CN113755640B - RT-CPA detection primer and kit for porcine epidemic diarrhea virus - Google Patents

RT-CPA detection primer and kit for porcine epidemic diarrhea virus Download PDF

Info

Publication number
CN113755640B
CN113755640B CN202110805347.3A CN202110805347A CN113755640B CN 113755640 B CN113755640 B CN 113755640B CN 202110805347 A CN202110805347 A CN 202110805347A CN 113755640 B CN113755640 B CN 113755640B
Authority
CN
China
Prior art keywords
detection
diarrhea virus
cpa
epidemic diarrhea
porcine epidemic
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110805347.3A
Other languages
Chinese (zh)
Other versions
CN113755640A (en
Inventor
陈伯祥
成伟伟
赵子惠
李元新
杨明
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Gansu Institute Of Animal Husbandry Veterinary Medicine
Original Assignee
Gansu Institute Of Animal Husbandry Veterinary Medicine
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Gansu Institute Of Animal Husbandry Veterinary Medicine filed Critical Gansu Institute Of Animal Husbandry Veterinary Medicine
Priority to CN202110805347.3A priority Critical patent/CN113755640B/en
Publication of CN113755640A publication Critical patent/CN113755640A/en
Application granted granted Critical
Publication of CN113755640B publication Critical patent/CN113755640B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
    • C12Q1/701—Specific hybridization probes
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6844—Nucleic acid amplification reactions
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Immunology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Virology (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

The invention provides an RT-CPA detection primer and a kit for porcine epidemic diarrhea virus, belonging to the technical field of porcine epidemic diarrhea virus detection reagents. The detection primer comprises N-CPF, N-CPR, N-F, N-R, N-DF and N-DR, and the kit comprises the detection primer, a Reaction Buffer, bst DNA/RNA polymerase, dNTPs, betaine, mgSO4 and a nucleic acid detection test strip. The RT-CPA detection primer of the porcine epidemic diarrhea virus provided by the invention is designed aiming at the conserved sequence of the N gene of PEDV, has stronger specificity, and can effectively detect the porcine epidemic diarrhea virus; the kit, which is preferably Bst DNA/RNA polymerase, can be directly suitable for RNA to carry out isothermal amplification reaction, simplifies the detection process and shortens the detection time to be within one hour; the method is simple to operate, is not dependent on professional-resistant detection personnel, has low requirements on instruments, is easy to judge detection results, has higher sensitivity, can detect 10 copies/mu L of PEDV, and is very suitable for rapid detection of PEDV in various levels of prevention and control units and various types of farms.

Description

RT-CPA detection primer and kit for porcine epidemic diarrhea virus
Technical Field
The invention relates to the technical field of porcine epidemic diarrhea virus detection reagents, in particular to an RT-CPA detection primer and a kit for detecting porcine epidemic diarrhea virus.
Background
Porcine epidemic diarrhea virus (Procne epidemic diaherra virus, PEDV) is a single-stranded positive strand RNA virus of the genus alphacoronaviridae, capable of causing acute, highly contagious intestinal diseases in pigs with watery diarrhea, vomiting and dehydration as the main symptoms. Pigs of all ages are susceptible, and the death rate of infected nursing piglets is as high as 80-100%. The disease is prevalent worldwide, particularly in japan, korea and china. The disease can cause the sick piglets to die in a large scale, the sick fattening pigs gradually get lean, and even if recovered, the sick fattening pigs grow slowly and even become stiff pigs. Meanwhile, the sick pigs are possibly infected secondarily, so that the breeding risk is increased, and the live pig slaughtering rate is greatly reduced. The disease seriously jeopardizes the pig industry, causing serious economic losses.
The primary task of controlling PEDV transmission is to perform detection and monitoring of PEDs. At present, the conventional detection method of PED includes methods such as electron microscope observation, ELISA, indirect immunofluorescence, enzyme-linked immunosorbent assay, immune colloidal gold, reverse transcription PCR, fluorescence real-time quantitative PCR and the like of virus particles. The electron microscope observation of virus particles firstly needs to separate viruses, then the electron microscope observation is carried out, the time consumption is long, and the process is complex. ELISA, indirect immunofluorescence, ELISA, reverse transcription PCR, fluorescence real-time quantitative PCR have the advantages of high sensitivity, strong specificity and the like, but require higher test conditions, expensive instruments and professional technicians, have complex operation, longer time and high detection cost, and are difficult to develop in common farms and basic units. All the above methods cannot meet the detection requirements of simplicity, rapidness and high sensitivity due to the own characteristic limitations. Early discovery, early diagnosis and molecular epidemiological investigation of PEDs are important means of controlling the popularity of PEDs and reducing the economic losses due to the onset of PEDs. Therefore, it is very important to establish a simple, rapid, highly sensitive detection method and develop a PEDV detection kit suitable for field application.
Disclosure of Invention
The invention aims to solve the technical problems, and the technical scheme and the beneficial effects adopted for solving the technical problems.
The invention aims to provide an RT-CPA detection primer and a kit for porcine epidemic diarrhea virus, and the detection primer and the kit provided by the invention can accurately, rapidly and highly sensitively detect porcine epidemic diarrhea virus.
The technical scheme of the invention is as follows:
the invention provides an RT-CPA detection primer for detecting porcine epidemic diarrhea virus, which specifically comprises the steps of designing three pairs of primers (a pair of stripping primers, a pair of crossing primers and a pair of detection primers) aiming at a conserved region of PEDV N gene, adding BIOTIN BIOTIN at the 5 'end of an upstream detection primer, adding fluorescein FITC at the 5' end of a downstream detection primer, and thus, the amplification product is provided with the marker, and the amplification result can be detected by using a test strip capable of detecting the marker. The stripping primers include N-F and N-R, the cross primers include N-CPF and N-CPR, and the detection primers include N-DF and N-DR.
Preferably, the primer N-F nucleotide sequence is as follows: 5'ATGGCTTCTGTCAGCTTTC 3'; the nucleotide sequence of the primer N-R is as follows: 5 'GTTCAATTCGCTACCACCACG3'; the primer N-CPF nucleotide sequence is as follows: 5 'TTTGCTCATTCCAGTCATTC-CGGGTGCCATTATCCCTCTAT'; the primer N-CPR nucleotide sequence is as follows: 5 'CGGGTGCCATTATCATC-TTTGCTCATTCCAGTATCC'; the nucleotide sequence of the primer N-DF is as follows: 5'- (BIOTIN) GCCCCTCTTAGGGTTACT'; the primer N-DR nucleotide sequence is as follows: 5'- (FITC) AATTTGCTGGTCCTTATTTC';
the invention provides a kit for detecting RT-CPA of porcine epidemic diarrhea virus, which comprises the RT-CPA detection primer of porcine epidemic diarrhea virus.
Preferably, the kit further comprises Bst DNA/RNA polymerase, dNTPs, reaction Buffer, mgSO 4 And Betaine.
Preferably, the kit further comprises a nucleic acid detection test strip.
Preferably, when the RT-CPA detection primer is used, the amplification system comprises per 20. Mu.L: reaction Buffer 2.0. Mu.L, N-CPF, N-CPR each 1.0. Mu.M, N-F, N-R each 0.5-1.0. Mu.M, N-DF, N-DR each 0.2-1.2. Mu.M, mgSO 4 0.6-2.0 mM, dNTPs 0.6-1.6mM,Betaine 0.2-1.4M, bst DNA/RNA polymerase 1.0-8.0U, template RNA1 uL, ddH2O to 20 uL.
Preferably, the amplification system comprises, per 20. Mu.L: reaction Buffer 2.0. Mu.L, N-CPF, N-CPR each 1.0. Mu.M, N-F, N-R each 0.7. Mu.M, N-DF, N-DR each 0.6. Mu.M, mgSO 4 1.2mM，dNTPs 1.0mM，Betaine 0.6mM, bst DNA/RNA polymerase 1.6U, template RNA 1. Mu.L, ddH2O make up to 20. Mu.L.
Preferably, the conditions of the amplification include: reacting for 15-90 min at 57-65 ℃, and inactivating for 2min at 85 ℃.
Preferably, the conditions of the amplification include: reacting at 61 deg.C for 60min, and inactivating at 85 deg.C for 2min.
The invention has the beneficial effects that:
1. the specificity is good, and the porcine epidemic diarrhea virus can be rapidly and effectively detected;
2. the operation is simple, the requirement on the instrument is low without depending on the professional inspector, and only one metal bath or constant temperature device is needed;
3. the method is accurate and rapid, can detect 10 copies/. Mu.L of PEDV, and can shorten the detection time to within one hour;
4. the detection result is easy to judge, simple and visual. (the nucleic acid detection test strip has a quality control line and a detection line, and the test strip has a red line at both the quality control line and the detection line and has a positive result.)
In conclusion, the RT-CPA detection primer and the kit for detecting the porcine epidemic diarrhea virus have good application prospects, and can be suitable for various levels of prevention and control units in China and various types of farms and farmers.
Drawings
FIG. 1 shows the optimization of the concentration and the proportion of different primers in a porcine epidemic diarrhea virus RT-CPA detection kit, wherein pictures are respectively Marker, 1), 2), 3), 4), 5) and 6) samples with different concentrations from right to left,
1) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.5. Mu.M each, N-DF/R: each of the two sets was 0.2. Mu.M,
2) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.6. Mu.M each, N-DF/R: each of the two sets was 0.4. Mu.M,
3) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.7. Mu.M each, N-DF/R: each of the two sets was 0.6. Mu.M,
4) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.8. Mu.M each, N-DF/R: each of the two sets was 0.8. Mu.M,
5) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.9. Mu.M each, N-DF/R: each 1.0 mu M of the total concentration,
6) N-CPF/R: 1.0. Mu.M each, N-F/R: 1.0. Mu.M each, N-DF/R: 1.2. Mu.M each;
FIG. 2 shows different concentrations of MgSO in the porcine epidemic diarrhea virus RT-CPA detection kit 4 Marker and 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0mM MgSO, respectively, from right to left 4 A sample;
FIG. 3 shows the optimization of dNTPs with different concentrations in a porcine epidemic diarrhea virus RT-CPA detection kit, wherein the dNTPs are respectively Marker samples and 0.6mM, 0.8 mM, 1.0mM, 1.2mM, 1.4mM and 1.6mM from right to left mM;
FIG. 4 shows the optimization of different concentrations of Betaine in a porcine epidemic diarrhea virus RT-CPA detection kit, wherein the samples are Marker and 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 and 1.4mM Betaine from left to right respectively;
FIG. 5 shows the optimization of Bst DNA/RNA polymerase at different concentrations in a kit for detecting porcine epidemic diarrhea virus RT-CPA, wherein the samples are Marker and 1.0, 1.6, 3.2, 4.8, 6.4 and 8.0U of Bst DNA/RNA polymerase respectively from right to left;
FIG. 6 shows the optimization of different reaction temperatures in the porcine epidemic diarrhea virus RT-CPA detection kit, wherein the reaction temperatures are Marker, 59 ℃, 61 ℃, 63 ℃ and 65 ℃ from left to right;
FIG. 7 shows the optimization of different reaction times in the porcine epidemic diarrhea virus RT-CPA detection kit, wherein the reaction times are respectively Marker and 15min, 30min, 45min, 60min and 75min from right to left;
FIG. 8 is a schematic diagram showing the specificity of the RT-CPA detection kit and the detection result of the porcine epidemic diarrhea virus, wherein the samples are PEDV, TGEV, RV, E.coli and blank control (H2O) in sequence from right to left;
FIG. 9 shows the detection sensitivity of the RT-CPA detection kit for porcine epidemic diarrhea virus, wherein the concentration of the sample from left to right virus standard plasmid is 10 in sequence 9 copies/μL、10 8 copies/μL、10 7 copies/μL、10 6 copies/μL、10 5 copies/μL、10 4 copies/μL、10 3 copies/μL、10 2 copies/μL、10 1 copies/μL、10 0 copies/. Mu.L, blank (H2O).
Detailed Description
The invention provides a RT-CPA detection primer of porcine epidemic diarrhea virus, which comprises N-F, N-R, N-CPF, N-CPR, N-DF and N-DR.
In the present invention, the N-F nucleotide sequence is: 5'ATGGCTTCTGTCAGCTTTC 3';
in the present invention, the N-R nucleotide sequence is: 5 'GTTCAATTCGCTACCACCACG3';
in the present invention, the N-CPF nucleotide sequence is: 5'TTTGCTCATTCCAGTATCCCGGGTGCCATTATCCC TCTAT 3';
in the present invention, the N-CPR nucleotide sequence is: 5'CGGGTGCCATTATCCCTCTAT TTTGCTCATTCCA GTATCC3';
in the present invention, the N-DF nucleotide sequence is: 5'- (BIOTIN) GCCCCTCTTAGGGTTACT';
in the present invention, the N-DR nucleotide sequence is: 5'- (FITC) AATTTGCTGGTCCTTATTTC';
in the present invention, the N-CPF and N-CPR are cross primers, the N-F and N-R are stripping primers, and the N-DF and N-DR are detection primers. In the invention, the RT-CPA detection primer is designed by taking a section of conservation region (205 bp) in an N gene (JX 406145.1) sequence of a PEDV strain published by GenBank as a template, and uses an RT-CPA technology to amplify a specific region of a target gene, so that the rapid detection of the porcine epidemic diarrhea virus is carried out at a molecular level, and the method has the characteristics of simplicity, convenience, rapidness, high specificity and sensitivity.
In the present invention, when the RT-CPA detection primer is used, the amplification system preferably comprises, per 20. Mu.L: reaction Buffer 2.0. Mu.L, N-CPF, N-CPR each 1.0. Mu.M, N-F, N-R each 0.5-1.0. Mu.M, N-DF, N-DR each 0.2-1.2. Mu.M, mgSO 4 0.6 to 2.0mM, dNTPs 0.6 to 1.6mM,Betaine 0.2 to 1.4mM, bst DNA/RNA polymerase 1 to 8.0U, template RNA 1. Mu.L, ddH2O to 20. Mu.L; more preferably comprises Reaction Buffer 2.0. Mu.L, N-CPF, N-CPR each 1.0. Mu.M, N-F, N-R each 0.7. Mu.M, N-DF, N-DR each 0.6. Mu.M, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6M,Bst DNA/RNA polymerase 1.6U, template RNA 1. Mu.L, ddH2O make up to 20. Mu.L.
In the present invention, the conditions for the amplification preferably include: reacting for 15-90 min at 57-65 ℃, and inactivating for 2min at 85 ℃; more preferably, the reaction is carried out at a temperature of 63℃for 60min and then inactivated at a temperature of 85℃for 2min.
The invention also provides a kit for detecting porcine epidemic diarrhea virus, which comprises the RT-CPA detection primer according to the technical scheme.
In the present invention, the kit further preferably comprises Reaction Buffer, bst DNA/RNA polymerase, dNTPs, betaine, mgSO 4 . The reagent source of the kit is not particularly limited, and the kit can be prepared by adopting a conventional commercial product. The amount of reagent placed in the kit is not particularly limited, and the amount of reagent placed in the conventional kit is adopted.
In the present invention, the kit further preferably comprises a nucleic acid detection test strip, which is purchased from the company you Si Da, hangzhou, and has the model number: d003-03.
In the present invention, the method of using the kit preferably comprises: amplifying by adopting the amplification system and the amplification conditions to obtain an amplification product;
when the nucleic acid detection test strip is not used for detection, taking an amplified product, carrying out agarose gel electrophoresis with the concentration of 1.0% (W/V), then placing the amplified product in a gel imaging system for imaging, and displaying RT-CPA characteristic ladder-shaped strips by an electrophoresis picture, wherein the result is positive; if no strip exists, the result is negative;
when the nucleic acid detection test strip is used for detection, the amplified product is taken and detected by the nucleic acid detection test strip, and only a red line appears in the quality control area C, so that the detection result of the sample is negative; two red lines appear, one detection line and one quality control line, which indicate that the sample detection result is positive; no red lines appear in the quality control area C and the detection area T, which indicates that the nucleic acid detection test strip fails and the detection result is invalid.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
A porcine epidemic diarrhea virus RT-CPA detection kit comprising: reaction Buffer; bst DNA/RNA polymerase (NEB); dNTPs; mgSO (MgSO) 4 The method comprises the steps of carrying out a first treatment on the surface of the Betaine (Sigma); cross primers N-CPF, N-CPR; stripping primer N-F, N-R; detecting a primer N-DF and N-DR; nucleic acid detection test strip.
N-CPF：5'TTTGCTCATTCCAGTATCCCGGGTGCCATTATCCCTCTAT 3'；
N-CPR：5'CGGGTGCCATTATCCCTCTATTTTGCTCATTCCAGTATCC3'；
N-F：5'ATGGCTTCTGTCAGCTTTC 3'；
N-R：5'GTTCAATTCGCTCACCACG3'；
N-DF：5'BIOTIN-GCCCCTCTTAGGGTTACT 3'；
N-DR：5'FITC3-AATTTGCTGGTCCTTATTTC3'。
Example 2
Optimization of concentration and proportion of different primers in RT-CPA detection kit for porcine epidemic diarrhea virus
1. Extraction of total RNA of porcine epidemic diarrhea virus
Collecting cell venom of porcine epidemic diarrhea virus, centrifuging at 5000r/min at 4deg.C for 30min, collecting supernatant, extracting porcine epidemic diarrhea virus RNA from the collected supernatant by using ThermoFisher RNA extraction kit, and storing the extracted RNA at-20deg.C for use.
2. Configuring RT-CPA amplification reaction system
