-02 | 2019-05-21 | 首都医科大学宣武医院 | Alzheimer disease new mutation, its surely turn cell model and medical usage |
Non-Patent Citations (2)
| Title |
|---|
| JEAN-NOËL OCTAVE等: "The Role of Presenilin-1 in the γ-Secretase Cleavage of the Amyloid Precursor Protein of Alzheimer\'s Disease", JBC, vol. 275, no. 3, pages 1526 * |
| 黄龙舰;赵春阳;冯新红;兰嘉琦;唐婧姝;王庆利;彭英;: "抗阿尔茨海默病药物非临床药效学评价体系的探索", 药学学报, no. 05, pages 789 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR20200057051A (en) | Methods, compositions and implantable elements comprising active cells | |
| WO2021135073A1 (en) | Yap1 gene-modified mesenchymal stem cell and preparation method thereof | |
| WO2023246003A1 (en) | Chimeric antigen receptor macrophage, method for preparing same, and use thereof | |
| CN108607101A (en) | Application of the ZIP1 genes in preparing the product for inhibiting apoptosis of mesenchymal stem cell | |
| CN111662907B (en) | Method for knocking out induced pluripotent stem cell NANS gene and application thereof | |
| CN113774029A (en) | Cell model containing human APP and PSEN1 genes and construction method thereof | |
| CN115607689A (en) | Application of KLF7 gene in preparation of drug for reversing cell senescence | |
| EP2484756B1 (en) | Novel pacemaker cell | |
| CN113502269B (en) | Method for inhibiting bovine skeletal muscle satellite cell proliferation and myogenic differentiation by interfering UBA2 expression | |
| CN114032237A (en) | Circular non-coding RNA circSTK39 and application thereof in preventing and treating atherosclerosis | |
| CN109266683B (en) | Lentiviral recombinant vector containing E4BP4 gene and preparation method and application thereof | |
| CN112961841A (en) | Packaging method for rapidly obtaining high-titer lentiviruses | |
| Takahashi et al. | Gene transfer into cultured mammalian embryos by electroporation | |
| RU2776930C1 (en) | Method for extracting isolated cells from the jaw | |
| CN112980887A (en) | Method for constructing Alzheimer's disease cell model and application thereof | |
| CN114134118B (en) | Immortalized human laryngeal ring posterior region cell and construction method thereof | |
| KR20190010490A (en) | Method for large production of extracellular vesicles with bioreactor-perfusion system and system therefore | |
| CN109852637B (en) | Method for improving transfection efficiency of adeno-associated virus | |
| CN114262688B (en) | Method for preparing inhibitory interneurons retaining age characteristics from non-neural cell transformation | |
| CN113943711B (en) | Method for preparing mesospinous process neuron by transforming non-neuron cell and application | |
| WO2024078124A1 (en) | Use of tdgf1 gene in preparation of drugs for treating aging-related diseases or reversing cell aging | |
| CN114540415A (en) | Bmal1 gene mutation cell strain and construction method and application thereof | |
| WO2023158755A1 (en) | A method of cell electroporation | |
| CN113462650A (en) | Alzheimer's disease cell model and construction method thereof | |
| CN115404238A (en) | Design and preparation method of BDNF mRNA with high translational stability |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |