CN113755600A

CN113755600A - Melanoma-associated biomarker and application thereof in diagnosis and treatment

Info

Publication number: CN113755600A
Application number: CN202111202965.5A
Authority: CN
Inventors: 张仙; 杨志强; 崔明鹿; 孔云
Original assignee: Beijing Baiaosike Biomedical Technology Co ltd; Kangtai Medical Laboratory Service Hebei Co ltd
Current assignee: Beijing Baiaosike Biomedical Technology Co ltd; Kangtai Medical Laboratory Service Hebei Co ltd
Priority date: 2021-10-15
Filing date: 2021-10-15
Publication date: 2021-12-07

Abstract

The invention discloses a biomarker related to melanoma and application thereof in diagnosis and treatment, wherein the biomarker comprises miR-155, miR-27b-5p and miR-450a, and the invention provides a chip and a kit for melanoma diagnosis.

Description

Melanoma-associated biomarker and application thereof in diagnosis and treatment

Technical Field

The invention belongs to the technical field of biological medicines, and particularly relates to a biomarker related to melanoma and application thereof in diagnosis and treatment, and more particularly relates to a biomarker related to melanoma, which comprises miR-155, miR-27b-5p and miR-450 a.

Background

Melanoma (melaoma) is a highly malignant tumor derived from melanocytes of the basal layer of the epidermis, which develops well in the skin or in the mucosal tissues adjacent to the skin, is the most aggressive and lethal cancer of the skin, and has a rapidly increasing tendency in the last decades to occur globally with an increasing incidence and mortality. However, the main cause of death in melanoma patients is the propensity of the tumor to metastasize rapidly. Melanoma is characterized by high malignancy, rapid progress, early metastasis and the like, and in recent years, the rapid progress of immunotherapy and targeted therapy has revolutionized the clinical history of melanoma, has a certain effect on treatment, and can significantly prolong the survival of patients, but is limited by clinical application, and no satisfactory treatment is currently available for patients with advanced melanoma who have tumor metastasis.

At present, further intensive research is urgently needed for the research on the pathogenesis of melanoma. There is increasing evidence that melanoma is pathologically formed involving multiple genes, multiple signaling pathways, and complex changes in gene regulation. Therefore, the identification of some potential target molecules in the progress of the melanoma, including oncogenes, cancer suppressor genes and the like, is expected to become a novel target for treating the melanoma in the future. Micrornas (mirnas) are a class of endogenous non-coding RNA molecules of about 19-24 nucleotides in length, and mirnas can regulate the expression of genes at the post-transcriptional level by directly binding to their complementary sequences that target the 3' -untranslated region of the regulatory gene, ultimately leading to degradation or translational inhibition of the target gene. Studies have shown that a single miRNA can regulate the expression of more than 100 genes, and that one gene may also be targeted by several mirnas.

Currently, a large number of mirnas have been annotated and it is predicted that approximately 30-40% of human genes are regulated by mirnas. In recent years, numerous studies have shown that there is a deregulation of miRNA expression profiles between tumor tissues of various solid cancer patients and their corresponding normal tissues in the vicinity of the tumor tissues, which may be the result of epigenetic changes induced by miRNA changes, changes in transcription factor activity, or changes in enzymes associated with miRNA biogenesis. In addition, there is evidence that expression of aberrant mirnas can contribute to the development, progression and progression of many cancers by down-regulating tumor suppressor genes or up-regulating tumor carcinogenic genes. Thus, mirnas are considered to be key regulators in the development of melanoma.

In view of the above, the invention provides a new biomarker for melanoma and a new approach for treating melanoma by screening miRNA related to melanoma and further researching application of the screened miRNA as a biomarker for melanoma in diagnosis and treatment of melanoma.

Disclosure of Invention

In order to solve the problems, the invention aims to provide a biomarker related to melanoma and application thereof in diagnosis and treatment, wherein the biomarker related to melanoma comprises miR-155, miR-27b-5p and miR-450a, and the invention provides a miRNA melanoma diagnosis and treatment marker combination, a chip and a kit, which can simply, effectively and non-invasively diagnose the melanoma, and in addition, the combination of the miR-155, miR-27b-5p and miR-450a has a synergistic effect on the treatment of the melanoma.

The sequences of the biomarkers miR-155, miR-27b-5p and miR-450a disclosed by the invention can be inquired in a miRBase database (http:// microrna.sanger.ac.uk /), wherein the sequence of miR-155 is shown as SEQ ID NO:16, the sequence of miR-27b-5p is shown as SEQ ID NO:17, and the sequence of miR-450a is shown as SEQ ID NO: 18;

sequence of miR-155:

CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG(SEQ ID NO:16)

sequence of miR-27b-5 p:

AGAGCUUAGCUGAUUGGUGAAC(SEQ ID NO:17)

sequence of miR-450 a:

AAACGAUACUAAACUGUUUUUGCGAUGUGUUCCUAAUAUGCACUAUAAAUAUAUUGGGAACAUUUUGCAUGUAUAGUUUUGUAUCAAUAUA(SEQ ID NO:18)

further, the miR-155 and miR-450a disclosed by the invention comprises miR-155, miR-450a initial miRNA, miR-155, miR-450a precursor miRNA, mature miR-155 and miR-450a, the miR-155 and miR-450a initial miRNA is cut and expressed into mature miR-155 and miR-450a in human cells, and the miR-155 and miR-450a precursor miRNA is cut and expressed into mature miR-155 and miR-450a in human cells. As a further preference, the miR-155 and miR-450a further comprise: base modification is carried out on miR-155 and miR-450a, or base is added at two ends to obtain the sequence.

In order to achieve the purpose, the invention adopts the following technical scheme:

the invention provides an application of a reagent for detecting the expression level of a biomarker in preparing a product for diagnosing melanoma.

Further, the biomarkers are miR-155, miR-27b-5p and miR-450 a.

Further, the agent is selected from:

oligonucleotide probes specifically recognizing the biomarkers miR-155, miR-27b-5p and miR-450 a; or

And primers for specifically amplifying the biomarkers miR-155, miR-27b-5p and miR-450 a.

Further, the sequences of primers for specifically amplifying the biomarkers miR-155, miR-27b-5p and miR-450a are respectively shown in SEQ ID NO 8-SEQ ID NO 9, SEQ ID NO 10-SEQ ID NO 11 and SEQ ID NO 12-SEQ ID NO 13.

Further, the product comprises: and (3) detecting the expression levels of the biomarkers miR-155, miR-27b-5p and miR-450a by real-time quantitative PCR, RT-PCR, in-situ hybridization, a chip or a high-throughput sequencing platform.

Further, the real-time quantitative PCR refers to a method of adding a fluorescent group into a PCR reaction system, realizing real-time monitoring of the whole PCR process by using fluorescent signal accumulation, and carrying out quantitative analysis on an initial template. The real-time quantitative PCR can be respectively SYBR Green fluorescent dye method and Taqman probe method, wherein, a quantitative PCR reaction system of the Taqman probe method comprises a pair of PCR primers and a probe. The 5 'end of the probe is marked with a Reporter group (R), such as FAM, VIC and the like, and the 3' end is marked with a fluorescence quenching group (Quencher, Q), such as TAMRA and the like. When the probe is intact, the fluorescence emitted by the reporter is absorbed by the quencher and the instrument is unable to detect the signal. As the PCR reaction proceeds, Taq enzyme encounters the probe bound to the template during the strand extension process, the 3 '→ 5' exonuclease activity of the Taq enzyme is cleaved by the probe, the reporter group is moved away from the quencher group, energy cannot be absorbed, and a fluorescent signal is generated. Thus, each time a cycle is passed, the fluorescent signal has a synchronous exponential growth process as the target fragment.

Further, the RT-PCR refers to converting mature miRNA into cDNA sequence and then amplifying using qPCR. This technology can be automated on standard equipment and is therefore widely used today. The RT-PCR method has good sensitivity, specificity and repeatability. In addition, the RT-PCR not only comprises the traditional real-time quantitative RT-PCR, but also comprises a Stem loop real-time quantitative RT-PCR technology, the Stem loop real-time quantitative RT-PCR is an experimental technology with high specificity and sensitivity for detecting miRNA expression, and comprises two key steps of designing a reverse transcription primer with a Stem loop (Stem loop) structure and carrying out real-time PCR by using a specific molecular probe fluorescently labeled by miRNA. The technique has the following advantages: the miRNA with high specificity and high sequence homology can be accurately distinguished; ultra-wide quantitative linear range and high detection sensitivity; the sample consumption is low, and only 1-10ng of total RNA is needed; the application range is wide, and the total RNA, the cell lysate and the purified RNA can be used for the quantitative detection of miRNA.

Furthermore, the in situ hybridization is divided into in situ hybridization in cells and tissues, and the miRNA expression is detected by the technology, so that the spatiotemporal expression mode of the miRNA can be displayed more intuitively. The kit can detect the expression of miRNA in single cells of different cell lines, and can compare the expression levels of miRNA in different cell lines without classification and separation. It is a powerful tool for analyzing miRNA expression tissue and timing sequence specificity.

The invention provides a product for diagnosing melanoma.

Further, the product comprises a reagent for detecting the expression levels of the biomarkers miR-155, miR-27b-5p and miR-450 a.

Further, the product comprises a chip and a kit;

preferably, the chip comprises a solid phase carrier and oligonucleotide probes which are fixed on the solid phase carrier and specifically recognize the biomarkers miR-155, miR-27b-5p and miR-450 a;

preferably, the kit comprises a primer, a probe or a chip which specifically binds to the biomarkers miR-155, miR-27b-5p and miR-450 a.

Further, the kit also comprises at least one of a positive quality control material, a negative quality control material, poly-A tailing enzyme, reverse transcriptase, dNTPs, reverse transcription buffer solution, RNase-free water, qPCR buffer solution, magnesium chloride, DNA polymerase and SYBRGreen fluorescent dye.

Further, the Poly-a tailing method is to perform reverse transcription on miRNA, so the reverse transcription primer and the reverse primer of the pcrs are both universal primers, and only the forward primer of the qPCR is used to identify 3 miRNA markers and the internal reference U6.

The invention provides application of a biomarker in preparation of a pharmaceutical composition for treating melanoma.

Further, the biomarkers are miR-155, miR-27b-5p and miR-450 a.

Further, the pharmaceutical composition comprises an inhibitor for reducing the expression level of miR-155, a promoter for increasing the expression level of miR-27b-5p, and an inhibitor for reducing the expression level of miR-450 a;

preferably, the sequence of the inhibitor for reducing the expression level of miR-155 is shown as SEQ ID NO 1;

preferably, the sequence of the promoter for increasing the expression level of miR-27b-5p is shown in SEQ ID NO 2-SEQ ID NO 3;

preferably, the sequence of the inhibitor for reducing the expression level of miR-450a is shown in SEQ ID NO. 4.

Further, the pharmaceutical composition of the present invention further comprises a pharmaceutically acceptable carrier, and the pharmaceutical composition of the present invention is prepared by mixing the effective ingredient, the substance inhibiting or promoting the expression of the biomarker, and the pharmaceutically acceptable carrier through a conventional pharmaceutical process.

The invention provides a method for screening a candidate drug for preventing and/or treating melanoma.

Further, the method comprises the steps of:

(1) contacting a substance to be detected with a system containing or expressing miR-155, miR-27b-5p and miR-450 a;

(2) detecting the expression levels of miR-155, miR-27b-5p and miR-450a in the system;

(3) and selecting the substances which can simultaneously reduce the expression levels of miR-155 and miR-450a and increase the expression level of miR-27b-5p as candidate medicines for preventing and/or treating melanoma.

Further, the system is selected from: a cell system, a subcellular system, a solution system, a tissue system, an organ system, or an animal system.

The invention provides application of biomarkers in screening candidate drugs for preventing and/or treating melanoma.

Further, the biomarkers are miR-155, miR-27b-5p and miR-450 a.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Further, some terms are explained as follows.

The term "treatment", as used herein, generally relates to the treatment of a human or animal (e.g., as applied by a veterinarian) wherein some desired therapeutic effect may be achieved, e.g., inhibiting the development of a condition (including reducing the rate of development, halting the development of a condition), ameliorating a condition, and curing the condition. Treatment as a prophylactic measure (e.g., prophylaxis) is also included. The use of a patient who has not yet developed a condition but who is at risk of developing the condition is also encompassed by the term "treatment".

The term "biomarker," as used herein, refers to a molecular indicator with a specific biological property, biochemical characteristic, or other aspect that can be used to determine the presence or absence of a particular disease or condition and/or the severity of a particular disease or condition. It is common to "markers", "miRNA markers" or "molecular markers", in particular embodiments of the invention the biomarkers are miRNA markers, more particularly the miRNA markers include miR-155, miR-27b-5p, miR-450 a.

The term "differential expression" as used herein refers to the presence of a difference between the expression levels of one or more biomarkers of the invention in one sample, in particular embodiments of the invention, miRNA markers, more particularly, miR-155, miR-27b-5p, miR-450a, as compared to the expression level of the same one or more biomarkers of the invention in a second sample, as measured by the expression level or amount of expression of the biomarkers in the sample.

The term "up-regulated" as used herein means that the expression level or amount of a biomarker shows an increase of at least 10% or more, e.g., 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or more or 1.1-fold, 1.2-fold, 1.4-fold, 1.6-fold, 1.8-fold or more, relative to a control.

The term "downregulate", as used herein, means that the expression level or amount of a biomarker exhibits a decrease of at least 10% or more, e.g., 20%, 30%, 40% or 50%, 60%, 70%, 80%, 90% or less than 1.0-fold, 0.8-fold, 0.6-fold, 0.4-fold, 0.2-fold, 0.1-fold or less, relative to a control.

The term "inhibitor" or "inhibitor for reducing the expression level of a biomarker" as used herein refers to miRNA inhibitor, which is a chemically modified inhibitor specifically directed to a specific target miRNA in a cell, specifically targets and knocks out a single miRNA molecule, can weaken the gene silencing effect of an endogenous miRNA, improve the protein expression level, perform loss-of-function (loss-of-function) research, and can be used to screen miRNA target sites, screen mirnas that regulate and control the expression of a certain gene, and screen mirnas that affect the development process of a cell. The miRNA inhibitor is a chemically modified RNA single chain, can be combined with a mature miRNA sequence in a competitive mode, is easy to obtain, simple and convenient to operate and short in experimental period, and can be well applied to miRNA function analysis research, such as function research in aspects of cell proliferation, cell apoptosis, cell differentiation, cell migration, stem cell growth and the like. The miRNA inhibitor can be transfected into cells only by being wrapped by a transfection reagent, the complicated operation of constructing a carrier is not needed, the worry about virus protection is not needed, and the transfection efficiency can be observed by using a transfection contrast.

The term "promoter" or "promoter for increasing the expression level of a biomarker" as used herein refers to miRNA mimics, which is a miRNA that mimics the endogenous level of an organism and is synthesized by chemical synthesis, and can enhance the function of the endogenous miRNA. The miRNA mimics the high-level expression of endogenous mature miRNA in cells so as to enhance the regulation and control effect of the endogenous miRNA, and is a great advantage for miRNA function research. The miRNA mimics are a simple and efficient miRNA research tool, can be transfected into cells only by being wrapped by a transfection reagent, do not need complicated operation of constructing a vector, do not need worry about virus protection, and can observe the transfection efficiency by using a transfection contrast. The transfection effect of miRNA mimics can be detected from the aspects of RNA expression level, protein expression level, cell function and the like of target genes. The experiments can obtain biological function data of miRNA and be applied to target gene verification of miRNA. Typically these experiments involve transfection of miRNA mimics.

Drawings

Embodiments of the invention are described in detail below with reference to the attached drawing figures, wherein:

FIG. 1 shows the result chart of the differential expression of miR-155, miR-27b-5p and miR-450a in training set and validation set, wherein, A chart: miR-155, training set, Panel B: miR-27b-5p, training set, panel C: miR-450a, training set, graph D: miR-155, validation set, Panel E: miR-27b-5p, validation set, Panel F: miR-450a and a verification set;

FIG. 2 shows the ROC curve result graphs of miR-155, miR-27b-5p and miR-450a in training set and validation set, wherein, A graph: miR-155, training set, Panel B: miR-27b-5p, training set, panel C: miR-450a, training set, graph D: miR-155, validation set, Panel E: miR-27b-5p, validation set, Panel F: miR-450a and a verification set;

FIG. 3 shows a ROC curve result graph of miR-155+ miR-27b-5p + miR-450a combination in training set and validation set, wherein, A graph: training set, B picture: a verification set;

FIG. 4 is a graph showing the results of the relative expression amounts of miR-155, miR-27b-5p and miR-450a, wherein A is a graph: miR-155, Panel B: miR-27b-5p, panel C: miR-450 a;

FIG. 5 shows a statistical graph of the results of the effects of the combination of miR-155inhibitor, miR-27b-5p mix, miR-450a inhibitor, miR-155inhibitor + miR-27b-5p mix + miR-450a inhibitor on the apoptosis rate of melanoma cells, wherein, A is shown as follows: blank control, panel B: negative control group, panel C: miR-155inhibitor group, panel D: miR-27b-5p mimics group, E picture: miR-450a inhibitor group, panel F: miR-155inhibitor + miR-27b-5p mimics + miR-450a inhibitor group.

Detailed Description

The present invention is further illustrated below with reference to specific examples, which are intended to be illustrative only and are not to be construed as limiting the invention. As will be understood by those of ordinary skill in the art: various changes, modifications, substitutions and alterations can be made to the embodiments without departing from the principles and spirit of the invention, the scope of which is defined by the claims and their equivalents. The following examples are examples of experimental methods not indicating specific conditions, and the detection is usually carried out according to conventional conditions or according to the conditions recommended by the manufacturers.

Example 1 screening of genes differentially expressed in melanoma

1. Data source

The data used in this embodiment are all from a GEO database (Gene Expression integrated database, Gene Expression Omnibus), melanoma data sets GSE35579 and GSE20994 are downloaded from the GEO database, the data sets include Gene Expression data and complete clinical annotations, wherein the downloaded data set GSE35579 is used as a validation set, and the sample size is Case: control 41: 11, the downloaded data set GSE20994 is used as a training set, and the sample size is Case: control 35: 22.

2. data pre-processing

The original data of the training set and the verification set downloaded from the GEO database are standardized, the standardized gene expression matrix is annotated through an annotation file (Platform file), a plurality of probes correspond to the same gene, and the average value is taken as the expression quantity of the gene.

3. Differential expression analysis

And performing differential expression analysis on the data in the data sets GSE35579 and GSE20994 by using a 'limma' packet in R language software, wherein the screening standard of the differential expression genes is as follows: value of adj<0.05，|log₂FC|>0.5。

4. Results of the experiment

The results are shown in table 1 and fig. 1A, fig. 1B, fig. 1C, fig. 1D, fig. 1E and fig. 1F, and the differential expression mirnas miR-155, miR-27B-5p and miR-450a obtained through screening show significant differential expression in training set and validation set, wherein the expression of miR-155in melanoma is significantly up-regulated, the expression of miR-27B-5p in melanoma is significantly down-regulated, and the expression of miR-450a in melanoma is significantly up-regulated.

TABLE 1 results of differential expression of miR-155, miR-27b-5p and miR-450a in training set and validation set

Example 2 diagnostic Performance validation

1. Experimental methods

For the differentially expressed miRNAs miR-155, miR-27b-5p and miR-450a obtained by screening in example 1, adopting R package 'pROC' (version 1.15.0) to draw a receiver operating characteristic curve (ROC curve), and analyzing the sensitivity, specificity and AUC value of the receiver operating characteristic curve to judge the diagnostic efficacy of the miRNAs in a training set and a verification set when the miRNAs are singly and combined;

when the diagnostic efficacy of the single index in the training set and the verification set is judged, the miRNA expression is directly used for analysis, the level corresponding to the point with the maximum Youden index is selected as the cutoff value, and the gene with the AUC of 0.5< AUC <0.8 is used for joint analysis;

when the diagnosis efficiency of the index combination in the training set and the verification set is judged, Logitics regression is carried out on the expression level of each miRNA, the probability of whether each individual is ill or not is calculated through a fitted regression curve, different probability division threshold values are determined, and the sensitivity, specificity, accuracy and the like of the joint diagnosis scheme are calculated according to the determined probability division threshold values.

2. Results of the experiment

The results are shown in table 2 and fig. 2A, fig. 2B, fig. 2C, fig. 2D, fig. 2E, fig. 2F, fig. 3A and fig. 3B, and the results show that the diagnostic effect of the combination of miRNA combination miR-155+ miR-27B-5p + miR-450a on melanoma is significantly better than that of a single miRNA, and AUC values in training set and validation set are 0.871 and 0.962, respectively, which indicates that the combination of miRNA combination miR-155+ miR-27B-5p + miR-450a has better diagnostic efficacy and can be applied to the diagnosis of melanoma.

TABLE 2 results of the diagnostic potency of miR-155, miR-27b-5p, miR-450a, miR-155+ miR-27b-5p + miR-450a in combination in training set and validation set

Example 3 study on the relationship between the expression of miR-155, miR-27b-5p and miR-450a and the apoptosis of melanoma cells

1. Experimental Material

The main experimental equipment, experimental reagents and consumables involved in the experiment are shown in tables 3 and 4.

TABLE 3 Main Equipment involved in the experiment

Name (R)	Manufacturer of the product	Model number
			Micro-pipette	EPPendorf	248692Z
Super clean bench	ZJ Suzhou purification	16052007
			CO₂Constant temperature incubator	YILIANG	YCP series
Inverted microscope	canon	126281
			Low-speed centrifuge	eppendorf	47103

TABLE 4 major reagents involved in the experiment

Name (R)	Manufacturer of the product	Goods number
			Lipofectamine 2000	Invitrogen	#11668-019
DMEM	GIBCO	C11995500BT
			Cell culture dish, cell culture bottle	Corning
Other chemical reagents	Domestic analytical purity
			FBS	GIBCO	10270
P/S solution	SCLENCELL	NO.0503

2. Cell source

Melanoma cells A375 were purchased from Shanghai institute of cell biology, Chinese academy of sciences and were introduced for long term culture in the laboratory. A375 culture medium is DMEM + 10% FBS + 1% P/S solution at 37 deg.C and 5% CO₂Culturing under the conditions of 95% air and saturated humidity.

3. Cell culture

(1) A375 melanoma cell resuscitation

Cell resuscitationThe method adopts rapid melting in a water bath. Protecting before experiment, wearing gloves and protective mask, taking out an A375 melanoma cell cryopreservation tube from liquid nitrogen, observing information such as label name, cryopreservation date and the like, determining the needed cell, quickly placing the cell in a prepared water bath kettle at 37 ℃, quickly completing the whole process, completely melting the cryopreservation liquid within 1min, preventing infection by aseptic operation, particularly, protecting the bottle cap, transferring the frozen cell into a centrifuge tube by using a suction tube after melting, adding PBS buffer solution, uniformly blowing to ensure complete melting into the PBS buffer solution, placing the centrifuge tube into a centrifuge, adjusting the rotation speed to 1000rpm/min, maintaining for about 5min, taking out supernatant, retaining substances at the bottom layer of the centrifuge tube, adding a proper amount of complete culture medium, re-suspending, planting into a T25 culture flask according to a ratio of 1:2, 5mL of DMEMF complete medium was added to each flask, round cells were visualized under the mirror in suspension, indicating that the cells had been successfully transferred, and then placed in a medium containing 5% CO₂Culturing in a cell incubator at constant temperature of 37 ℃;

(2) a375 melanoma cell exchange solution

The time for A375 melanoma cells to begin to adhere to the wall is about 4-6 hours generally, the cells can be adhered to the wall completely within one day generally, the cells after adhering to the wall are polygonal, the cells can be changed according to the color of the observed culture solution and the observation condition under a mirror, the DMEM complete culture medium is required to be preheated in a constant-temperature water bath kettle at 37 ℃, a Pasteur tube can be used for sucking the old culture solution on the cells, the cells do not contact the lower part of the culture dish as far as possible, scratches caused by bottom-layer cells are prevented, and the cells are not uniformly grown. Washing with 37 deg.C water bath preheated PBS buffer solution slowly along the side wall to remove some necrotic cells, washing with 37 deg.C water bath preheated PBS three times, adding 37 deg.C water bath preheated 5mL DMEM complete culture medium into the culture dish, and adding 5% CO₂And culturing in a constant-temperature incubator at 37 ℃. The whole process is carried out aseptically, the pasteur tube is discarded in time after contacting the outside, the process is clean and convenient, and the long time is not suitable;

(3) passage of A375 melanoma cells

About 2-3 days, A375 melanoma cells reached 80% -100% cell fusion when passaged. Performing personal protection before experiment, in an ultra-clean workbench disinfected for 30min in advance, using a Pasteur tube, removing old culture solution, washing with PBS preheated in a37 ℃ water bath for three times, adding 1mL of trypsin with the concentration of 0.25%, placing in a37 ℃ constant-temperature incubator, timing for about 1min, observing under an inverted microscope to determine whether cells are completely digested, if most of round cells are suspended, stopping digestion of trypsin, adding 1-2mL of DMEM/F-12 complete culture medium preheated in a37 ℃ water bath, blowing cells in time to completely suspend the cells, transferring into a centrifuge tube, balancing the centrifuge, adjusting the rotation speed to 1000rpm/min, centrifuging for about 5min, performing passage according to the ratio of 1:3-1:5, placing a culture dish in 5-10mL of DMEM/F-12 complete culture medium, adding 5% CO at 37 deg.C₂The cell incubator of (1) for culturing.

4. Cell transfection

(1) Taking A375 cells in logarithmic growth phase, and adjusting cell density to 1 × 10 with culture medium⁵The cells are inoculated into 6-hole plates, 2mL of cell suspension is added into each hole, each group comprises two holes, and the cells are cultured overnight at 37 ℃;

(2) 2 hours before transfection, the medium is changed into a serum-free medium;

(3) the transfection procedure, for each transfection sample, was prepared as follows:

1) counting cells one day before transfection, adding 1mL into 6-well plate to make cell density of the plate not less than 2 × 10⁵A plurality of;

2) for each well of cells, 10. mu.L of 100nM inhibitor or mimics was diluted with 250. mu.L of serum-free medium and incubated for 5min at room temperature;

3) for each well of cells, 5 μ L Lipo2000 was diluted with 250 μ L serum free medium and incubated for 5min at room temperature;

4) mixing the liquids in the step 2) and the step 3), and incubating for 20min at room temperature;

5) replacing the pre-divided adherent cellsForming serum-free culture medium, adding the above complex, and culturing at 37 deg.C with 5% CO₂Culturing for 6 hr, adding growth medium containing serum, and culturing at 37 deg.C under 5% CO₂And culturing for 48 hours. Collecting a cell sample, washing twice with PBS, discarding liquid, and extracting RNA subsequently;

the experiments were set up as 3 groups: blank control group (A375 melanoma cells), negative control group (inhibitor-NC or mimics-NC group) and experimental group (inhibitor or mimics group).

Wherein, the sequence information of the inhibitor aiming at miR-155 is as follows:

5’-AACCCCUAUCACGAUUAGCAUUAA-3’(SEQ ID NO:1)

the sequence information of the mimics for miR-27b-5p is as follows:

sense strand 5'-AGAGCUUAGCUGAUUGGUGAAC-3' (SEQ ID NO:2)

The antisense strand is 5'-GUUCACCAAUCAGCUAAGCUCU-3' (SEQ ID NO:3)

Sequence information of inhibitor for miR-450a is as follows:

5’-AUAUUAGGAACACAUCGCAAAA-3’(SEQ ID NO:4)

sequence information of inhibitor-NC is as follows:

5’-CAGUACUUUUGUGUAGUACAAA-3’(SEQ ID NO:5)

the sequence information of the mimics-NC is as follows:

sense strand 5'-UUUGUACUACACAAAAGUACUG-3' (SEQ ID NO:6)

The antisense strand is 5'-CAGUACUUUUGUGUAGUACAAA-3' (SEQ ID NO:7)

5. QPCR (quantitative polymerase chain reaction) detection of expression levels of miR-155, miR-27b-5p and miR-450a in cells

(1) Extraction of sample Total RNA (Trizol method)

1) Taking a proper amount of a sample to be detected, adding liquid nitrogen, grinding and crushing;

2) the ground samples were transferred to 1.5mL EP tubes with 1mL Trizol;

3) adding 500 mu L of phenol chloride into a 1.5mL EP tube, shaking and mixing uniformly, and standing for 5 minutes;

4) centrifuge at 12000rpm for 10 minutes at 4 ℃ and carefully pipette the supernatant into a new 1.5mL EP tube;

5) adding 700 μ L isopropanol into the separated supernatant, and mixing well;

6) centrifuging at 12000rpm at 4 deg.C for 10 min, and carefully discarding the supernatant;

7) washing the precipitate with 75% ethanol once, and air drying at room temperature;

8) dissolving the RNA precipitate by 50 mu L DEPC water;

9) and (5) detecting by agarose gel electrophoresis.

(2) Total RNA quality detection

1) The concentration and purity of RNA were determined using a nucleic acid concentration meter, which was previously zeroed with DEPC water for RNA lysis, and the procedure was as follows: lifting the sample arm to apply the sample to the test base; the sample arm was lowered and absorbance detection was initiated using software on the computer. A sample column can be automatically pulled out between the upper optical fiber and the lower optical fiber, and then detection is carried out; after the detection is finished, lifting the sample arm, and wiping the samples on the upper base and the lower base clean by clean dust-free paper;

2) and (3) concentration determination: a reading at 260nm of 1 indicates 40ng RNA/. mu.L. The formula for calculating the RNA concentration of the sample is as follows: A260X 40 ng/. mu.L;

3) and (3) purity detection: the ratio of A260/A280 of the RNA solution is a method for detecting RNA purity, and the ratio ranges from 1.8 to 2.1.

(3) Reverse transcription to synthesize cDNA

Reverse transcription was performed using the Invitrogen reverse transcription kit superscript III;

the reaction system 1 was established as shown in Table 5, mixed, centrifuged at 65 ℃ for 5 minutes, and then placed on ice;

TABLE 5 composition of reaction System 1

Reaction System 1 composition	The content of each component
		RNA	200ng(10μL)
Oligo-dT	1μL

The reaction system 2 was set up as shown in Table 6;

TABLE 6 composition of reaction System 2

Reaction System 2 composition	The content of each component
		Reaction System 1	12μL
dNTP(10μM)	1μL
		0.1M DTT	2μL
5X Buffer	4μL
		RT enzymes	1μL

Mixing, centrifuging, and placing at 42 deg.C in water bath for 60 min; taking out, reacting at 85 deg.C for 10 min, inactivating reverse transcriptase, and standing at-20 deg.C.

(4) Real-time fluorescent quantitative detection

Firstly, designing amplification primers of QPCR, wherein specific primer sequences are as follows:

miR-155：

the forward primer was 5'-TTAATGCTAATCGTGATAGG-3' (SEQ ID NO: 8);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 9);

miR-27b-5p：

the forward primer was 5'-AGAGCTTAGCTGATTGGTG-3' (SEQ ID NO: 10);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 11);

miR-450a：

the forward primer was 5'-TTTTGCGATGTGTTCCTAAT-3' (SEQ ID NO: 12);

the reverse primer is 5'-CTCAACTGGTGTCGTG-3' (SEQ ID NO: 13);

u6 internal reference primer:

the forward primer was 5'-GCTTCGGCAGCACATATACTAAAAT-3' (SEQ ID NO: 14);

the reverse primer is 5'-CGCTTCACGAATTTGCGTGTCAT-3' (SEQ ID NO: 15);

the Real time PCR reaction system is set up as shown in Table 7;

TABLE 7 Real time PCR reaction System

Composition of reaction system	The content of each component
		cDNA	2μL
PCR mix	10μL
		primer F	1μL
primer R	1μL
		ddH₂O	6μL

After the system is mixed uniformly, the mixture is instantaneously separated and placed on a fluorescent quantitative PCR instrument for reaction according to the conditions shown in the table 8;

TABLE 8 Realtime PCR reaction conditions

Analyzing the relative quantitative results of each group of samples, wherein the calculation formulas of the relative expression amounts of miR-155, miR-27b-5p and miR-450a are as follows:

ΔCt_qmean Ct value of target gene in group to be tested-mean Ct value of reference gene in group to be tested

ΔCt_cbMean Ct value of target gene in control group-mean Ct value of reference gene in control group

6. Apoptosis assay

In the embodiment, the influence of the expression of miR-155, miR-27b-5p, miR-450a, miR-155+ miR-27b-5p + miR-450a on the apoptosis of the A375 melanoma cell is detected by adopting flow cytometry, firstly, the A375 melanoma cell which is not transfected, is transfected with miR-155inhibitor, is transfected with miR-27b-5p mimics, is transfected with miR-450a inhibitor, and is simultaneously transfected with miR-155inhibitor, miR-27b-5p mimics and miR-450a inhibitor is collected, the cell is washed and then is fixed by ethanol, the cell is re-suspended and filtered, and is dyed by adopting PI staining solution, and then, the detection is carried out by adopting a flow cytometer;

in the apoptosis detection, different quadrants in a flow cytometry detection result graph represent different meanings, Q1-1(annexin V-FITC) -/PI + represents necrotic cells, Q1-2(annexin V + FITC) +/PI + represents middle and late apoptotic cells, Q1-4(annexin V-FITC) +/PI-represents early apoptotic cells, Q1-3(annexin V-FITC) -/PI-represents normal living cells, the percentage of each quadrant represents the proportion of corresponding cells, and the total apoptosis rate of the cells is the middle and late apoptosis rate plus the early apoptosis rate.

7. Results of the experiment

The transfection result shows that the expression level of the blank control group miR-155 is set as 1 as a reference, compared with the expression level (relative expression amount is 1) of the blank control group miR-155 and the expression level of the negative control group (NC group) miR-155 transfected with inhibitor-NC, the expression level of the miR-155 of the experimental group transfected with miR-155inhibitor is obviously reduced, the difference has statistical significance (P is less than 0.05), and the blank control group and the negative control group have no obvious difference (see figure 4A);

the transfection result shows that, with the expression level of the blank control group miR-27B-5P as a reference set as 1, compared with the expression level of the blank control group miR-27B-5P (the relative expression level is 1) and the expression level of the negative control group miR-27B-5P of the transfection mimics-NC (the NC group), the expression level of the miR-27B-5P of the experimental group of the transfection miR-27B-5P mimics is obviously up-regulated, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no obvious difference (see figure 4B);

the transfection result shows that, when the expression level of the blank control group miR-450a is set as 1 as a reference, compared with the expression level (relative expression level is 1) of the blank control group miR-450a and the expression level of the negative control group (NC group) miR-450a transfected with inhibitor-NC, the expression level of miR-450a of the experimental group transfected with miR-450a inhibitor is significantly reduced, and the difference has statistical significance (P < 0.05), while the blank control group and the negative control group have no significant difference (see FIG. 4C);

the result of an apoptosis experiment shows that the total apoptosis rate (10.16%) of the cells of the experimental group transfected with the miR-155inhibitor is significantly higher than that of a blank control group (3.00%) and a negative control group (3.17%) (see Table 9 and FIG. 5A, FIG. 5B and FIG. 5C), which indicates that miR-155 can influence the apoptosis capacity of melanoma cells, and the inhibition of the expression level of miR-155 can promote the apoptosis of the melanoma cells;

the result of an apoptosis experiment shows that the total apoptosis rate (10.01%) of cells of an experimental group transfected with miR-27B-5p mimics is significantly higher than that of a blank control group (3.00%) and a negative control group (3.17%) (see Table 9 and FIGS. 5A, 5B and 5D), and the miR-27B-5p can influence the apoptosis capacity of melanoma cells, and the increase of the expression level of miR-27B-5p can promote the apoptosis of the melanoma cells;

the result of an apoptosis experiment shows that the total apoptosis rate (10.26%) of cells of an experimental group transfected with miR-450a inhibitor is significantly higher than that of a blank control group (3.00%) and a negative control group (3.17%) (see Table 9 and FIGS. 5A, 5B and 5E), which indicates that miR-450a can influence the apoptosis capacity of melanoma cells, and the inhibition of the expression level of miR-450a can promote the apoptosis of the melanoma cells;

the results of apoptosis experiments showed that the total apoptosis rate (45.39%) of cells of the experimental group co-transfected with miR-155inhibitor and miR-27b-5p mimics and miR-450a inhibitor was significantly higher than that of the experimental group transfected with miR-155inhibitor alone (10.16%) and that of the experimental group transfected with miR-27b-5p mimics alone (10.01%) and that of the experimental group transfected with miR-450a inhibitor alone (10.26%) (see Table 9 and FIG. 5C, FIG. 5D, FIG. 5E, and FIG. 5F);

in addition, the cell inhibition ratios of the respective groups were calculated, and the results obtained by the calculation are shown in table 10, using the formula q ═ E_A+B+C/(E_A+E_B+E_C-E_A×E_B×E_C) Judging whether the effect of the three components has a synergistic effect, wherein E_A+B+CIs the inhibition rate of miR-155inhibitor + miR-27b-5p mimics + miR-450a inhibitor on melanoma cells, E_AIs the inhibition rate of miR-155inhibitor on melanoma cells, E_BIs the inhibition rate of miR-27b-5p mimics on melanoma cells, E_CThe inhibition rate of miR-450a inhibitor on melanoma cells is shown; if q is 0.85-1.15, the superposition is simple, 1.1The synergy is that q is more than 5 and less than 20, the obvious synergy is that q is more than 20, the antagonism is that q is less than 0.85, namely that the promoting effect of the miR-155inhibitor, the miR-27b-5p mimics and the miR-450a inhibitor on the apoptosis of melanoma cells can be judged to be the synergistic effect when q is more than 1.15, and the synergistic effect is not the simple superposition;

according to the results of the cell inhibition rates calculated in table 10, the synergy q value was calculated by using the kindred formula, whether the combined effect of the miR-155inhibitor, the miR-27b-5p mimics and the miR-450a inhibitor is a synergistic effect or not was evaluated, and the results of the cell inhibition rates calculated were substituted to find that q ═ E_A+B+C/(E_A+E_B+E_C-E_A×E_B×E_C) 0.4239/(0.0716+0.0701+0.0726-0.0716 × 0.0701 × 0.0726) ═ 1.982, namely q ═ 1.982, q > 1.15, shows that the combined promotion effect of the miR-155inhibitor, the miR-27b-5p mimics and the miR-450a inhibitor on the apoptosis of melanoma cells is a synergistic effect, and further proves that the combined promotion effect of the miR-155inhibitor, the miR-27b-5p mimics and the miR-450a inhibitor is synergistic treatment instead of simple additive effect.

TABLE 9 statistics of results of apoptosis experiments

TABLE 10 calculation results of cytostatic rates of the respective groups

The above description of the embodiments is only intended to illustrate the method of the invention and its core idea. It should be noted that, for those skilled in the art, without departing from the principle of the present invention, several improvements and modifications can be made to the present invention, and these improvements and modifications will also fall into the protection scope of the claims of the present invention.

Sequence listing

<110> Hebei Limited Corp medical laboratory services

Beijing Baiao Cisco biomedical technology Co., Ltd

<120> melanoma-associated biomarker and application thereof in diagnosis and treatment

<141> 2021-10-13

<160> 18

<170> SIPOSequenceListing 1.0

<210> 1

<211> 24

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

aaccccuauc acgauuagca uuaa 24

<210> 2

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

agagcuuagc ugauugguga ac 22

<210> 3

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 3

guucaccaau cagcuaagcu cu 22

<210> 4

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 4

auauuaggaa cacaucgcaa aa 22

<210> 5

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

caguacuuuu guguaguaca aa 22

<210> 6

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 6

uuuguacuac acaaaaguac ug 22

<210> 7

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 7

caguacuuuu guguaguaca aa 22

<210> 8

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 8

ttaatgctaa tcgtgatagg 20

<210> 9

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 9

ctcaactggt gtcgtg 16

<210> 10

<211> 19

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 10

agagcttagc tgattggtg 19

<210> 11

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 11

ctcaactggt gtcgtg 16

<210> 12

<211> 20

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 12

ttttgcgatg tgttcctaat 20

<210> 13

<211> 16

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 13

ctcaactggt gtcgtg 16

<210> 14

<211> 25

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 14

gcttcggcag cacatatact aaaat 25

<210> 15

<211> 23

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 15

cgcttcacga atttgcgtgt cat 23

<210> 16

<211> 65

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 16

cuguuaaugc uaaucgugau agggguuuuu gccuccaacu gacuccuaca uauuagcauu 60

aacag 65

<210> 17

<211> 22

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 17

agagcuuagc ugauugguga ac 22

<210> 18

<211> 91

<212> RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 18

aaacgauacu aaacuguuuu ugcgaugugu uccuaauaug cacuauaaau auauugggaa 60

cauuuugcau guauaguuuu guaucaauau a 91

Claims

1. Application of a reagent for detecting the expression level of a biomarker in preparation of a product for diagnosing melanoma is characterized in that the biomarker is miR-155, miR-27b-5p and miR-450 a.

2. The use according to claim 1, wherein the agent is selected from the group consisting of:

3. The application of claim 2, wherein the sequences of primers for specific amplification of the biomarkers miR-155, miR-27b-5p and miR-450a are shown in SEQ ID NO 8-SEQ ID NO 9, SEQ ID NO 10-SEQ ID NO 11 and SEQ ID NO 12-SEQ ID NO 13, respectively.

4. Use according to claim 1, characterized in that the product comprises: and (3) detecting the expression levels of the biomarkers miR-155, miR-27b-5p and miR-450a by real-time quantitative PCR, RT-PCR, in-situ hybridization, a chip or a high-throughput sequencing platform.

5. A product for diagnosing melanoma, which comprises a reagent for detecting the expression levels of biomarkers miR-155, miR-27b-5p and miR-450 a.

6. The product of claim 5, wherein the product comprises a chip, a kit;

7. The application of the biomarker in the preparation of the pharmaceutical composition for treating melanoma is characterized in that the biomarker is miR-155, miR-27b-5p and miR-450 a.

8. The use of claim 7, wherein the pharmaceutical composition comprises an inhibitor for decreasing the expression level of miR-155, a promoter for increasing the expression level of miR-27b-5p, an inhibitor for decreasing the expression level of miR-450 a;

9. A method for screening a candidate drug for preventing and/or treating melanoma, comprising the steps of:

10. The application of the biomarker in screening candidate drugs for preventing and/or treating melanoma is characterized in that the biomarker is miR-155, miR-27b-5p and miR-450 a.