CN113755640A - RT-CPA (reverse transcription-positive amplification) detection primer and kit for porcine epidemic diarrhea virus - Google Patents
RT-CPA (reverse transcription-positive amplification) detection primer and kit for porcine epidemic diarrhea virus Download PDFInfo
- Publication number
- CN113755640A CN113755640A CN202110805347.3A CN202110805347A CN113755640A CN 113755640 A CN113755640 A CN 113755640A CN 202110805347 A CN202110805347 A CN 202110805347A CN 113755640 A CN113755640 A CN 113755640A
- Authority
- CN
- China
- Prior art keywords
- cpa
- detection
- diarrhea virus
- porcine epidemic
- epidemic diarrhea
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- General Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Analytical Chemistry (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- General Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Virology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides an RT-CPA detection primer and a kit for porcine epidemic diarrhea virus, belonging to the technical field of porcine epidemic diarrhea virus detection reagents. The detection primer comprises N-CPF, N-CPR, N-F, N-R, N-DF and N-DR, and the kit comprises the detection primer, Reaction Buffer, Bst DNA/RNA polymerase, dNTPs, Betaine, MgSO4 and nucleic acid detection test paper. The RT-CPA detection primer for the porcine epidemic diarrhea virus provided by the invention is designed aiming at the conserved sequence of the N gene of PEDV, has stronger specificity and can effectively detect the porcine epidemic diarrhea virus; the kit preferably selects Bst DNA/RNA polymerase which can be directly suitable for RNA to carry out isothermal amplification reaction, simplifies the detection process and shortens the detection time to within one hour; the method is simple to operate, does not depend on professional detection personnel, has low requirement on instruments, is easy to judge detection results, has higher sensitivity, can detect PEDV of 10 copies/mu L, and is very suitable for rapid detection of PEDV of various prevention and control units and various farms.
Description
Technical Field
The invention relates to the technical field of a porcine epidemic diarrhea virus detection reagent, and particularly relates to an RT-CPA detection primer and a kit for detecting porcine epidemic diarrhea virus.
Background
Porcine Epidemic Diarrheal Virus (PEDV), a single-stranded positive-stranded RNA virus of the genus alphacoronavirus of the family coronaviridae, can cause acute, highly contagious intestinal disease in pigs with watery diarrhea, vomiting, and dehydration as the major symptoms. Pigs of all ages are susceptible, and the mortality rate of infected fed piglets reaches 80-100%. The disease is prevalent worldwide, and is particularly serious in japan, korea, and china. The disease can lead sick piglets to die in large scale, and the sick fattening pigs get leaner day by day, and even if the sick fattening pigs get well, the sick fattening pigs grow slowly and even become cad pigs. Meanwhile, the sick pigs have the possibility of secondary infection, the breeding risk is increased, and the slaughtering rate of the live pigs is greatly reduced. The disease seriously harms the pig industry and causes serious economic loss.
The primary task of controlling PEDV propagation is to do the detection and monitoring of PEDs. Currently, conventional methods for detecting PED include methods such as electron microscope observation of virus particles, ELISA, indirect immunofluorescence, enzyme-linked immunosorbent assay, immune colloidal gold, reverse transcription PCR, fluorescent real-time quantitative PCR, and the like. The electron microscope observation of the virus particles firstly needs to separate the virus and then carries out the electron microscope observation, which takes long time and has complex process. ELISA, indirect immunofluorescence, enzyme-linked immunosorbent assay, reverse transcription PCR and fluorescence real-time quantitative PCR have the advantages of high sensitivity, strong specificity and the like, but higher test conditions, expensive instruments and professional technicians are needed, the operation is complex, the time is longer, the detection cost is high, and the general farms and basic units are difficult to develop. The above methods cannot meet the detection requirements of simplicity, rapidness and high sensitivity due to the respective characteristics and limitations. Early discovery, early diagnosis and molecular epidemiological investigation of PED are important means for controlling the epidemic of PED and reducing economic loss caused by PED morbidity. Therefore, it is very important to establish a simple, rapid and highly sensitive detection method and develop a PEDV detection kit suitable for field application.
Disclosure of Invention
The technical problems to be solved by the invention, the technical scheme adopted for solving the technical problems and the beneficial effects thereof are included.
The invention aims to provide an RT-CPA detection primer and a kit for porcine epidemic diarrhea virus, and the detection primer and the kit provided by the invention can be used for accurately, quickly and sensitively detecting the porcine epidemic diarrhea virus.
The technical scheme of the invention is as follows:
the invention provides an RT-CPA detection primer for detecting porcine epidemic diarrhea virus, which is specifically operated by designing three pairs of primers (a pair of stripping primers, a pair of cross primers and a pair of detection primers) aiming at a conserved region of an N gene of PEDV, adding BIOTIN BIOTIN at the 5 'end of an upstream detection primer and adding fluorescein FITC at the 5' end of a downstream detection primer, so that an amplification product carries a marker, and an amplification result can be detected by using a test strip capable of detecting the marker. The stripping primer comprises N-F and N-R, the cross primer comprises N-CPF and N-CPR, and the detection primer comprises N-DF and N-DR.
Preferably, the primer N-F nucleotide sequence is: 5'ATGGCTTCTGTCAGCTTTC 3'; the primer N-R nucleotide sequence is as follows: 5'GTTCAATTCGCTCACCACG 3'; the primer N-CPF nucleotide sequence is as follows: 5'TTTGCTCATTCCAGTATCC-CGGGTGCCATTATCCCTCTAT 3'; the primer N-CPR nucleotide sequence is as follows: 5'CGGGTGCCATTATCCCTCTAT-TTTGCTCATTCCAGTATCC 3'; the primer N-DF nucleotide sequence is as follows: 5'- (BIOTIN) GCCCCTCTTAGGGTTACT 3'; the primer N-DR nucleotide sequence is as follows: 5'- (FITC) AATTTGCTGGTCCTTATTTC 3';
the invention provides an RT-CPA detection kit for porcine epidemic diarrhea virus, which comprises the RT-CPA detection primer for porcine epidemic diarrhea virus.
Preferably, the kit further comprises Bst DNA/RNA polymerase, dNTPs, Reaction Buffer, MgSO4And Betaine.
Preferably, the kit further comprises a nucleic acid detection test strip.
Preferably, when the RT-CPA detection primer is used, the amplification system comprises every 20 mu L: reaction Buffer 2.0 μ L, N-CPF, N-CPR each 1.0 μ M, N-F, N-R each 0.5-1.0 μ M, N-DF, N-DR each 0.2-1.2 μ M, MgSO40.6-2.0 mM, 0.6-1.6 mM dNTPs, 0.2-1.4M beta-nine, 1.0-8.0U Bst DNA/RNA polymerase, 1 muL template RNA, and ddH2O to 20 muL.
Preferably, the amplification system comprises, per 20 μ L: reaction Buffer 2.0. mu.L, N-CPF, N-CPR each 1.0. mu.M, N-F, N-R each 0.7. mu.M, N-DF, N-DR each 0.6. mu.M, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase 1.6U, template RNA 1. mu.L, ddH2O to 20. mu.L.
Preferably, the amplification conditions include: reacting at 57-65 deg.C for 15-90 min, and inactivating at 85 deg.C for 2 min.
Preferably, the amplification conditions include: reacting at 61 deg.C for 60min, and inactivating at 85 deg.C for 2 min.
The invention has the beneficial effects that:
1. the specificity is good, and the porcine epidemic diarrhea virus can be quickly and effectively detected;
2. the operation is simple, professional detection personnel are not required, the requirement on the instrument is low, and only one metal bath or constant temperature device is needed;
3. the method is accurate and rapid, PEDV of 10 copies/mu L can be detected, and the detection time can be shortened to be within one hour;
4. the detection result is easy to judge, simple and visual. (the nucleic acid test strip has a quality control line and a detection line, and the test strip shows a positive result when red lines appear at the quality control line and the detection line.)
In conclusion, the RT-CPA detection primer and the kit for detecting the porcine epidemic diarrhea virus have good application prospects, and can be applied to various prevention and control units and various types of farms and farmers in China.
Drawings
FIG. 1 shows the optimization of concentration and proportion of different primers in the porcine epidemic diarrhea virus RT-CPA detection kit, and the pictures from right to left are Marker, 1), 2), 3), 4), 5), 6) samples with different concentrations of primers,
1) N-CPF/R: 1.0. mu.M each, N-F/R: 0.5. mu.M each, N-DF/R: each of which is 0.2 mu M,
2) N-CPF/R: 1.0. mu.M each, N-F/R: 0.6. mu.M each, N-DF/R: each of which is 0.4. mu.M,
3) N-CPF/R: 1.0. mu.M each, N-F/R: 0.7. mu.M each, N-DF/R: each of which is 0.6 mu M,
4) N-CPF/R: 1.0. mu.M each, N-F/R: 0.8. mu.M each, N-DF/R: each of which is 0.8 mu M,
5) N-CPF/R: 1.0. mu.M each, N-F/R: 0.9. mu.M each, N-DF/R: at a rate of 1.0. mu.M each,
6) N-CPF/R: 1.0. mu.M each, N-F/R: 1.0. mu.M each, N-DF/R: 1.2. mu.M each;
FIG. 2 shows MgSO (MgSO) with different concentrations in porcine epidemic diarrhea virus RT-CPA detection kit4The optimization of (1) is that the Marker and 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8 and 2.0mM MgSO 1 from right to left4A sample;
FIG. 3 is the optimization of dNTPs with different concentrations in the porcine epidemic diarrhea virus RT-CPA detection kit, from right to left are Marker and 0.6, 0.8, 1.0, 1.2, 1.4, 1.6mM dNTPs samples respectively;
FIG. 4 is the optimization of Betae in different concentrations in the porcine epidemic diarrhea virus RT-CPA detection kit, from left to right are Marker and 0.2, 0.4, 0.6, 0.8, 1.0, 1.2, 1.4mM Betae samples respectively;
FIG. 5 shows the optimization of Bst DNA/RNA polymerase with different concentrations in the porcine epidemic diarrhea virus RT-CPA detection kit, from right to left are Marker and Bst DNA/RNA polymerase samples of 1.0, 1.6, 3.2, 4.8, 6.4 and 8.0U, respectively;
FIG. 6 shows the optimization of different reaction temperatures in the porcine epidemic diarrhea virus RT-CPA detection kit, from left to right, the Marker and the reaction temperatures of 59 deg.C, 61 deg.C, 63 deg.C, and 65 deg.C, respectively;
FIG. 7 is the optimization of different reaction times in the porcine epidemic diarrhea virus RT-CPA detection kit, from right to left are Marker and reaction times of 15min, 30min, 45min, 60min and 75min respectively;
FIG. 8 is a schematic diagram showing specificity of the porcine epidemic diarrhea virus RT-CPA detection kit and detection results, wherein the samples are PEDV, TGEV, RV, Escherichia coli and blank control (H2O) from right to left;
FIG. 9 shows the detection sensitivity of the porcine epidemic diarrhea virus RT-CPA detection kit, wherein the standard plasmid concentration of the porcine epidemic diarrhea virus from left to right of the sample is 109copies/μL、108copies/μL、107copies/μL、106copies/μL、105copies/μL、104copies/μL、103copies/μL、102copies/μL、101copies/μL、100copies/. mu.L, blank control (H2O).
Detailed Description
The invention provides an RT-CPA detection primer of porcine epidemic diarrhea virus, which comprises N-F, N-R, N-CPF, N-CPR, N-DF and N-DR.
In the present invention, the N-F nucleotide sequence is: 5'ATGGCTTCTGTCAGCTTTC 3';
in the present invention, the N-R nucleotide sequence is: 5'GTTCAATTCGCTCACCACG 3';
in the present invention, the N-CPF nucleotide sequence is: 5'TTTGCTCATTCCAGTATCCCGGGTGCCATTATCCC TCTAT 3';
in the present invention, the N-CPR nucleotide sequence is: 5'CGGGTGCCATTATCCCTCTAT TTTGCTCATTCCA GTATCC 3';
in the present invention, the N-DF nucleotide sequence is: 5'- (BIOTIN) GCCCCTCTTAGGGTTACT 3';
in the present invention, the N-DR nucleotide sequence is: 5'- (FITC) AATTTGCTGGTCCTTATTTC 3';
in the invention, the N-CPF and the N-CPR are cross primers, the N-F and the N-R are stripping primers, and the N-DF and the N-DR are detection primers. In the invention, the RT-CPA detection primer takes a section of conserved region (205bp) in the N gene (JX406145.1) sequence of PEDV strain published by GenBank as a template to design the RT-CPA primer, and utilizes the RT-CPA technology to amplify the specific region of a target gene and rapidly detect the porcine epidemic diarrhea virus from the molecular level, thus having the characteristics of simplicity, rapidness, high specificity and sensitivity.
In the present invention, when the RT-CPA detection primer is used, the amplification system preferably comprises, per 20. mu.L: reaction Buffer 2.0 μ L, N-CPF, N-CPR each 1.0 μ M, N-F, N-R each 0.5-1.0 μ M, N-DF, N-DR each 0.2-1.2 μ M, MgSO40.6-2.0 mM, 0.6-1.6 mM dNTPs, 0.2-1.4 mM beta ine, 1-8.0U Bst DNA/RNA polymerase, 1 mu L template RNA, and ddH2O to 20 mu L; more preferably, the reagent Buffer 2.0. mu.L, N-CPF, N-CPR each 1.0. mu.M, N-F, N-R each 0.7. mu.M, N-DF, N-DR each 0.6. mu.M, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6M, Bst DNA/RNA polymerase 1.6U, template RNA 1. mu.L, ddH2O to 20. mu.L.
In the present invention, the amplification conditions preferably include: reacting at 57-65 ℃ for 15-90 min, and then inactivating at 85 ℃ for 2 min; more preferably, the method comprises reacting at 63 deg.C for 60min, and inactivating at 85 deg.C for 2 min.
The invention also provides a kit for detecting the porcine epidemic diarrhea virus, which comprises the RT-CPA detection primer in the technical scheme.
In the present invention, the kit preferably further comprises Reaction Buffer, Bst DNA/RNA polymerase, dNTPs, Betaine, MgSO4. The reagent source of the kit is not particularly limited in the invention, and the kit can be prepared by adopting a conventional commercial product. The amount of the reagent in the kit is not particularly limited, and the amount of the reagent in the conventional kit can be adopted.
In the present invention, the kit further preferably comprises a nucleic acid detection test strip purchased from yogzhou jisda, and having a model number of: d003-03.
In the present invention, the method of using the kit preferably comprises: amplifying by adopting the amplification system and the amplification conditions to obtain an amplification product;
when the nucleic acid detection test strip is not used for detection, an amplification product is taken, 1.0% (W/V) agarose gel electrophoresis is carried out, the amplification product is placed in a gel imaging system for imaging, an electrophoresis picture displays an RT-CPA characteristic ladder-shaped strip, and the result is positive; if no band exists, the result is negative;
when the nucleic acid detection test strip is used for detection, an amplification product is taken and detected by the nucleic acid detection test strip, and only one red line appears in the quality control area C, which indicates that the detection result of the sample is negative; two red lines appear, one detection line and one quality control line represent that the detection result of the sample is positive; no red line appears in the quality control area C and the detection area T, which indicates that the nucleic acid detection test strip is invalid and the detection result is invalid.
The technical solutions provided by the present invention are described in detail below with reference to examples, but they should not be construed as limiting the scope of the present invention.
Example 1
A porcine epidemic diarrhea virus RT-CPA detection kit comprises: reaction Buffer; bst DNA/RNA polymerase (NEB); dNTPs; MgSO (MgSO)4(ii) a Betaine (sigma); crossed primers N-CPF and N-CPR; stripping primer N-F, N-R; detecting primers N-DF and N-DR; a nucleic acid detection test strip.
N-CPF：5'TTTGCTCATTCCAGTATCCCGGGTGCCATTATCCCTCTAT 3'；
N-CPR：5'CGGGTGCCATTATCCCTCTATTTTGCTCATTCCAGTATCC3'；
N-F：5'ATGGCTTCTGTCAGCTTTC 3'；
N-R：5'GTTCAATTCGCTCACCACG3'；
N-DF：5'BIOTIN-GCCCCTCTTAGGGTTACT 3'；
N-DR：5'FITC3-AATTTGCTGGTCCTTATTTC3'。
Example 2
Optimization of concentration and proportion of different primers in porcine epidemic diarrhea virus RT-CPA detection kit
Extraction of total RNA of porcine epidemic diarrhea virus
Collecting cell venom of porcine epidemic diarrhea virus, centrifuging at 4 ℃ for 30min at 5000r/min, collecting supernatant, extracting porcine epidemic diarrhea virus RNA from the collected supernatant by using a ThermoFisher RNA extraction kit, performing specific operation steps according to kit instructions, and storing the extracted RNA at-20 ℃ for later use.
Secondly, configuring an RT-CPA amplification reaction system
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: viral RNA template 1. mu.L, Reaction Buffer 2.0. mu.L, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase 1.6U, N-CPF/R, N-F/R, N-DF/R, nuclease-free water to 20. mu.L. Wherein, the cross primers (N-CPF and N-CPR), the stripping primer (N-F, N-R), the detection primers (N-DF and N-DR) adopt different concentration ratios:
1) N-CPF/R: 1.0. mu.M each, N-F/R: 0.5. mu.M each, N-DF/R: 0.2. mu.M each
2) N-CPF/R: 1.0. mu.M each, N-F/R: 0.6. mu.M each, N-DF/R: 0.4. mu.M each
3) N-CPF/R: 1.0. mu.M each, N-F/R: 0.7. mu.M each, N-DF/R: 0.6. mu.M each
4) N-CPF/R: 1.0. mu.M each, N-F/R: 0.8. mu.M each, N-DF/R: 0.8. mu.M each
5) N-CPF/R: 1.0. mu.M each, N-F/R: 0.9. mu.M each, N-DF/R: each 1.0. mu.M
6) N-CPF/R: 1.0. mu.M each, N-F/R: 1.0. mu.M each, N-DF/R: each 1.2. mu.M
Reaction conditions for three, RT-CPA amplification
The reaction tubes were incubated at 61 ℃ for 60min and inactivated at 85 ℃ for 2 min.
Fourthly, judging the detection result
Taking 10 mu L of amplification product, carrying out electrophoresis by using 1.0% agarose gel, and then placing the amplification product in a gel imaging system for imaging, wherein an electrophoresis picture (figure 1) shows the concentration of the primer, and the combination 3 has the best amplification effect, namely: N-CPF/R: 1.0. mu.M each, N-F/R: 0.7. mu.M each, N-DF/R: 0.6. mu.M each.
Example 3
MgSO (MgSO) with different concentrations in porcine epidemic diarrhea virus RT-CPA (reverse transcription-positive amplification) detection kit4Is optimized
Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
Secondly, configuring a reaction system for RT-CPA amplification
Preparing reaction solution according to 20 μ L RT-CPA amplification reaction system, specificallyThe following: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO4dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase 1.6U, nuclease-free water to 20. mu.L.
Wherein MgSO4Are 0.6, 0.8, 1.0, 1.2, 1.4, 1.6, 1.8, 2.0mM, respectively.
Reaction conditions for three, RT-CPA amplification
The reaction tubes were incubated at 61 ℃ for 60min and inactivated at 85 ℃ for 2 min.
Fourthly, judging the detection result
mu.L of the amplification product was electrophoresed through a 1.0% agarose gel and imaged on a gel imaging system, and the electrophoretogram (FIG. 2) showed the best results at a concentration of 1.2mM MgSO 4.
Example 4
Optimization of dNTPs with different concentrations in porcine epidemic diarrhea virus RT-CPA detection kit
Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
Secondly, configuring a reaction system for RT-CPA amplification
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO41.2mM, dNTPs, Betainee 0.6mM, Bst DNA/RNA polymerase 1.6U, no nuclease water make up to 20. mu.L.
Wherein the concentration of dNTPs is 0.6, 0.8, 1.0, 1.2, 1.4 and 1.6mM respectively.
And thirdly, the reaction conditions of RT-CPA amplification are as follows:
the reaction tubes were incubated at 63 ℃ for 60min and inactivated at 85 ℃ for 2 min.
Fourthly, judging the detection result:
mu.L of the amplified product was electrophoresed through a 1.0% agarose gel and imaged in a gel imaging system, and the best results were shown in the electrophoresed picture (FIG. 3) when the concentration of dNTPs was 1.0 mM.
Example 5
Optimization of different concentrations of beta-amine in porcine epidemic diarrhea virus RT-CPA detection kit
Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
Secondly, configuring a reaction system for RT-CPA amplification
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO41.2mM, dNTPs 1.0mM, Betaine, Bst DNA/RNA polymerase 1.6U, nuclease-free water to 20. mu.L.
Wherein the concentration of Betaine is 0.2, 0.4, 0.6, 0.8, 1.0, 1.2 and 1.4mM respectively.
Reaction conditions for three, RT-CPA amplification
The reaction tubes were incubated at 63 ℃ for 60min and inactivated at 85 ℃ for 2 min.
Fourthly, judging the detection result
mu.L of the amplification product was electrophoresed through a 1.0% agarose gel and imaged in a gel imaging system, and the best results were shown in the electrophoresed picture (FIG. 4) when the concentration of Betaine was 0.6 mM.
Example 6
Optimization of Bst DNA/RNA polymerase with different concentrations in porcine epidemic diarrhea virus RT-CPA detection kit
Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
Secondly, configuring a reaction system for RT-CPA amplification
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase, and nuclease-free water to 20. mu.L.
Wherein the concentration of Bst DNA polymerase is 1.0, 1.6, 3.2, 4.8, 6.4 and 8.0U respectively.
And thirdly, the reaction conditions of RT-CPA amplification are as follows:
the reaction tubes were incubated at 63 ℃ for 60min and inactivated at 85 ℃ for 2 min.
Fourthly, judging the detection result:
mu.L of the amplification product was electrophoresed through 1.0% agarose gel and imaged on a gel imaging system, and the best results were shown in the electrophoresed picture (FIG. 5) at a Bst concentration of 1.6U.
Example 7
Optimization of different reaction temperatures in porcine epidemic diarrhea virus RT-CPA detection kit
Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
Secondly, configuring a reaction system for RT-CPA amplification
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase 1.6U, nuclease-free water to 20. mu.L.
Reaction conditions for three, RT-CPA amplification
The reaction tubes were incubated at 59 deg.C, 61 deg.C, 63 deg.C, 65 deg.C for 60min, and inactivated at 85 deg.C for 2 min.
Fourthly, judging the detection result
mu.L of the amplification product was electrophoresed through 1.0% agarose gel and imaged in a gel imaging system, and the electrophoresis picture (FIG. 6) showed that the best results were obtained at a reaction temperature of 61 ℃.
Example 8
Optimization of different reaction times in porcine epidemic diarrhea virus RT-CPA detection kit
Extraction of total RNA of porcine epidemic diarrhea virus
The procedure is as in example 2.
Secondly, configuring a reaction system for RT-CPA amplification
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase 1.6U, nuclease-free water to 20. mu.L.
And thirdly, the reaction conditions of RT-CPA amplification are as follows:
the reaction tube is placed at 63 ℃ and is inactivated for 2min at 85 ℃ after being respectively incubated for 15min, 30min, 45min, 60min and 75 min.
Fourthly, judging the detection result:
mu.L of the amplification product was electrophoresed through 1.0% agarose gel and imaged in a gel imaging system, and the best result was shown in the electrophoresis picture (FIG. 7) at a reaction temperature of 60 min.
Example 9
Specificity test of porcine epidemic diarrhea virus RT-CPA detection kit
PEDV, TGEV, RV and Escherichia coli are detected according to the optimized porcine epidemic diarrhea virus RT-CPA detection kit in the examples 2, 3, 4, 5, 6, 7 and 8, and a blank control is set.
Extraction of Total viral RNA
Collecting cell venom of PEDV, TGEV and RV, repeatedly freezing and thawing at-80 ℃ to room temperature for 3 times, centrifuging at 5000r/min for 30min, collecting supernatant, extracting total RNA of the virus from the collected supernatant by using a ThermoFisher DNA/RNA extraction kit, performing specific operation steps according to kit instructions, and storing the extracted total RNA of the virus at-20 ℃ for later use. Coli was directly detected using bacterial suspension (109CFU/mL) as a template.
Secondly, configuring a reaction system for RT-CPA amplification
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase 1.6U, nuclease-free water to 20. mu.L.
Reaction conditions for three, RT-CPA amplification
The reaction tubes were incubated at 63 ℃ for 60min and inactivated at 85 ℃ for 2 min.
Fourthly, judging the detection result
And (3) detecting by using a nucleic acid detection test strip, dropwise adding 5-8 mu L of an amplification product to the lower end of the test strip, dropwise adding 100 mu L of a buffer solution (Hangzhou Yosidao company), and observing the result after 15-30 min. The nucleic acid detection test strip shows that the specific RT-CPA primer group designed for PEDV can ensure the specific detection of PEDV, only the PEDV is detected to be positive, and TGEV, RV, Escherichia coli and blank control (water) are all negative (figure 8).
Example 10
Sensitivity test of porcine epidemic diarrhea virus RT-CPA detection kit
Construction of Standard recombinant plasmid
Extracting total RNA of PEDV, carrying out reverse transcription PCR amplification on the full-length sequence of the N gene (JX406145.1) of the PEDV, cloning to a pMD19-T plasmid, verifying, and naming the recombinant plasmid verified to be correct as pMD 19-T-N. Purification of recombinant plasmid, determination of plasmid concentration, calculation of plasmid copy number, and adjustment of standard plasmid concentration to 10 with pure water10copies/. mu.L. In the sensitivity measurement, standard plasmids were diluted with pure water in 10-fold gradient to give a plasmid concentration in the range of 109copies/μL～100copies/. mu.L, as template for CPA reaction.
Secondly, configuring a reaction system for RT-CPA amplification
The reaction solution is prepared according to a 20-mu-L RT-CPA amplification reaction system, and the details are as follows: 1. mu.L of viral RNA template, 2.0. mu.L of Reaction Buffer, 1.0. mu.M each of N-CPF/R, 0.7. mu.M each of N-F/R, 0.6. mu.M each of N-DF/R, MgSO41.2mM, dNTPs 1.0mM, Betaine0.6mM, Bst DNA/RNA polymerase 1.6U, nuclease-free water to 20. mu.L.
Reaction conditions for three, RT-CPA amplification
The reaction tubes were incubated at 63 ℃ for 60min and inactivated at 85 ℃ for 2 min.
Fourthly, judging the detection result
And (3) detecting by using a nucleic acid detection test strip, dropwise adding 5-8 mu L of an amplification product to the lower end of the test strip, dropwise adding 100 mu L of a buffer solution (Hangzhou Yosidao company), and observing the result after 15-30 min. The nucleic acid test strip showed that 10 copies/. mu.L of the standard recombinant plasmid could be detected (FIG. 9).
The above examples are only preferred embodiments of the present invention, but the embodiments of the present invention are not limited by the above examples, and other modifications and decorations without departing from the principle of the present invention should be regarded as the protection scope of the present invention.
Claims (8)
1. An RT-CPA primer for detecting porcine epidemic diarrhea virus, which is characterized by comprising N-F, N-R, N-CPF, N-CPR, N-DF and N-DR;
the N-F nucleotide sequence is as follows: 5'ATGGCTTCTGTCAGCTTTC 3';
the N-R nucleotide sequence is as follows: 5'GTTCAATTCGCTCACCACG 3';
the N-CPF nucleotide sequence is as follows: 5'TTTGCTCATTCCAGTATCCCGGGTGCCATTATCCCTCTAT 3';
the N-CPR nucleotide sequence is as follows: 5'CGGGTGCCATTATCCCTCTAT TTTGCTCATTCCAGTATCC 3';
the N-DF nucleotide sequence is as follows: 5'- (BIOTIN) GCCCCTCTTAGGGTTACT 3';
the N-DR nucleotide sequence is: 5'- (FITC) AATTTGCTGGTCCTTATTTC 3'.
2. The RT-CPA primer for detecting the porcine epidemic diarrhea virus of claim 1, wherein the RT-CPA detection primer is used in an amplification system comprising every 20 μ L: reaction Buffer 2.0 μ L, N-CPF, N-CPR each 1.0 μ M, N-F, N-R each 0.5-1.0 μ M, N-DF, N-DR each 0.2-1.2 μ M, MgSO40.6-2.0 mM, 0.6-1.6 mM dNTPs, 0.2-1.4M beta-nine, 1.0-8.0U Bst DNA/RNA polymerase, 1 muL template RNA, and ddH2O to 20 muL.
3. The RT-CPA primer for detecting porcine epidemic diarrhea virus of claim 2, wherein the amplification system comprises per 20 μ L: reaction Buffer 2.0. mu.L, N-CPF, N-CPR each 1.0. mu.M, N-F, N-R each 0.7. mu.M, N-DF, N-DR each 0.6. mu.M, MgSO41.2 mM, dNTPs 1.0mM, Betaine0.6M, Bst DNA/RNA polymerase 1.6U, template RNA 1. mu.L, ddH2O to 20. mu.L.
4. The RT-CPA primer for detecting porcine epidemic diarrhea virus according to claim 2 or 3, wherein the amplification conditions comprise: reacting at 57-65 deg.C for 15-90 min, and inactivating at 85 deg.C for 2 min.
5. The RT-CPA primer for detecting porcine epidemic diarrhea virus of claim 4, wherein the amplification conditions comprise: reacting at 63 deg.C for 60min, and inactivating at 85 deg.C for 2 min.
6. An RT-CPA kit for detecting porcine epidemic diarrhea virus, comprising the RT-CPA detection primer of claim 1.
7. The RT-CPA kit for detecting porcine epidemic diarrhea virus of claim 6, wherein the kit further comprises Bst DNA/RNA polymerase (the enzyme is suitable for isothermal amplification Reaction of RNA, and can detect RNA molecules with low sensitivity), dNTPs, Reaction Buffer, MgSO4 and Betaine.
8. The RT-CPA kit for detecting the porcine epidemic diarrhea virus of claim 6, wherein the kit further comprises a nucleic acid detection test strip.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110805347.3A CN113755640B (en) | 2021-07-16 | 2021-07-16 | RT-CPA detection primer and kit for porcine epidemic diarrhea virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110805347.3A CN113755640B (en) | 2021-07-16 | 2021-07-16 | RT-CPA detection primer and kit for porcine epidemic diarrhea virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113755640A true CN113755640A (en) | 2021-12-07 |
| CN113755640B CN113755640B (en) | 2023-10-13 |
Family
ID=78787687
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110805347.3A Active CN113755640B (en) | 2021-07-16 | 2021-07-16 | RT-CPA detection primer and kit for porcine epidemic diarrhea virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113755640B (en) |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609695A (en) * | 2018-12-29 | 2019-04-12 | 华南农业大学 | Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus |
-
2021
- 2021-07-16 CN CN202110805347.3A patent/CN113755640B/en active Active
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN109609695A (en) * | 2018-12-29 | 2019-04-12 | 华南农业大学 | Detect the RPA-LED visualizing agent box of Porcine epidemic diarrhea virus |
Non-Patent Citations (2)
| Title |
|---|
| FENG-XUE WANG等: "Reverse Transcription Cross-Priming Amplification–Nucleic Acid Test Strip for Rapid Detection of orcine Epidemic Diarrhea Virus", SCIENTIFIC REPORTS, vol. 6, pages 24702 * |
| 黄梦琦等: "交叉引物恒温扩增技术（CPA）研究进展", 民营科技, no. 9, pages 78 - 79 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113755640B (en) | 2023-10-13 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105420379A (en) | Real-time fluorescence quantification PCR detecting kit for cow mycoplasma and special primers and TaqMan probe thereof | |
| CN110760620A (en) | Classical swine fever virus and African classical swine fever virus dual-fluorescence PCR detection reagent, kit and detection method | |
| CN110951916A (en) | Primer and kit for detecting SADS-CoV based on real-time fluorescent reverse transcription recombinase polymerase nucleic acid amplification technology | |
| WO2020034317A1 (en) | Dual real-time fluorescent quantitative pcr detection reagent and reagent kit for seneca virus a and foot-and-mouth disease virus | |
| WO2022179494A1 (en) | Salmonella typhi detection kit, preparation method therefor and application thereof | |
| CN110735006A (en) | African swine fever TaqMan real-time fluorescent quantitative PCR (polymerase chain reaction) detection primer and kit | |
| CN105624329A (en) | Real-time fluorescence nucleic acid isothermal amplification detection kit for human herpesvirus 1 | |
| CN111471797B (en) | RT-RPA primer pair, probe, kit and detection method for detecting cat coronavirus | |
| CN111560471A (en) | Nucleic acid, kit and micro-drop digital PCR method for detecting infectious bovine rhinotracheitis virus | |
| CN113718045A (en) | DNA fragment, primer, probe and kit for detecting 4 kinds of Bordetella pertussis and specifically detecting Bordetella pertussis and application | |
| CN106435032B (en) | Duplex RT-PCR primer, kit and method for simultaneously amplifying North American type and European type porcine reproductive and respiratory syndrome viruses | |
| CN113249517A (en) | Primer, probe and kit for real-time fluorescent quantitative PCR (polymerase chain reaction) detection of bovine plague | |
| CN111471802A (en) | Porcine delta coronavirus rapid detection primer, kit and application thereof | |
| CN116814859A (en) | Primer probe composition, kit and method for identifying African swine fever virus genes I and II | |
| CN116656845A (en) | Triple fluorescent quantitative PCR detection kit for diagnosing brucella vaccine immunity and natural infection and detection method thereof | |
| CN114634996B (en) | Primer probe combination and kit for detecting bovine respiratory disease and application of primer probe combination and kit | |
| CN113755640B (en) | RT-CPA detection primer and kit for porcine epidemic diarrhea virus | |
| CN107058619A (en) | Bovine Respiratory Syncytial virus nano PCR detection kits and preparation method thereof | |
| CN109266786B (en) | E184L gene-based African swine fever virus detection kit and detection method | |
| CN114196784B (en) | RT-CPA detection primer and kit for transmissible gastroenteritis virus | |
| CN109136409B (en) | Kit and method for detecting African swine fever virus based on K196R gene | |
| CN111593137A (en) | Fluorescent quantitative PCR detection reagent and kit for African swine fever virus | |
| CN116515840B (en) | Kit and detection method for detecting bovine viral diarrhea virus type 3 | |
| CN108315480B (en) | Real-time fluorescent quantitative PCR primer, probe and kit for detecting tree shrew adenovirus | |
| CN110387437B (en) | Amplification method for detecting mouse encephalomyelitis virus RT-RPA and kit thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |