CN113755601A

CN113755601A - Melanoma molecular marker and application thereof in early diagnosis and treatment of melanoma

Info

Publication number: CN113755601A
Application number: CN202111202976.3A
Authority: CN
Inventors: 孔云; 杨志强; 崔明鹿; 张仙
Original assignee: Beijing Baiaosike Biomedical Technology Co ltd; Kangtai Medical Laboratory Service Hebei Co ltd
Current assignee: Beijing Baiaosike Biomedical Technology Co ltd; Kangtai Medical Laboratory Service Hebei Co ltd
Priority date: 2021-10-15
Filing date: 2021-10-15
Publication date: 2021-12-07

Abstract

The invention discloses a melanoma molecular marker and application thereof in early diagnosis and treatment of melanoma, wherein the melanoma molecular marker comprises miR-196a, miR-27a-5p and miR-27b-5p, and experimental verification shows that the molecular markers miR-196a, miR-27a-5p and miR-27b-5p have good diagnosis efficiency when being applied to the diagnosis of melanoma, and miR-196a, miR-27a-5p and miR-27b-5p have a synergistic treatment effect when being applied to the treatment of melanoma.

Description

Melanoma molecular marker and application thereof in early diagnosis and treatment of melanoma

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a melanoma molecular marker and application thereof in early diagnosis and treatment of melanoma, and more particularly relates to a melanoma molecular marker comprising miR-196a, miR-27a-5p and miR-27b-5 p.

Background

Cutaneous melanoma is the 12 th most common cancer worldwide, and is produced by malignant transformation of melanocytes, can occur in all parts of skin and mucous membranes, is easy to transfer, is highly invasive, and is highly malignant, resulting in high mortality. The diagnosis of melanoma is combined by clinical and pathological criteria, including physical examination, histopathological examination and imaging examination, however, patients have difficulty finding themselves early, sometimes not easily identified clinically with benign nevi, and difficulty diagnosing early due to its variable histological morphology, or only a small amount or even no visible pigment. Early stage treatment of melanoma is mainly surgical operation, and later stage treatment of melanoma comprises chemotherapy, targeted therapy and immunotherapy. Targeted therapy and immunotherapy currently significantly improve the survival of patients with advanced melanoma compared to chemotherapy alone, but both therapies are generally limited by drug resistance and do not have universal applicability, and the absolute survival of patients remains low (Hamid O, Robert C, Daud A, et al, five-year survival individuals for patients with advanced melanomas treated with pembrolizumab in KEYNE-001 [ J ]. antibiotics of Oncology,2019,30(4):582 and 588.), thus early diagnosis and early treatment are critical to improving the survival and quality of life of patients.

The biomarker is a biochemical index which can mark the change of the structure or function of a system, an organ, a tissue, a cell and a subcellular, or the change which is possible to happen, has very wide application in the field of biomedicine, and can be used for disease diagnosis, disease staging judgment or the evaluation of the safety and effectiveness of new drugs or new therapies in target populations. Biomarkers can objectively reflect normal physiological and pathological processes. In recent years, microRNA (micro RNA, miRNA) is a kind of endogenous non-coding small molecular RNA found in eukaryotes, exists in different organisms, is cut into pre-miRNA with stem-loop structure with the length of 70-100 nucleotides by pri-miRNA under the action of Drosha R Nase, and is cut into mature RNA with the length of 19-25 nucleotides, namely miRNA under the action of Dicer enzyme. Mature mirnas cause inhibition of mRNA translation by specifically complementing the 3 'untranslated region (3' UTR) of the target mRNA. miRNA has wide gene regulation function, the miRNA regulates about 30% of human gene functions according to statistics, participates in a series of life activities including cell proliferation and apoptosis, organ formation, hematopoietic process, development process and the like, has close relation with the generation, diagnosis, treatment, prognosis and the like of tumor, more than 50% of miRNA genes in the tumor are located in chromosome fragile sites or chromosome amplification, deletion or transposition regions, and compared with protein markers, miRNA expression abnormality occurs earlier, so the miRNA is more beneficial to early diagnosis and is more suitable to be used as a biomarker of tumor.

Therefore, it is important to the art to identify biomarkers that can be better used for melanoma diagnosis and treatment. In view of the above, the present invention screens miRNA markers associated with the occurrence and development of melanoma, and verifies the efficacy of the miRNA markers as a prediction marker and a therapeutic target of melanoma through relevant validation experiments.

Disclosure of Invention

The invention aims to provide a melanoma molecular marker and application thereof in early diagnosis and treatment of melanoma, wherein the molecular marker comprises miR-196a, miR-27a-5p and miR-27b-5p, and experimental verification shows that the combination of miR-196a, miR-27a-5p and miR-27b-5p has better diagnosis efficiency on melanoma and has a synergistic treatment effect.