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1 mu L of virus RNA template, 2.0 mu L of Reaction Buffer and MgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6mM,Bst DNA/RNA polymerase 1.6U, N-CPF/R, N-F/R, N-DF/R, nuclease-free water make-up to 20. Mu.L. Wherein the cross primer (N-CPF, N-CPR), the stripping primer (N-F, N-R) and the detection primer (N-DF, N-DR) are used in different concentration ratios:
1) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.5. Mu.M each, N-DF/R: 0.2 mu M each
2) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.6. Mu.M each, N-DF/R: 0.4 mu M each
3) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.7. Mu.M each, N-DF/R: 0.6 mu M each
4) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.8. Mu.M each, N-DF/R: 0.8 mu M each
5) N-CPF/R: 1.0. Mu.M each, N-F/R: 0.9. Mu.M each, N-DF/R: 1.0 mu M each
6) N-CPF/R: 1.0. Mu.M each, N-F/R: 1.0. Mu.M each, N-DF/R: 1.2 mu M each
3. Reaction conditions for RT-CPA amplification
The reaction tube was incubated at 61℃for 60min and inactivated at 85℃for 2min.
4. Determination of detection results
Taking 10 mu L of amplified product, carrying out agarose gel electrophoresis with concentration of 1.0%, placing the amplified product in a gel imaging system for imaging, and displaying primer concentration by an electrophoresis picture (figure 1), wherein the amplification effect of the combination 3 is the best, namely: N-CPF/R: 1.0. Mu.M each, N-F/R: 0.7. Mu.M each, N-DF/R: each 0.6 μm.
Example 3
MgSO with different concentrations in RT-CPA detection kit for porcine epidemic diarrhea virus 4 Optimization of (a)
1. Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
2. Reaction system for configuring RT-CPA amplification
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 dNTPs 1.0mM,Betaine0.6mM,Bst DNA/RNA polymerase 1.6U, nuclease-free water make up to 20. Mu.L.
Wherein MgSO 4 The concentration of (C) was 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0mM, respectively.
3. Reaction conditions for RT-CPA amplification
The reaction tube was incubated at 61℃for 60min and inactivated at 85℃for 2min.
4. Determination of detection results
After 10. Mu.L of the amplified product was electrophoresed on a 1.0% agarose gel, the amplified product was imaged in a gel imaging system, and an electrophoresis image (FIG. 2) showed that MgSO4 concentration was 1.2mM, which was most effective.
Example 4
Optimization of dNTPs with different concentrations in porcine epidemic diarrhea virus RT-CPA detection kit
1. Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
2. Reaction system for configuring RT-CPA amplification
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 1.2mM,dNTPs,Betaine0.6mM,Bst DNA/RNA polymerase 1.6U, nuclease-free water make up to 20. Mu.L.
Wherein the concentration of dNTPs is 0.6, 0.8, 1.0, 1.2, 1.4, 1.6mM, respectively.
3. Reaction conditions for RT-CPA amplification:
the reaction tube was incubated at 63℃for 60min and inactivated at 85℃for 2min.
4. And (3) judging a detection result:
10. Mu.L of the amplified product was electrophoresed through a 1.0% agarose gel and then imaged in a gel imaging system, and the electrophoresed pictures (FIG. 3) showed that dNTPs at a concentration of 1.0mM gave the best results.
Example 5
Optimization of Betaine with different concentrations in RT-CPA detection kit for porcine epidemic diarrhea virus
1. Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
2. Reaction system for configuring RT-CPA amplification
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine,Bst DNA/RNA polymerase 1.6U, nuclease-free water make up to 20. Mu.L.
Wherein the concentration of Betaine is 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4mM sample, respectively.
3. Reaction conditions for RT-CPA amplification
The reaction tube was incubated at 63℃for 60min and inactivated at 85℃for 2min.
4. Determination of detection results
After 10. Mu.L of the amplified product was electrophoresed on a 1.0% agarose gel, the amplified product was imaged in a gel imaging system, and an electrophoresis image (FIG. 4) showed that the concentration of Betaine was 0.6mM, which was most effective.
Example 6
Optimization of Bst DNA/RNA polymerase with different concentrations in RT-CPA detection kit for porcine epidemic diarrhea virus
1. Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
2. Reaction system for configuring RT-CPA amplification
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6mM,Bst DNA/RNA polymerase, nuclease-free water make up to 20. Mu.L.
Wherein the concentration of Bst DNA polymerase is 1.0, 1.6, 3.2, 4.8, 6.4, 8.0U, respectively.
3. Reaction conditions for RT-CPA amplification:
the reaction tube was incubated at 63℃for 60min and inactivated at 85℃for 2min.
4. And (3) judging a detection result:
10. Mu.L of the amplified product was electrophoresed through a 1.0% agarose gel and then imaged in a gel imaging system, and the electrophoresis image (FIG. 5) showed that Bst concentration was 1.6U, which was most effective.
Example 7
Optimization of different reaction temperatures in porcine epidemic diarrhea virus RT-CPA detection kit
1. Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
2. Reaction system for configuring RT-CPA amplification
According to 20. Mu.L RT-CPA amplification reactionThe reaction system is prepared with the following reaction liquid: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6mM,Bst DNA/RNA polymerase 1.6U, nuclease-free water make up to 20. Mu.L.
3. Reaction conditions for RT-CPA amplification
The reaction tubes were incubated at 59℃at 61℃at 63℃at 65℃for 60min, and then inactivated at 85℃for 2min.
4. Determination of detection results
10. Mu.L of the amplified product was subjected to electrophoresis with 1.0% agarose gel, and then was subjected to imaging in a gel imaging system, and the electrophoresis image (FIG. 6) showed that the reaction temperature was 61℃and the effect was excellent.
Example 8
Optimization of different reaction time in porcine epidemic diarrhea virus RT-CPA detection kit
1. Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
2. Reaction system for configuring RT-CPA amplification
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6mM,Bst DNA/RNA polymerase 1.6U, nuclease-free water make up to 20. Mu.L.
3. Reaction conditions for RT-CPA amplification:
the reaction tube was incubated at 63℃for 15min, 30min, 45min, 60min, 75min, and then inactivated at 85℃for 2min.
4. And (3) judging a detection result:
10. Mu.L of the amplified product was subjected to electrophoresis with 1.0% agarose gel, and then the amplified product was subjected to imaging in a gel imaging system, and an electrophoresis image (FIG. 7) shows that the reaction temperature was 60 min.
Example 9
Specificity test of porcine epidemic diarrhea virus RT-CPA detection kit
PEDV, TGEV, RV, E.coli, were tested and a blank was set up according to the porcine epidemic diarrhea virus RT-CPA test kit optimized in examples 2, 3, 4, 5, 6, 7, 8.
Extraction of total RNA of virus
Collecting PEDV, TGEV, RV cell venom, repeatedly freezing and thawing for 3 times at-80 ℃ to room temperature, centrifuging at 5000r/min for 30min, collecting supernatant, extracting total RNA of virus from the collected supernatant by using a ThermoFisher DNA/RNA extraction kit, and storing the extracted total RNA of virus at-20 ℃ for later use by referring to the description of the kit. Coli was directly detected using the bacterial solution (109 CFU/mL) as a template.
2. Reaction system for configuring RT-CPA amplification
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6mM,Bst DNA/RNA polymerase 1.6U, nuclease-free water make up to 20. Mu.L.
3. Reaction conditions for RT-CPA amplification
The reaction tube was incubated at 63℃for 60min and inactivated at 85℃for 2min.
4. Determination of detection results
And detecting by using a nucleic acid detection test strip, dripping 5-8 mu L of amplified product to the lower end of the test strip, and dripping 100 mu L of buffer (Hangzhou Yongsi da company) for 15-30 min to observe the result. The nucleic acid detection test strip shows that the specific RT-CPA primer set designed for PEDV can ensure the specific detection of PEDV, only the PEDV is detected to be positive, and TGEV, RV, escherichia coli and blank control (water) are all negative (figure 8).
Example 10
Sensitivity test of porcine epidemic diarrhea virus RT-CPA detection kit
1. Construction of Standard recombinant plasmid
Extracting PEDV total RNA, carrying out reverse transcription PCR to amplify the full-length sequence of the N gene (JX 406145.1) of PEDV, cloning to pMD19-T plasmid, carrying out verification, and naming the correct recombinant plasmid as the verificationpMD19-T-N. Purifying recombinant plasmid, measuring plasmid concentration, calculating plasmid copy number, and adjusting standard plasmid concentration to 10 with pure water 10 COPies/. Mu.L. In the sensitivity measurement, the standard plasmid was diluted 10-fold with pure water to give a plasmid concentration range of 10 9 copies/μL～10 0 The copies/. Mu.L served as templates for CPA reactions.
2. Reaction system for configuring RT-CPA amplification
The reaction solution was prepared according to 20. Mu.L RT-CPA amplification reaction system, and the reaction solution was as follows: 1. Mu.L of viral RNA template, 2.0. Mu.L of Reaction Buffer, 1.0. Mu.M each of N-CPF/R, 0.7. Mu.M each of N-F/R, 0.6. Mu.M each of N-DF/R, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6mM,Bst DNA/RNA polymerase 1.6U, nuclease-free water make up to 20. Mu.L.
3. Reaction conditions for RT-CPA amplification
The reaction tube was incubated at 63℃for 60min and inactivated at 85℃for 2min.
4. Determination of detection results
And detecting by using a nucleic acid detection test strip, dripping 5-8 mu L of amplified product to the lower end of the test strip, and dripping 100 mu L of buffer (Hangzhou Yongsi da company) for 15-30 min to observe the result. The nucleic acid test strip showed that 10 copies/. Mu.L of the standard recombinant plasmid could be detected (FIG. 9).
The above examples are only preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above examples, and other modifications and improvements made without departing from the principles of the present invention should be considered as the scope of the present invention.

Claims (8)

1. An RT-CPA primer for detecting porcine epidemic diarrhea virus, comprising N-F, N-R, N-CPF, N-CPR, N-DF, and N-DR;
the N-F nucleotide sequence is as follows: 5'ATGGCTTCTGTCAGCTTTC 3';
the N-R nucleotide sequence is as follows: 5 'GTTCAATTCGCTACCACCACG3';
the N-CPF nucleotide sequence is as follows: 5'TTTGCTCATTCCAGTATCCCGGGTGCCATTATCCCTCTAT 3';
the N-CPR nucleotide sequence is as follows: 5'CGGGTGCCATTATCCCTCTAT TTTGCTCATTCCAGTATCC3';
the N-DF nucleotide sequence is as follows: 5'- (BIOTIN) GCCCCTCTTAGGGTTACT';
the N-DR nucleotide sequence is as follows: 5'- (FITC) AATTTGCTGGTCCTTATTTC'.
2. An RT-CPA primer for detecting porcine epidemic diarrhea virus according to claim 1, wherein the RT-CPA primer comprises per 20 μl of amplification system: reaction Buffer 2.0. Mu.L, N-CPF, N-CPR each 1.0. Mu.M, N-F, N-R each 0.5-1.0. Mu.M, N-DF, N-DR each 0.2-1.2. Mu.M, mgSO 4 0.6-2.0 mM, dNTPs 0.6-1.6mM,Betaine 0.2-1.4M, bst DNA/RNA polymerase 1.0-8.0U, template RNA1 uL, ddH2O to 20 uL.
3. An RT-CPA primer for detecting porcine epidemic diarrhea virus according to claim 2, wherein the amplification system comprises per 20 μl: reaction Buffer 2.0. Mu.L, N-CPF, N-CPR each 1.0. Mu.M, N-F, N-R each 0.7. Mu.M, N-DF, N-DR each 0.6. Mu.M, mgSO 4 1.2mM,dNTPs 1.0mM,Betaine0.6M,Bst DNA/RNA polymerase 1.6U, template RNA 1. Mu.L, ddH2O make up to 20. Mu.L.
4. A RT-CPA primer for detecting porcine epidemic diarrhea virus according to claim 2 or 3, wherein the amplification conditions comprise: reacting for 15-90 min at 57-65 ℃, and inactivating for 2min at 85 ℃.
5. The RT-CPA primer for detecting porcine epidemic diarrhea virus according to claim 4, wherein the amplification conditions comprise: reacting at 63 deg.C for 60min, and inactivating at 85 deg.C for 2min.
6. An RT-CPA kit for detecting porcine epidemic diarrhea virus, comprising the RT-CPA primer of claim 1.
7. The kit for detecting porcine epidemic diarrhea virus according to claim 6, wherein the kit further comprises Bst DNA/RNA polymerase, dNTPs, reaction Buffer, mgSO 4 And Betaine.
8. The RT-CPA kit for detecting porcine epidemic diarrhea virus according to claim 6, wherein said kit further comprises a nucleic acid detection test strip.
CN202110805347.3A 2021-07-16 2021-07-16 RT-CPA detection primer and kit for porcine epidemic diarrhea virus Active CN113755640B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110805347.3A CN113755640B (en) 2021-07-16 2021-07-16 RT-CPA detection primer and kit for porcine epidemic diarrhea virus

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110805347.3A CN113755640B (en) 2021-07-16 2021-07-16 RT-CPA detection primer and kit for porcine epidemic diarrhea virus

Publications (2)

Publication Number Publication Date
CN113755640A CN113755640A (en) 2021-12-07
CN113755640B true CN113755640B (en) 2023-10-13

Family

ID=78787687

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110805347.3A Active CN113755640B (en) 2021-07-16 2021-07-16 RT-CPA detection primer and kit for porcine epidemic diarrhea virus

Country Status (1)

Country Link
CN (1) CN113755640B (en)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109609695A (en) * 2018-12-29 2019-04-12 华南农业大学 Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN109609695A (en) * 2018-12-29 2019-04-12 华南农业大学 Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
Reverse Transcription Cross-Priming Amplification–Nucleic Acid Test Strip for Rapid Detection of orcine Epidemic Diarrhea Virus;Feng-Xue Wang等;Scientific Reports;第6卷;24702 *
交叉引物恒温扩增技术（CPA）研究进展;黄梦琦等;民营科技(第9期);78-79 *

Also Published As

Publication number Publication date
CN113755640A (en) 2021-12-07

Similar Documents

Publication Publication Date Title
CN105420379A (en) Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof
CN110004240B (en) Real-time fluorescence detection kit and test strip detection kit for mycoplasma gallisepticum based on RPA and application of kit and test strip detection kit
WO2020034317A1 (en) Dual real-time fluorescent quantitative pcr detection reagent and reagent kit for seneca virus a and foot-and-mouth disease virus
CN111286559B (en) Primer, probe and kit for detecting African swine fever virus
CN111676324A (en) Method for detecting new coronavirus based on RAA-LFD
CN110735006A (en) African swine fever TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit
WO2022179494A1 (en) Salmonella typhi detection kit, preparation method therefor and application thereof
CN106148506A (en) The antenatal detection kit of a kind of B race streptococcus quantitative fluorescent PCR and application thereof
CN109439775A (en) A kind of multi-PCR detection method of porcine pathogen
CN113755640B (en) RT-CPA detection primer and kit for porcine epidemic diarrhea virus
CN116814859A (en) Primer probe composition, kit and method for identifying African swine fever virus genes I and II
CN111471802A (en) Porcine delta coronavirus rapid detection primer, kit and application thereof
CN114574628B (en) Detection kit and application thereof
CN114807435A (en) Kit for detecting respiratory syncytial virus and application thereof
CN114196784B (en) RT-CPA detection primer and kit for transmissible gastroenteritis virus
CN110157836B (en) Primer, probe and method for detecting IBRV and BVDV
CN111593137A (en) Fluorescent quantitative PCR detection reagent and kit for African swine fever virus
CN116515840B (en) Kit and detection method for detecting bovine viral diarrhea virus type 3
CN105002299B (en) Detect specific primer, probe and the kit of Echovirus30 viruses
CN114250320B (en) RT-CPA primer group and kit for detecting porcine rotavirus
CN110791579B (en) Real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit and detection method for identifying chlamydophila abortus
CN117802275B (en) Triple fluorescence quantitative PCR detection method for main pathogen of calf diarrhea and application thereof
CN108315480B (en) Real-time fluorescent quantitative PCR primer, probe and kit for detecting tree shrew adenovirus
TWI681057B (en) Primer pair for detecting ureaplasma urealyticum serovar 10 and kit thereof
CN105385785A (en) Taqman Real-time RT-PCR reagent kit for detecting hog cholera virus vaccine C strain and use method thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant