CN105002299B - Detect specific primer, probe and the kit of Echovirus30 viruses - Google Patents
Detect specific primer, probe and the kit of Echovirus30 viruses Download PDFInfo
- Publication number
- CN105002299B CN105002299B CN201510320134.6A CN201510320134A CN105002299B CN 105002299 B CN105002299 B CN 105002299B CN 201510320134 A CN201510320134 A CN 201510320134A CN 105002299 B CN105002299 B CN 105002299B
- Authority
- CN
- China
- Prior art keywords
- detection
- viruses
- kit
- probe
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6851—Quantitative amplification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses specific primer, probe and the kit of a kind of detection Echovirus30 viruses, belongs to technical field of biological, and the specific primer has such as SEQ ID NO:2 and SEQ ID NO:Base composition shown in 3, the probe have such as SEQ ID NO:Base composition shown in 4.The kit of present invention detection Echovirus30 viruses can be reached 100% with specificity, can be detected content as little as 27.7copy/ul sample using specific primer and probe and the detection architecture of optimization, sensitivity；Without PCR primer is sequenced, the detection cycle of existing method is substantially reduced, while improve the sensitivity of detection；The kit of the present invention can early diagnose to the patient of infection Echovirus30 viruses, fill up the blank of the domestic kit for Echovirus30 viruses.
Description
Technical field
The invention belongs to biological technical field, and specifically, the present invention relates to a kind of viral encephalitis correlated virus
Echovirus30 specific detection primer, probe and its fluorescent quantificationally PCR detecting kit.
Background technology
Mankind's ECHO30 virus (Echovirus 30, ECHO30) belongs to Type B enterovirus, is to cause children and adult
One of main pathogens of aseptic meningitis.In pediatric viral encephalitis case, the case as caused by ECHO30 viruses accounts for
80~93%.The virus is a kind of without after birth virus, can be stablized under rugged environment condition (such as high salt, high ph-values and 37 DEG C)
Survival.People remains to discharge virus from respiratory tract and enteron aisle within several weeks after infecting Human enterovirus virus, so as to cause virus
Propagate, infection even outbreak of epidemic.
On China Taiwan, Zhejiang, Fujian and Henan and other places, repeatedly report causes viral encephalitis by ECHO30 in recent years
Break out or popular.At the beginning of 5 months 2012, the report of Luoding City of Guangdong Province is together to generate heat, have a headache, vomit brain for main clinic symptoms
It is scorching popular.This time epidemic situation reports 246 encephalitis cases altogether, and wherein ECHO30, which is accounted for, all makes a definite diagnosis the 60% of parting case.Since then,
ECHO30 is always one of Guangdong Province's emphasis monitoring infectious disease, and it makes a definite diagnosis as early as possible can help to find epidemic situation early, take arrange as early as possible
Apply, epidemic situation is controlled in minimum zone, so as to which loss is minimized.
The test method that human enterovirus infection is detected and classified mainly is having three major types at this stage at present：When
Traditional virus purification and serum neutralization test；Second, the Serum Antibody Detection of human enterovirus；Third, Molecular strain typing
Method.
Although traditional virus purification and the goldstandard that serum neutralization test sizing is human enterovirus detection, due to inspection
The limitations such as the time is long, neutralization test is cumbersome are surveyed, have significant limitation as early stage quick determination method.Examined for serology
Comparatively the EUSA (ELISA) of survey has the advantages that method is easy, quick, but due to human enterovirus type
Not numerous, ELISA-IgM kits use hybrid antigen more, specific relatively low, it is impossible to accurately to detect a certain serotype people intestines
Road virus infection, so equally having limitation.2006, Nix etc. was by human enterovirus genetic analysis, proposing basis
VP1 areas total length or partial sequence homology size carry out the standard of enterovirus type judgement.For ECHO30, its molecule parting
After amplifying purpose fragment using nest PCR (PCR), then it can pass through by using the universal primer of enterovirus
Sequencing and sequence alignment are judged.But this method requires higher to the detection technique of ECHO30 in encephalitis case, is cured in basic unit
Yuan Ji cities, Disease Control and Prevention Center at county level are difficult to popularize.In addition, the nested PCR method sensitivity is relatively low, detection cycle is longer cause it is starting
Patient tends not to confirm cause of disease in time, without adopting an effective measure in time, so as to cause epidemic situation to spread.Every epidemic situation is at it
It was found that when be absorbed in passive situation, and then costly manpower and materials go to control.
Therefore, develop it is sensitive, easy, quick, economical, be suitable for the ECHO30 diagnostic reagents that grass-roots unit promotes the use of
As urgent need to solve the problem.
Real-Time round pcrs, also known as real-time quantitative fluorescence PCR, refer to add fluorescent base in PCR reaction systems
Group, whole PCR processes are monitored using fluorescence signal accumulation in real time, and macroanalysis is carried out to unknown template finally by standard curve
Or relative quantification is carried out to template by Ct values.Compared with Standard PCR, real-time quantitative PCR need not take out PCR primer and be divided
From it has the characteristics that stronger, the effective solution PCR pollution problems of specificity, automaticity are high.The reality very effective as one
Proved recipe method, real-time quantitative PCR have been widely used for the diagnosis of human infectious disease.
Because ECHO30 viruses in China in just there is outbreak of epidemic in recent years, at present disclosed in ncbi database at me
The sequence of the popular ECHO30 strains of state is also less, therefore designs special and sensitive ECHO30 according to a small number of sequences are more difficult
Virus detection kit.At present, the domestic real-time quantitative fluorescence PCR kit that there is no detection ECHO30 viruses, to ECHO30 diseases
The detection of poison still relies on the method for nest-type PRC and the method for cell culture, and there is detection technique to require high, detection cycle length,
The shortcomings of poor sensitivity.
The content of the invention
Based on this, the defects of in order to overcome above-mentioned prior art, the invention provides one kind detection Echovirus30 viruses
Specific primer, probe and fluorescent quantificationally PCR detecting kit, solve prior art requires high to detection technique, inspection
Cycle length is surveyed, the shortcomings that poor sensitivity.
In order to realize foregoing invention purpose, this invention takes following technical scheme：
A kind of specific primer of detection Echovirus30 viruses, the specific primer have such as SEQ ID NO:2 Hes
SEQ ID NO:Base composition shown in 3.
A kind of probe of detection Echovirus30 viruses, the probe have such as SEQ ID NO:Base group shown in 4
Into.
In one of the embodiments, 5' ends band fluorophor FAM, the 3' ends band quenching group TAMRA of the probe.
A kind of kit of detection Echovirus30 viruses, includes：The spy of above-mentioned detection Echovirus30 viruses
The probe of specific primer and above-mentioned detection Echovirus30 viruses.
In one of the embodiments, the kit of detection Echovirus30 virus also include reaction buffer and
Enzyme reaction solution, the reaction buffer include dNTPs, MgCl2And stabilizer, the enzyme reaction solution includes reverse transcriptase, heat opens
Dynamic archaeal dna polymerase and RNase inhibitor.
The present invention is by the Echovirus30 and 2008-2012 to Guangdong outbreak of epidemic in 2012 in Guangzhou environment
The Echovirus30 detected in sewage, totally 26 strains be sequenced, in combination with all Echovirus30 bases in Genbank
Because of sequence, by sequence alignment, it is determined that conservative fragment designs special detection primer pair and visited as detection target relatively
Pin, it successfully have developed Echovirus30 virus real-time quantitative fluorescence PCR detection kits.Compared with prior art, present invention tool
There is following beneficial effect：
1st, present invention detection Echovirus30 viruses use specific primer and probe and the detection architecture of optimization,
Kit sensitivity can reach 100% with specificity, and significantly larger than domestic conventional method at present is that nest-type PRC is mutually tied with sequencing
The method of conjunction (its sensitivity only has 46.2%)；
2nd, the fluorescent quantificationally PCR detecting kit of detection Echovirus30 of the invention viruses is through BioRad digital pcr instrument
Absolute quantitation, the kit can detect content as little as 27.7copy/ul sample；
3rd, the method for detection Echovirus30 of the invention viruses substantially reduces existing without PCR primer is sequenced
Methodical detection cycle；
4th, the real-time quantitative fluorescence PCR detection kit of Echovirus30 of the invention viruses is by detecting cerebrospinal fluid, excrement
Just Echovirus30 viral nucleic acids in sample are waited, the patient of infection Echovirus30 viruses can be early diagnosed, filled up
The blank of the domestic kit for Echovirus30 viruses.
Brief description of the drawings
Fig. 1 is the testing result of 1 positives sample of test example of the present invention, and wherein A is that 26 parts of cell separation are accredited as the positive
The nest-type PRC first round gel electrophoresis figure of sample；The wheel of nest-type PRC second that B is accredited as positive sample for 26 parts of cells separation is solidifying
Gel electrophoresis figure；C is the fluorescent quantitative PCR curve map that 26 parts of cell separation are accredited as positive sample；
Fig. 2 is the absolute quantitation result of digital pcr instrument in test example 3 of the present invention.
Embodiment
Below in conjunction with specific embodiment, the present invention is expanded on further.But these embodiments be only limitted to explanation the present invention and
It is not the further restriction to protection scope of the present invention.
The experimental method of unreceipted actual conditions in following examples, generally according to normal condition, such as Sambrook etc.
People, molecular cloning：Laboratory manual (New York:Cold SpringHarborLaboratory Press, 1989) described in
Condition, or according to the condition proposed by manufacturer.Used various conventional chemical reagent, are commercially available production in embodiment
Product.
A kind of real-time quantitative fluorescence PCR detection kit of 1 Echovirus30 of embodiment viruses
The preparation of detection kit described in the present embodiment comprises the following steps：
1st, the target and special primer and probe of detection are determined
By the way that totally 26 plants of ECHO30 viruses of Guangdong Province's bacterium Virus seed library preservation are sequenced, in combination with GenBank
Totally 29 ECHO30 virus sequences, relatively conservative fragment SEQ ID NO are determined by target gene VP1 sequence alignment:1
Target sequence as detection；
Bioinformatic analysis is carried out to it using softwares such as Bioedit and PrimerPremier5.0, for SEQ
ID NO:1 sequence, design qPCR primer pair SEQ ID NO:2 and SEQ ID NO:3 and Taqman probe SEQ ID NO:4.Draw
Thing and Taqman probes deliver biotech firm's synthesis.
Particular sequence is as follows：
The target sequence SEQ ID NO of detection:1：KM034804(7-132nt)
5'-cctgaaagtgcaatcaacagggccgtgggaagggtagccgacactgtagctagtggacctgtcaac
accgagcaaattcctgccttgacagcagtggagacaggacacacatcacaagtggtaccg-3'
QPCR primer pair SEQ ID NO:2：5'-CCTGAAAGTGCAATYAAC-3'
QPCR primer pair SEQ ID NO:3：5'-CGGTACYACTTGTGATGTG-3'
Probe SEQ ID NO:4：5'-FAM-TGTCTCCACTGCTGTCAAGGC-TAMRA-3'
2nd, the composition of real-time quantitative fluorescence PCR detection kit is determined
Kit forms：Primer pair SEQ ID NO:2 and SEQ ID NO:3rd, Taqman probes SEQ ID NO:4th, 2 × anti-
Buffer solution is answered (to include dNTPs, MgCl purchased from Life technologies2, and stabilizer) and 25 × enzyme reaction solution (be purchased from
Life technologies include reverse transcriptase, thermal starting archaeal dna polymerase, RNase inhibitor).
3rd, the reaction system and response procedures of real-time quantitative fluorescence PCR detection are determined
Reaction system (25 μ l)：
PCR amplification conditions：95 DEG C of pre-degeneration 10min；95 DEG C of 15s, 55 DEG C of 1min programs carry out 40 circulations.In annealing 55
During DEG C 1min, real-time fluorescent signals collection is carried out.
Wherein template ribonucleic acid is to extract from the RNA in the samples such as cerebrospinal fluid, excrement.RNA extractions are using viral RNA extraction examination
Agent box (Qiagen, QIAamp MinElute Virus SpinKit, 57704).
The sensitivity and specificity of the real-time quantitative fluorescence PCR detection kit of the embodiment 1 of test example 1 are assessed
The method of serological typing is carried out again using cell culture amplicon virus as goldstandard, i.e.,：First by case mark
This separation is inoculated with RD and HeP2 cells, by cell culture amplicon virus, followed by specific serum (by Dutch Bilthoven
National public health is prepared with Environmental Studies institute) carry out type identification.Choose 26 through cell culture and serological Identification
ECHO30 positive cases sample and 19 other enterovirus positive ECHO30 virus negative samples, use the fluorescence of embodiment 1
Quantifying PCR method is detected, so as to judge its sensitivity and specificity.
The fluorescence quantifying PCR method threshold value setting principle of embodiment 1 is expanded with threshold line just above normal negative control
The peak of curve, as a result show that feminine gender is defined, or can be adjusted according to instrument noise situation.The criterion of sample is：
Sample of the Ct values without numerical value is negative sample；The sample that Ct value≤35.0 and amplification curve are in typical S types amplification curve is sun
Property；The sample suggestion of Ct value >=35.0 is reformed.It is feminine gender that result, which is reformed, without numerical value person, is otherwise the positive.Selected during fluorescent PCR read plate
Select FAM Air conduct measurements.
To the 26 ECHO30 positive cases samples identified through cell culture and 19 negative samples, while use routine
Nested PCR detection method (blank control replaces template DNA with ultra-pure water) and the fluorescence quantifying PCR method of embodiment 1 are carried out
Detection.Conventional nested PCR detection method is with reference to the document delivered：First by Reverse Transcriptase kit (Qiagen,
Sensiscript RT Kit) by sample rna (10 μ l) reverse transcription it is CDNA, primer is AN32/33/34/35 (primer concentrations
0.5 μM), reaction system is 20 μ l, and all steps are operated by Reverse Transcriptase kit specification, after the completion of reverse transcription, take 4 μ l
CDNA carries out nested PCR amplification reaction as template, and first round PCR primer 2s 24,222, QIAGEN thermal starting are common
PCR kit, 25 μ l reaction systems.Second wheel PCR：With primer 88,89, and QIAGEN heat start PCR kit
(HotStarTaq MasterMix Kit).PCR primer carries out gel electrophoresis identification, has the sample of amplified band further through surveying
Sequence carries out type identification after comparing.Testing result is shown in Table 1 and Fig. 1.
The testing result of 1 two kinds of detection methods of table
It was found from table 1 and Fig. 1 testing result, 26 parts of cell separation are accredited as the sample of the positive, the reagent through embodiment 1
It is the positive that box, which carries out detection,；The sample (EV71, CVA6, CVA16, CVA10) that 19 parts of cell separation are accredited as feminine gender is positive,
Sample negative ECHO30, it is feminine gender that the PCR kit for fluorescence quantitative through embodiment 1, which carries out detection,；And conventional nest-type PRC side
Method only detects 12 parts of positive samples, and ' negative ' specimens do not detect.Illustrate the quantitative fluorescent PCR reviewing party of the embodiment of the present invention 1
Method sensitivity, specificity are very high, are 100%.
The repeatability assessment of the quantitative detection architecture of the real-time quantitative fluorescence PCR detection kit of the embodiment 1 of test example 2
The repeatability of detection architecture refers to that different time sections repeat the difference between testing, with standard deviation (Standard
Deviation, SD) and relative standard deviation (Relative StandardDeviation, RSD) represent.This test example is led to
Cross and the sample of 6 various concentrations is carried out respectively to repeat to test three times, to evaluate the repeatability of detection architecture.As a result see
Table 2.
The repeatability analysis of the fluorescence quantifying PCR method of table 2
| Sample | Mean Ct | SD | RSD (%) |
| 1 | 23.52 | 0.07 | 0.29 |
| 2 | 25.56 | 0.20 | 0.78 |
| 3 | 27.69 | 0.26 | 0.94 |
| 4 | 29.40 | 0.69 | 2.34 |
| 5 | 31.48 | 0.65 | 2.08 |
| 6 | 33.92 | 0.41 | 1.22 |
As can be known from Table 2, the quantitative detection architecture repeatability of real-time quantitative fluorescence PCR detection kit of the invention is very
It is good.
The determination of the Monitoring lower-cut of the real-time quantitative fluorescence PCR detection kit of the embodiment 1 of test example 3
Single ECHO30 positive samples are chosen with four times of doubling dilutions into after 7 various concentrations gradients, utilize Biorad numbers
Word PCR instrument carries out absolute quantitation to diluted sample.Simultaneously using the real-time quantitative fluorescence PCR test method detection times of embodiment 1
Than the sample of dilution, with reference to absolute quantitation result, the Monitoring lower-cut of the real-time quantitative fluorescence PCR test method of embodiment 1 is determined.
As a result Fig. 2 and table 3 are seen.
The Monitoring lower-cut analysis of the fluorescence quantifying PCR method of table 3
The result of table 3 shows that fluorescent quantitative PCR detection method of the invention can detect concentration as little as 27.7copy/ul's
Sample.Fig. 2 is uses bio-rad digital pcr instrument absolute quantitations after 4 times of doubling dilutions of sample, gradient dilution sample concentration is with diluting
There are notable linear relationship, absolute quantitation reliable results between multiple.
Embodiment described above only expresses the several embodiments of the present invention, and its description is more specific and detailed, but simultaneously
Therefore the limitation to the scope of the claims of the present invention can not be interpreted as.It should be pointed out that for one of ordinary skill in the art
For, without departing from the inventive concept of the premise, various modifications and improvements can be made, these belong to the guarantor of the present invention
Protect scope.Therefore, the protection domain of patent of the present invention should be determined by the appended claims.
Claims (2)
1. a kind of kit of detection Echovirus30 viruses, it is characterised in that include：Detect Echovirus30 viruses
Specific primer, the specific primer is respectively by SEQ ID NO:2 and SEQ ID NO:Base composition shown in 3；
With the probe of detection Echovirus30 viruses, the probe is by SEQ ID NO:Base composition shown in 4；
5' ends band fluorophor FAM, the 3' ends band quenching group TAMRA of the probe.
2. the kit of detection Echovirus30 viruses according to claim 1, it is characterised in that it is slow also to include reaction
Fliud flushing and enzyme reaction solution, the reaction buffer include dNTPs, MgCl2And stabilizer, the enzyme reaction solution include reverse transcription
Enzyme, thermal starting archaeal dna polymerase and RNase inhibitor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510320134.6A CN105002299B (en) | 2015-06-11 | 2015-06-11 | Detect specific primer, probe and the kit of Echovirus30 viruses |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201510320134.6A CN105002299B (en) | 2015-06-11 | 2015-06-11 | Detect specific primer, probe and the kit of Echovirus30 viruses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN105002299A CN105002299A (en) | 2015-10-28 |
| CN105002299B true CN105002299B (en) | 2018-03-27 |
Family
ID=54375160
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201510320134.6A Active CN105002299B (en) | 2015-06-11 | 2015-06-11 | Detect specific primer, probe and the kit of Echovirus30 viruses |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN105002299B (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN111153989B (en) * | 2020-01-15 | 2020-09-15 | 江苏省疾病预防控制中心(江苏省公共卫生研究院) | Preparation and application of Echo30 monoclonal antibody |
-
2015
- 2015-06-11 CN CN201510320134.6A patent/CN105002299B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| 《人类埃可病毒30型中国分离株的基因特征分析》;田炳均等;《中国病毒病杂志》;20130731;第3卷(第4期);第268-269页 * |
| 《肠道病毒71型荧光RT-PCR检测方法的建立及评价》;于贺娟;《中国优秀硕士学位论文全文数据库电子期刊（医药卫生科技辑）》;20110615(第6期);第13-14、20和29-30页 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN105002299A (en) | 2015-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN112063756B (en) | Method and kit for multiple detection of respiratory virus nucleic acid | |
| CN111270013A (en) | Multiplex real-time fluorescent quantitative PCR (polymerase chain reaction) kit and method for detecting 2019 novel coronavirus and primer probe composition | |
| CN103275862B (en) | Fluorescent quantitative reverse transcription-polymerase chain reaction (RT-PCR) kit for detecting influenza A virus subtype H7N9 | |
| Yang et al. | Development of real-time and lateral flow strip reverse transcription recombinase polymerase Amplification assays for rapid detection of peste des petits ruminants virus | |
| Yu et al. | Development of a real-time reverse transcription loop-mediated isothermal amplification method for the rapid detection of porcine epidemic diarrhea virus | |
| CN110157839A (en) | Quadruple fluorescence quantitative detection kit that is a kind of while detecting four kinds of human corona virus | |
| CN104561377A (en) | Real-time fluorescent multiplex PCR (polymerase chain reaction) based kit for rapidly detecting common respiratory pathogens | |
| CN111500776A (en) | Novel coronavirus 2019-nCoV fluorescent RPA detection primer, probe, kit and method | |
| CN110144422A (en) | The quadruple fluorescence quantitative detection kit of four kinds of human corona virus is detected simultaneously | |
| CN107151711B (en) | Dual fluorescent quantitative RT-PCR kit for detecting dengue virus and Zika virus | |
| CN103642945B (en) | A kind of highly sensitive Epstein-Barr FLuorescent quantitative PCR kit containing internal reference | |
| CN106048094B (en) | Dual real-time fluorescent quantitative PCR (polymerase chain reaction) detection kit, primers and probe for porcine pseudorabies wild strains and gene-deleted strains | |
| CN105624329B (en) | Herpes simplex virus type 1 real-time fluorescence nucleic acid isothermal amplification detection kit | |
| CN105525040A (en) | Real-time fluorescent RPA kit and test strip RPA kit for rapid detection of porcine type 2 circovirus and application of real-time fluorescent RPA kit and test strip RPA kit | |
| CN103866034A (en) | Multiple real-time fluorescence quantification PCR (polymerase chain reaction) detection kit and detection method for helicobacter pylori in gastric juice | |
| CN103571961B (en) | Method, primer pair, target probe, internal standard probe and kit for detecting Cronobacter sakazakii | |
| CN113005226A (en) | Oligonucleotide and kit for detecting SARS-CoV-2 | |
| CN106148506A (en) | The antenatal detection kit of a kind of B race streptococcus quantitative fluorescent PCR and application thereof | |
| CN103614489A (en) | Constant-temperature amplification detection kit for dengue viruses and detection method | |
| CN105779625B (en) | It is a kind of to detect that Streptococcus suis is universal and streptococcus suis 2-type double fluorescent quantitative PCR primer, kit and method simultaneously | |
| CN105603123A (en) | Real-time fluorescence RPA reagent kit and test strip RPA reagent kit for rapidly detecting porcine parvovirus and application of reagent kits | |
| CN113652505A (en) | Method and kit for detecting novel coronavirus and VOC-202012/01 mutant strain thereof | |
| CN103333903A (en) | Target sequence, primer and probe for detecting helicobacter pylori and kit thereof | |
| Mo et al. | Validation of specific quantitative real-time RT-PCR assay panel for Infectious Bronchitis using synthetic DNA standards and clinical specimens | |
| CN101363063A (en) | Primer, probe, kit and method for detecting A, B and H5 subtype influenza virus by triple fluorescent quantitative RT-PCR |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant | ||
| TR01 | Transfer of patent right |
Effective date of registration: 20210603 Address after: 201499 1302, 1303, 1304, 1305, 1306, 1307, 1309 rooms 3 building 1588, Shanghai Hangzhou highway, Fengxian District, Shanghai. Patentee after: SHANGHAI BOJIE MEDICAL TECHNOLOGY Co.,Ltd. Address before: 510000 160 Qunxian Road, Dashi Town, Panyu District, Guangzhou City, Guangdong Province Patentee before: CENTRE FOR DISEASE CONTROL AND PREVENTION OF GUANGDONG PROVINCE Patentee before: GUANGDONG PROVINCIAL INSTITUTE OF PUBLIC HEALTH |
|
| TR01 | Transfer of patent right | ||
| CP01 | Change in the name or title of a patent holder |
Address after: 201499 1302, 1303, 1304, 1305, 1306, 1307, 1309 rooms 3 building 1588, Shanghai Hangzhou highway, Fengxian District, Shanghai. Patentee after: Shanghai Berger Medical Technology Co.,Ltd. Address before: 201499 1302, 1303, 1304, 1305, 1306, 1307, 1309 rooms 3 building 1588, Shanghai Hangzhou highway, Fengxian District, Shanghai. Patentee before: SHANGHAI BOJIE MEDICAL TECHNOLOGY CO.,LTD. |
|
| CP01 | Change in the name or title of a patent holder |