The sequences of the molecular markers miR-196a, miR-27a-5p and miR-27b-5p disclosed by the invention can be inquired in a miRBase database (http:// microrna.sanger.ac.uk /), wherein the sequence of miR-196a is shown as SEQ ID NO:17, the sequence of miR-27a-5p is shown as SEQ ID NO:18, and the sequence of miR-27b-5p is shown as SEQ ID NO: 19;

sequence of miR-196 a:

GUGAAUUAGGUAGUUUCAUGUUGUUGGGCCUGGGUUUCUGAACACAACAACAUUAAACCACCCGAUUCAC(SEQ ID NO:17)

sequence of miR-27a-5 p:

AGGGCUUAGCUGCUUGUGAGCA(SEQ ID NO:18)

sequence of miR-27b-5 p:

AGAGCUUAGCUGAUUGGUGAAC(SEQ ID NO:19)

further, the miR-196a provided by the invention comprises miR-196a initial miRNA, miR-196a precursor miRNA and mature miR-196a, wherein the miR-196a initial miRNA is sheared and expressed in human cells to mature miR-196a, and the miR-196a precursor miRNA is sheared and expressed in human cells to mature miR-196 a. As a further preference, the miR-196a further comprises: and a sequence obtained by carrying out base modification on miR-196a or adding bases at two ends.

The above object of the present invention is achieved by the following technical solutions:

in a first aspect, the invention provides the use of a reagent for detecting a molecular marker in the preparation of a product for diagnosing melanoma.

Further, the molecular markers are miR-196a, miR-27a-5p and miR-27b-5 p.

Further, the reagent comprises a reagent for detecting the expression level of the molecular marker by reverse transcription PCR, real-time quantitative PCR, in-situ hybridization and a chip technology.

Further, the reagent for detecting the expression level of the molecular marker by reverse transcription PCR comprises a primer for specifically amplifying the molecular marker;

the reagent for detecting the expression level of the molecular marker through real-time quantitative PCR comprises a primer for specifically amplifying the molecular marker;

the reagent for detecting the expression level of the molecular marker by in situ hybridization comprises a probe that specifically recognizes the molecular marker.

Further, the sequence of a primer for specifically amplifying the molecular marker miR-196a is shown as SEQ ID NO 9-SEQ ID NO 10;

the sequence of a primer for specifically amplifying the molecular marker miR-27a-5p is shown as SEQ ID NO. 11-SEQ ID NO. 12;

the sequence of the primer for specifically amplifying the molecular marker miR-27b-5p is shown as SEQ ID NO 13-SEQ ID NO 14.

In a second aspect, the invention provides a product for diagnosing melanoma.

Further, the product comprises reagents for detecting the expression levels of the molecular markers miR-196a, miR-27a-5p and miR-27b-5 p;

preferably, the product comprises a chip, a kit;

more preferably, the chip comprises a solid phase carrier and a probe which is fixed on the solid phase carrier and specifically recognizes the molecular markers miR-196a, miR-27a-5p and miR-27b-5 p;

more preferably, the kit comprises primers, probes or chips which specifically bind to the molecular markers miR-196a, miR-27a-5p and miR-27b-5 p.

Further, the solid phase carrier includes plastic products, microparticles, membrane carriers and the like. The most common plastic products are small test tubes, beads and microplates made of polystyrene; the microparticles are microspheres or particles polymerized by high molecular monomers, and the diameter of the microparticles is mostly micron; the membrane carrier comprises microporous filter membranes such as nitrocellulose membrane, glass cellulose membrane and nylon membrane.

Further, the kit also comprises an RNA extraction reagent, a reverse transcription reagent, a fluorescent quantitative PCR reagent and an internal reference quantitative reagent;

preferably, the RNA extraction reagent comprises TrizolLS, absolute ethanol, chloroform, isopropanol, RNase-freewater;

preferably, the reverse transcription reagent comprises a reverse transcription primer, a reverse transcriptase, an RNase-freewater;

preferably, the fluorescent quantitative PCR reagent comprises forward primers and reverse primers of SYBR Green fluorescent quantitative PCR enzyme, RNase-freewater, cDNA, miR-196a, miR-27a-5p and miR-27b-5 p;

preferably, the internal reference quantification reagent comprises a primer specific for internal reference U6;

more preferably, the forward primer and the reverse primer of miR-196a, miR-27a-5p and miR-27b-5p are respectively shown in SEQ ID NO 9-SEQ ID NO 10, SEQ ID NO 11-SEQ ID NO 12 and SEQ ID NO 13-SEQ ID NO 14;

more preferably, the sequence of the specific primer of the internal reference U6 is shown as EQ ID NO:15-SEQ ID NO: 16.

Further, the application method of the product comprises the following steps:

(1) collecting a sample from a subject as an experimental group, and detecting the expression levels of miR-196a, miR-27a-5p and miR-27b-5p in the sample of the subject;

(2) taking a normal sample of non-melanoma as a control group, and detecting the expression levels of miR-196a, miR-27a-5p and miR-27b-5p in the normal sample of non-melanoma;

(3) and if the expression level of the miR-196a in the experimental group is higher than that of the miR-196a in the control group, and the expression levels of the miR-27a-5p and miR-27b-5p in the control group are lower than that of the miR-27a-5p and miR-27b-5p in the control group, judging that the subject is at risk of suffering from melanoma or has already developed the melanoma.

In a third aspect, the present invention provides a system for early screening of melanoma.

Further, the system comprises:

(1) melanoma evaluation device: comprises a control unit and a storage unit for assessing whether a subject has melanoma or a risk probability of having melanoma;

(2) information communication terminal apparatuses communicatively connected to each other: for providing data on the expression levels of the molecular markers miR-196a, miR-27a-5p, miR-27b-5p in a sample from the subject;

the control unit of the melanoma evaluation device includes four units:

1) a data receiving unit: the data are transmitted from the information communication terminal equipment and are used for receiving the data about the expression levels of the molecular markers miR-196a, miR-27a-5p and miR-27b-5p in the sample;

2) a discrimination value calculation unit: calculating a discrimination value based on discrimination of the expression levels of the molecular markers miR-196a, miR-27a-5p, miR-27b-5p in the sample received by the data receiving unit and the expression levels of the molecular markers miR-196a, miR-27a-5p, miR-27b-5p as explanatory variables stored in the storage unit;

3) discrimination value criterion evaluation unit: evaluating the occurrence risk of melanoma of the subject based on the discrimination value calculated by the discrimination value calculation unit;

4) an evaluation result transmitting unit: which transmits the evaluation result of the subject obtained by the discrimination value reference evaluation unit to the information communication terminal device.

In a fourth aspect, the present invention provides the use of a molecular marker in the preparation of a pharmaceutical composition for the treatment of melanoma.

Further, the molecular markers are miR-196a, miR-27a-5p and miR-27b-5 p.

Further, the pharmaceutical composition comprises an inhibitor for reducing the expression level of miR-196a, and a promoter for increasing the expression levels of miR-27a-5p and miR-27b-5 p;

preferably, the sequence of the inhibitor for reducing the expression level of miR-196a is shown in SEQ ID NO 1;

preferably, the sequences of the accelerant for increasing the expression levels of miR-27a-5p and miR-27b-5p are respectively shown as SEQ ID NO:2-SEQ ID NO:3 and SEQ ID NO:4-SEQ ID NO: 5.

Further, the pharmaceutical composition can also comprise a pharmaceutically acceptable carrier and/or an auxiliary material.

In a fifth aspect, the present invention provides the use of a molecular marker for screening a candidate drug for the prevention and/or treatment of melanoma.

Further, the molecular markers are miR-196a, miR-27a-5p and miR-27b-5 p.

In a sixth aspect, the present invention provides a method of screening a candidate drug for preventing and/or treating melanoma.

Further, the method comprises the steps of:

(1) contacting a substance to be detected with a system containing or expressing miR-196a, miR-27a-5p and miR-27b-5 p;

(2) detecting the expression levels of miR-196a, miR-27a-5p and miR-27b-5p in the system;

(3) and selecting the substances which can simultaneously reduce the expression level of miR-196a and increase the expression levels of miR-27a-5p and miR-27b-5p as candidate medicines for preventing and/or treating melanoma.

Further, the system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

Compared with the prior art, the invention has the advantages and beneficial effects that:

the invention is verified by experiments for the first time, the combination of the molecular markers miR-196a, miR-27a-5p and miR-27b-5p can be used for the diagnosis and treatment of early melanoma, and the combination of the molecular markers miR-196a, miR-27a-5p and miR-27b-5p has a synergistic treatment effect and high diagnosis efficiency, so that the invention provides guidance for early diagnosis and early intervention and treatment of melanoma.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 shows a graph of the results of differential expression of miR-196a, miR-27a-5p and miR-27b-5p in training set and validation set, wherein, A is: miR-196a, training set, panel B: miR-27a-5p, training set, panel C: miR-27b-5p, training set, panel D: miR-196a, validation set, Panel E: miR-27a-5p, validation set, Panel F: miR-27b-5p and a verification set;

FIG. 2 shows the results of ROC curves of miR-196a, miR-27a-5p and miR-27b-5p in training set and validation set, wherein, A is as follows: miR-196a, training set, panel B: miR-27a-5p, training set, panel C: miR-27b-5p, training set, panel D: miR-196a, validation set, Panel E: miR-27a-5p, validation set, Panel F: miR-27b-5p and a verification set;

FIG. 3 shows a ROC curve result graph of miR-196a + miR-27a-5p + miR-27b-5p combination in training set and validation set, wherein, A graph: training set, B picture: a verification set;

FIG. 4 is a graph showing the results of the relative expression amounts of miR-196a, miR-27a-5p and miR-27b-5p, wherein, Panel A: miR-196a, B picture: miR-27a-5p, panel C: miR-27b-5 p;

FIG. 5 shows a statistical graph of the results of the effects of the combination of miR-196a inhibitor, miR-27a-5p mimics, miR-27b-5p mimics, miR-196 aininhibitor + miR-27a-5p mimics and miR-27b-5p mimics on the apoptosis rate of melanoma cells, wherein, A is shown as follows: blank control, panel B: negative control group, panel C: miR-196ainhibitor group, panel D: miR-27a-5p mimics group, E picture: miR-27b-5p mimics group, F picture: miR-196a inhibitor + miR-27a-5p mimics + miR-27b-5p mimics group.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1 screening of genes differentially expressed in melanoma

1. Data source

The data used in this embodiment are all from a GEO database (Gene Expression integrated database, Gene Expression Omnibus), melanoma data sets GSE35579 and GSE20994 are downloaded from the GEO database, the data sets include Gene Expression data and complete clinical annotations, wherein the downloaded data set GSE35579 is used as a validation set, and the sample size is Case: control 41: 11, the downloaded data set GSE20994 is used as a training set, and the sample size is Case: control 35: 22.

2. data pre-processing

The original data of the training set and the verification set downloaded from the GEO database are standardized, the standardized gene expression matrix is annotated through an annotation file (Platform file), a plurality of probes correspond to the same gene, and the average value is taken as the expression quantity of the gene.

3. Differential expression analysis

And performing differential expression analysis on the data in the data sets GSE35579 and GSE20994 by using a 'limma' packet in R language software, wherein the screening standard of the differential expression genes is as follows: value of adj<0.05，|log₂FC|>0.5。

4. Results of the experiment

The results are shown in table 1 and fig. 1A, fig. 1B, fig. 1C, fig. 1D, fig. 1E and fig. 1F, and the differential expressions miR-196a, miR-27a-5p and miR-27B-5p obtained through screening are significantly and differentially expressed in the training set and the verification set, wherein the expression of miR-196a in melanoma is significantly up-regulated, the expression of miR-27a-5p in melanoma is significantly down-regulated, and the expression of miR-27B-5p in melanoma is significantly down-regulated.

TABLE 1 results of differential expression of miR-196a, miR-27a-5p and miR-27b-5p in training set and validation set

Example 2 diagnostic Performance validation

1. Experimental methods

For the differentially expressed miRNAs miR-196a, miR-27a-5p and miR-27b-5p obtained by screening in example 1, adopting an R package 'pROC' (version 1.15.0) to draw a receiver operating characteristic curve (ROC curve), and analyzing the sensitivity, specificity and AUC value of the curve to judge the diagnostic efficacy of the miRNAs in a training set and a validation set when the miRNAs are singly and combined;

when the diagnostic efficacy of the single index in the training set and the verification set is judged, the miRNA expression is directly used for analysis, the level corresponding to the point with the maximum Youden index is selected as the cutoff value, and the gene with the AUC of 0.5< AUC <0.8 is used for joint analysis;

when the diagnosis efficiency of the index combination in the training set and the verification set is judged, Logitics regression is carried out on the expression level of each miRNA, the probability of whether each individual is ill or not is calculated through a fitted regression curve, different probability division threshold values are determined, and the sensitivity, specificity, accuracy and the like of the joint diagnosis scheme are calculated according to the determined probability division threshold values.

2. Results of the experiment

The results are shown in table 2 and fig. 2A, fig. 2B, fig. 2C, fig. 2D, fig. 2E, fig. 2F, fig. 3A and fig. 3B, and the results show that the diagnostic effect of the combination of miRNA combination miR-196a + miR-27a-5p + miR-27B-5p on melanoma is significantly better than that of a single miRNA, the AUC values in the training set and the validation set are 0.843 and 0.942 respectively, and the sensitivity and the specificity are both higher, which indicates that the combination of miRNA combination miR-196a + miR-27a-5p + miR-27B-5p has better diagnostic efficacy and can be applied to the diagnosis of melanoma.

TABLE 2 diagnostic efficacy results of miR-196a, miR-27a-5p, miR-27b-5p, miR-196a + miR-27a-5p + miR-27b-5p in combination in training set and validation set

Example 3 study of the relationship between the expression of miR-196a, miR-27a-5p and miR-27b-5p and the apoptosis of melanoma cells

1. Experimental Material

The main experimental equipment, experimental reagents and consumables involved in the experiment are shown in tables 3 and 4.

TABLE 3 Main Equipment involved in the experiment

Name (R)	Manufacturer of the product	Model number
			Micro-pipette	EPPendorf	248692Z
Super clean bench	ZJ Suzhou purification	16052007
			CO₂Constant temperature incubator	YILIANG	YCP series
Inverted microscope	canon	126281
			Low-speed centrifuge	eppendorf	47103

TABLE 4 major reagents involved in the experiment

Name (R)	Manufacturer of the product	Goods number
			Lipofectamine 2000	Invitrogen	#11668-019
DMEM	GIBCO	C11995500BT
			Cell culture dish, cell culture bottle	Corning
Other chemical reagents	Domestic analytical purity
			FBS	GIBCO	10270
P/S solution	SCLENCELL	NO.0503

2. Cell source

Melanoma cells A375 purchased from Shanghai, Chinesemedicity, academy of sciencesThe institute for cytobiology, after introduction, was cultured for a long period in this laboratory. A375 culture medium is DMEM + 10% FBS + 1% P/S solution at 37 deg.C and 5% CO₂Culturing under the conditions of 95% air and saturated humidity.

3. Cell culture

(1) A375 melanoma cell resuscitation

The cell recovery method adopts a method of rapid melting in a water bath. Protecting before experiment, wearing gloves and protective mask, taking out an A375 melanoma cell cryopreservation tube from liquid nitrogen, observing information such as label name, cryopreservation date and the like, determining the needed cell, quickly placing the cell in a prepared water bath kettle at 37 ℃, quickly completing the whole process, completely melting the cryopreservation liquid within 1min, preventing infection by aseptic operation, particularly, protecting the bottle cap, transferring the frozen cell into a centrifuge tube by using a suction tube after melting, adding PBS buffer solution, uniformly blowing to ensure complete melting into the PBS buffer solution, placing the centrifuge tube into a centrifuge, adjusting the rotation speed to 1000rpm/min, maintaining for about 5min, taking out supernatant, retaining substances at the bottom layer of the centrifuge tube, adding a proper amount of complete culture medium, re-suspending, planting into a T25 culture flask according to a ratio of 1:2, 5mL of DMEMF complete medium was added to each flask, round cells were visualized under the mirror in suspension, indicating that the cells had been successfully transferred, and then placed in a medium containing 5% CO₂Culturing in a cell incubator at constant temperature of 37 ℃;

(2) a375 melanoma cell exchange solution

The time for A375 melanoma cells to begin to adhere to the wall is about 4-6 hours generally, the cells can be adhered to the wall completely within one day generally, the cells after adhering to the wall are polygonal, the cells can be changed according to the color of the observed culture solution and the observation condition under a mirror, the DMEM complete culture medium is required to be preheated in a constant-temperature water bath kettle at 37 ℃, a Pasteur tube can be used for sucking the old culture solution on the cells, the cells do not contact the lower part of the culture dish as far as possible, scratches caused by bottom-layer cells are prevented, and the cells are not uniformly grown. Then washing by slowly adding PBS buffer solution preheated in 37 deg.C water bath along the side wall to remove some necrotic cellsWashing with 37 deg.C water bath preheated PBS three times, adding 37 deg.C water bath preheated 5mL DMEM complete culture medium into the culture dish, and adding 5% CO₂And culturing in a constant-temperature incubator at 37 ℃. The whole process is carried out aseptically, the pasteur tube is discarded in time after contacting the outside, the process is clean and convenient, and the long time is not suitable;

(3) passage of A375 melanoma cells

About 2-3 days, A375 melanoma cells reached 80% -100% cell fusion when passaged. Performing personal protection before experiment, in an ultra-clean workbench disinfected for 30min in advance, using a Pasteur tube, removing old culture solution, washing with PBS preheated in a37 ℃ water bath for three times, adding 1mL of trypsin with the concentration of 0.25%, placing in a37 ℃ constant-temperature incubator, timing for about 1min, observing under an inverted microscope to determine whether cells are completely digested, if most of round cells are suspended, stopping digestion of trypsin, adding 1-2mL of DMEM/F-12 complete culture medium preheated in a37 ℃ water bath, blowing cells in time to completely suspend the cells, transferring into a centrifuge tube, balancing the centrifuge, adjusting the rotation speed to 1000rpm/min, centrifuging for about 5min, performing passage according to the ratio of 1:3-1:5, placing a culture dish in 5-10mL of DMEM/F-12 complete culture medium, adding 5% CO at 37 deg.C₂The cell incubator of (1) for culturing.

4. Cell transfection

(1) Taking A375 cells in logarithmic growth phase, and adjusting cell density to 1 × 10 with culture medium⁵The cells are inoculated into 6-hole plates, 2mL of cell suspension is added into each hole, each group comprises two holes, and the cells are cultured overnight at 37 ℃;

(2) 2 hours before transfection, the medium is changed into a serum-free medium;

(3) the transfection procedure, for each transfection sample, was prepared as follows:

1) counting cells one day before transfection, adding 1mL into 6-well plate to make cell density of the plate not less than 2 × 10⁵A plurality of;

2) for each well of cells, 10. mu.L of 100nM inhibitor or mimics was diluted with 250. mu.L of serum-free medium and incubated for 5min at room temperature;

3) for each well of cells, 5 μ L Lipo2000 was diluted with 250 μ L serum free medium and incubated for 5min at room temperature;

4) mixing the liquids in the step 2) and the step 3), and incubating for 20min at room temperature;

5) replacing pre-divided adherent cells with serum-free medium, adding the above complex, and culturing at 37 deg.C with 5% CO₂Culturing for 6 hr, adding growth medium containing serum, and culturing at 37 deg.C under 5% CO₂And culturing for 48 hours. Collecting a cell sample, washing twice with PBS, discarding liquid, and extracting RNA subsequently;

the experiments were set up as 3 groups: blank control group (A375 melanoma cells), negative control group (inhibitor-NC or mimics-NC group) and experimental group (inhibitor or mimics group).

Wherein, the sequence information of the inhibitor aiming at miR-196a is as follows:

5’-CCCAACAACAUGAAACUACCUA-3’(SEQ ID NO:1)

the sequence information of the mimics for miR-27a-5p is as follows:

sense strand 5'-AGGGCUUAGCUGCUUGUGAGCA-3' (SEQ ID NO:2)

The antisense strand is 5'-UGCUCACAAGCAGCUAAGCCCU-3' (SEQ ID NO:3)

The sequence information of the mimics for miR-27b-5p is as follows:

sense strand 5'-AGAGCUUAGCUGAUUGGUGAAC-3' (SEQ ID NO:4)

The antisense strand is 5'-GUUCACCAAUCAGCUAAGCUCU-3' (SEQ ID NO:5)

Sequence information of inhibitor-NC is as follows:

5’-CAGUACUUUUGUGUAGUACAAA-3’(SEQ ID NO:6)

the sequence information of the mimics-NC is as follows:

sense strand 5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO:7)

The antisense strand is 5'-CAGUACUUUUGUGUAGUACAAA-3' (SEQ ID NO:8)

5. QPCR (quantitative polymerase chain reaction) detection of expression levels of miR-196a, miR-27a-5p and miR-27b-5p in cells

(1) Extraction of sample Total RNA (Trizol method)

1) Taking a proper amount of a sample to be detected, adding liquid nitrogen, grinding and crushing;

2) the ground samples were transferred to 1.5mL EP tubes with 1mL Trizol;

3) adding 500 mu L of phenol chloride into a 1.5mL EP tube, shaking and mixing uniformly, and standing for 5 minutes;

4) centrifuge at 12000rpm for 10 minutes at 4 ℃ and carefully pipette the supernatant into a new 1.5mL EP tube;

5) adding 700 μ L isopropanol into the separated supernatant, and mixing well;

6) centrifuging at 12000rpm at 4 deg.C for 10 min, and carefully discarding the supernatant;

7) washing the precipitate with 75% ethanol once, and air drying at room temperature;

8) dissolving the RNA precipitate by 50 mu L DEPC water;

9) and (5) detecting by agarose gel electrophoresis.

(2) Total RNA quality detection

1) The concentration and purity of RNA were determined using a nucleic acid concentration meter, which was previously zeroed with DEPC water for RNA lysis, and the procedure was as follows: lifting the sample arm to apply the sample to the test base; the sample arm was lowered and absorbance detection was initiated using software on the computer. A sample column can be automatically pulled out between the upper optical fiber and the lower optical fiber, and then detection is carried out; after the detection is finished, lifting the sample arm, and wiping the samples on the upper base and the lower base clean by clean dust-free paper;

2) and (3) concentration determination: a reading at 260nm of 1 indicates 40ng RNA/. mu.L. The formula for calculating the RNA concentration of the sample is as follows: A260X 40 ng/. mu.L;

3) and (3) purity detection: the ratio of A260/A280 of the RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

(3) Reverse transcription to synthesize cDNA

Reverse transcription was performed using the Invitrogen reverse transcription kit superscript III;

the reaction system 1 was established as shown in Table 5, mixed, centrifuged at 65 ℃ for 5 minutes, and then placed on ice;

TABLE 5 composition of reaction System 1

Reaction System 1 composition	The content of each component
		RNA	200ng(10μL)
Oligo-dT	1μL

The reaction system 2 was set up as shown in Table 6;

TABLE 6 composition of reaction System 2

Reaction System 2 composition	The content of each component
		Reaction System
1	12μL
		dNTP(10μM)	1μL
0.1M DTT	2μL
		5X Buffer	4μL
RT enzymes	1μL

Mixing, centrifuging, and placing at 42 deg.C in water bath for 60 min; taking out, reacting at 85 deg.C for 10 min, inactivating reverse transcriptase, and standing at-20 deg.C.

(4) Real-time fluorescent quantitative detection

Firstly, designing amplification primers of QPCR, wherein specific primer sequences are as follows:

miR-196a：

the forward primer was 5'-TAGGTAGTTTCATGTTGTTG-3' (SEQ ID NO: 9);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 10);

miR-27a-5p：

the forward primer was 5'-AGGGCTTAGCTGCTTGTGA-3' (SEQ ID NO: 11);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 12);

miR-27b-5p：

the forward primer was 5'-AGAGCTTAGCTGATTGGTG-3' (SEQ ID NO: 13);

the reverse primer was 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 14);

u6 internal reference primer:

the forward primer was 5'-GCTTCGGCAGCACATATACTAAAAT-3' (SEQ ID NO: 15);

the reverse primer is 5'-CGCTTCACGAATTTGCGTGTCAT-3' (SEQ ID NO: 16);

the Real time PCR reaction system is set up as shown in Table 7;

TABLE 7 Real time PCR reaction System

Composition of reaction system	The content of each component
		cDNA	2μL
PCR mix	10μL
		primer F	1μL
primer R	1μL
		ddH₂O	6μL

After the system is mixed uniformly, the mixture is instantaneously separated and placed on a fluorescent quantitative PCR instrument for reaction according to the conditions shown in the table 8;

TABLE 8 Realtime PCR reaction conditions

And analyzing relative quantitative results of each group of samples, wherein the calculation formulas of the relative expression amounts of miR-196a, miR-27a-5p and miR-27b-5p are as follows:

ΔCt_qmean Ct value of target gene in group to be tested-mean Ct value of reference gene in group to be tested

ΔCt_cbMean Ct value of target gene in control group-mean Ct value of reference gene in control group

6. Apoptosis assay

In the embodiment, flow cytometry is adopted to detect the influence of miR-196a, miR-27a-5p, miR-27b-5p, miR-196a + miR-27a-5p + miR-27b-5p expression on A375 melanoma cell apoptosis, firstly, collecting A375 melanoma cells which are not transfected, are transfected with miR-196a inhibitor, are transfected with miR-27a-5p mimics, are transfected with miR-27b-5p mimics, are transfected with miR-196a inhibitor, are miR-27a-5p mimics and are transfected with miR-27b-5p mimics, are washed, are fixed with ethanol, are subjected to cell resuspension and cell filtration, are dyed by PI staining solution, and are detected by a flow cytometer;

in the apoptosis detection, different quadrants in a flow cytometry detection result graph represent different meanings, Q1-1(annexin V-FITC) -/PI + represents necrotic cells, Q1-2(annexin V + FITC) +/PI + represents middle and late apoptotic cells, Q1-4(annexin V-FITC) +/PI-represents early apoptotic cells, Q1-3(annexin V-FITC) -/PI-represents normal living cells, the percentage of each quadrant represents the proportion of corresponding cells, and the total apoptosis rate of the cells is the middle and late apoptosis rate plus the early apoptosis rate.

7. Results of the experiment

The transfection result shows that the expression level of the blank control group miR-196a is set as 1 as a reference, compared with the expression level (relative expression amount is 1) of the blank control group miR-196a and the expression level of the negative control group (NC group) miR-196a of the transfection inhibitor-NC, the expression level of the miR-196a of the experimental group of the transfection inhibitor-196 a inhibitor is obviously reduced, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no obvious difference (see figure 4A);

the transfection result shows that, with the expression level of the blank control group miR-27a-5P as a reference set as 1, compared with the expression level of the blank control group miR-27a-5P (the relative expression level is 1) and the expression level of the negative control group miR-27a-5P of the transfection mimics-NC (the NC group), the expression level of the miR-27a-5P of the experimental group of the transfection miR-27a-5P mimics is obviously up-regulated, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no significant difference (see FIG. 4B);

the transfection result shows that, with the expression level of the blank control group miR-27b-5P as a reference set as 1, compared with the expression level of the blank control group miR-27b-5P (the relative expression level is 1) and the expression level of the negative control group miR-27b-5P of the transfection mimics-NC (the NC group), the expression level of the miR-27b-5P of the experimental group of the transfection miR-27b-5P mimics is obviously up-regulated, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no obvious difference (see figure 4C);

the result of an apoptosis experiment shows that the total apoptosis rate (10.11%) of cells of an experimental group transfected with miR-196a inhibitor is significantly higher than that of a blank control group (3.06%) and a negative control group (3.16%) (see Table 9 and FIG. 5A, FIG. 5B and FIG. 5C), which indicates that miR-196a can influence the apoptosis capacity of melanoma cells, and the inhibition of the expression level of miR-196a can promote the apoptosis of the melanoma cells;

the result of an apoptosis experiment shows that the total apoptosis rate (10.00%) of cells of an experimental group transfected with miR-27a-5p mimics is significantly higher than that of a blank control group (3.06%) and a negative control group (3.16%) (see Table 9 and FIGS. 5A, 5B and 5D), and the miR-27a-5p can influence the apoptosis capacity of melanoma cells, and the increase of the expression level of miR-27a-5p can promote the apoptosis of the melanoma cells;

the result of an apoptosis experiment shows that the total apoptosis rate (10.32%) of cells of an experimental group transfected with miR-27B-5p mimics is significantly higher than that of a blank control group (3.06%) and a negative control group (3.16%) (see Table 9 and FIGS. 5A, 5B and 5E), and the miR-27B-5p can influence the apoptosis capacity of melanoma cells, and the increase of the expression level of miR-27B-5p can promote the apoptosis of the melanoma cells;

the results of apoptosis experiments show that the total apoptosis rate (39.99%) of cells of the experimental group co-transfected with miR-196a inhibitor and miR-27a-5p mimics and miR-27b-5p mimics is significantly higher than that of the experimental group transfected with miR-196a inhibitor alone (10.11%) and the experimental group transfected with miR-27a-5p mimics alone (10.00%) and the experimental group transfected with miR-27b-5p mimics alone (10.32%) (see Table 9 and FIG. 5C, FIG. 5D, FIG. 5E, and FIG. 5F);

in addition, the cell inhibition ratios of the respective groups were calculated, and the results obtained by the calculation are shown in table 10, using the formula q ═ E_A+B+C/(E_A+E_B+E_C-E_A×E_B×E_C) Judging whether the effect of the three components has a synergistic effect, wherein E_A+B+CIs the inhibition rate of miR-196a inhibitor, miR-27a-5p mimics and miR-27b-5p mimics on melanoma cells, E_AIs the inhibition rate of miR-196a inhibitor to melanoma cells, E_BIs the inhibition rate of miR-27a-5p mimics on melanoma cells, E_CThe inhibition rate of miR-27b-5p mimics on melanoma cells is shown; if q is between 0.85 and 1.15, the pure superposition is carried out, q is more than 1.15 and less than 20, the synergy is obvious, q is less than 0.85, antagonism is realized, namely, the apoptosis promotion effect of the miR-196a inhibitor, the miR-27a-5p mimics and the miR-27b-5p mimics on melanoma cells can be judged to be a synergistic effect instead of the pure superposition when q is more than 1.15;

according to the results of the cell inhibition rates calculated in table 10, the synergy q value was calculated using the kindred equation, and whether the combined effect of miR-196a inhibitor, miR-27a-5p mimics, and miR-27b-5p mimics was a synergistic effect was evaluated, and the results of the cell inhibition rates calculated were substituted to find that q ═ E_A+B+C/(E_A+E_B+E_C-E_A×E_B×E_C) 0.3693/(0.0705+0.0694+0.0726-0.0705 × 0.0694 × 0.0726) ═ 1.742, namely q 1.742, q > 1.15, shows that the combined action of miR-196a inhibitor, miR-27a-5p mimics and miR-27b-5 pmmimics on the apoptosis promotion of melanoma cells is a synergistic effect, and further proves that the combined action of the miR-196a inhibitor, miR-27a-5p mimics and miR-27b-5p mimics is synergistic treatment instead of simple additive effect.

TABLE 9 statistics of results of apoptosis experiments

TABLE 10 calculation results of cytostatic rates of the respective groups

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Hebei Limited Corp medical laboratory services

Beijing Baiao Cisco biomedical technology Co., Ltd

<120> melanoma molecular marker and application thereof in early diagnosis and treatment of melanoma

<141> 2021-10-13

<160> 19

<170> SIPOSequenceListing 1.0

<210> 1

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cccaacaaca ugaaacuacc ua 22

<210> 2

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agggcuuagc ugcuugugag ca 22

<210> 3

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

ugcucacaag cagcuaagcc cu 22

<210> 4

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

agagcuuagc ugauugguga ac 22

<210> 5

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

guucaccaau cagcuaagcu cu 22

<210> 6

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

caguacuuuu guguaguaca aa 22

<210> 7

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

uuuguacuac acaaaaguac ug 22

<210> 8

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

caguacuuuu guguaguaca aa 22

<210> 9

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

taggtagttt catgttgttg 20

<210> 10

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

ctcaactggt gtcgtg 16

<210> 11

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

agggcttagc tgcttgtga 19

<210> 12

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ctcaactggt gtcgtg 16

<210> 13

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

agagcttagc tgattggtg 19

<210> 14

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

ctcaactggt gtcgtg 16

<210> 15

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

gcttcggcag cacatatact aaaat 25

<210> 16

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cgcttcacga atttgcgtgt cat 23

<210> 17

<211> 70

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

gugaauuagg uaguuucaug uuguugggcc uggguuucug aacacaacaa cauuaaacca 60

cccgauucac 70

<210> 18

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

agggcuuagc ugcuugugag ca 22

<210> 19

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 19

agagcuuagc ugauugguga ac 22

Claims

1. The application of the reagent for detecting the molecular marker in preparing the product for diagnosing melanoma is characterized in that the molecular marker is miR-196a, miR-27a-5p and miR-27b-5 p.

2. The use of claim 1, wherein the reagents comprise reagents for detecting the expression level of the molecular marker by reverse transcription PCR, real-time quantitative PCR, in situ hybridization, chip technology.

3. The use according to claim 2, wherein the reagent for detecting the expression level of the molecular marker by reverse transcription PCR comprises a primer for specifically amplifying the molecular marker;

4. The use according to claim 3, wherein the primer for specifically amplifying the molecular marker miR-196a has a sequence shown in SEQ ID NO 9-SEQ ID NO 10;

5. A product for diagnosing melanoma is characterized by comprising reagents for detecting the expression levels of molecular markers miR-196a, miR-27a-5p and miR-27b-5 p;

preferably, the product comprises a chip, a kit;

6. A system for early screening of melanoma, the system comprising:

the control unit of the melanoma evaluation device includes four units:

7. The application of the molecular marker in preparing the pharmaceutical composition for treating melanoma is characterized in that the molecular marker is miR-196a, miR-27a-5p and miR-27b-5 p.

8. The use of claim 7, wherein the pharmaceutical composition comprises an inhibitor for decreasing the expression level of miR-196a, a promoter for increasing the expression level of miR-27a-5p and miR-27b-5 p;

9. The application of the molecular marker in screening candidate drugs for preventing and/or treating melanoma is characterized in that the molecular marker is miR-196a, miR-27a-5p and miR-27b-5 p.

10. A method for screening a candidate drug for preventing and/or treating melanoma, comprising the steps of: