CN113755464A

CN113755464A - LrUGT2 protein participating in biosynthesis of cinnamic glycoside B and verbascoside as well as encoding gene and application thereof

Info

Publication number: CN113755464A
Application number: CN202110989121.3A
Authority: CN
Inventors: 刘涛; 杨一涵; 庄以彬; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2021-08-26
Filing date: 2021-08-26
Publication date: 2021-12-07
Anticipated expiration: 2041-08-26
Also published as: CN113755464B

Abstract

The invention provides an LrUGT2 protein participating in biosynthesis of cinnamic glycoside B and acteoside, and a coding gene and application thereof. Specifically, the invention provides an LrUGT2 protein which can catalyze the rhamnosylation reaction of the C-3 carbon atom of the glucose group of cinnamic glycoside A and akebia quinata phenylethanoid glycoside A. The LrUGT2 protein of the invention provides wide application space for improving the content of target components or directly producing effective components or intermediates by using biotechnology.

Description

LrUGT2 protein participating in biosynthesis of cinnamic glycoside B and verbascoside as well as encoding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to a LrUGT2 protein participating in biosynthesis of cinnamic glycoside B and verbascoside, and a coding gene and application thereof.

Background

The lobular broadleaf holly leaf is a traditional plant medicinal tea widely drunk in China, and the raw material of the lobular broadleaf holly leaf is Ligustrum robustum which is planted in Guizhou, Yunnan, Sichuan and other places. The traditional medicine considers that the traditional Chinese medicine has the effects of dispelling wind heat, clearing head and eyes and removing polydipsia, and can be used for treating headache, toothache, conjunctival congestion, fever polydipsia, dysentery and other symptoms. Modern researches show that the broadleaf holly leaf has a certain effect of preventing diseases such as hypertension, hyperlipidemia, hyperglycemia, obesity and the like frequently occurring in modern society. Chemical research shows that the phenylethanoid glycosides compounds are considered as the main effective components of the lobular ilex. At present, more than 20 compounds are separated and identified from ligustrum robustum. The compounds are reported from various medicinal plants all over the world, such as cistanche, echinacea angustifolia, plantain, olive and other plants, and are proved to have various biological activities of antibiosis, anti-inflammation, antioxidation, immunoregulation, memory enhancement and the like. The compounds take salidroside as an initial structure, form a complex molecular structure through multi-step glycosylation and acyl, and can be divided into mono-glycoside, diglycoside, triglycoside and the like according to the number of sugar groups. Among them, the phenylethanoid glycosides compounds in which rhamnose is substituted at the 3-OH position of the parent nuclear glucose are the most representative, and the compounds widely studied include verbascoside, echinacoside and ligustrazine A (fig. 1).

With the development of molecular biology, physiology, biochemistry and other disciplines, research on plant secondary metabolites is increasingly intensive. However, plant secondary metabolites are diverse and diverse in structure, and secondary metabolic pathways are also diverse and complex, and many pathways are still unclear at present or are only rough routes for synthetic pathways.

Therefore, there is an urgent need in the art to develop a clone-related enzyme that can increase the content of a target component or directly produce an active ingredient or an intermediate.

Disclosure of Invention

The invention aims to provide an LrUGT2 protein participating in biosynthesis of cinnamic glycoside B and acteoside, and a coding gene and application thereof.

A first aspect of the invention provides an isolated LrUGT2 polypeptide selected from the group consisting of:

a) polypeptides having amino acid sequences shown in

SEQ ID NO

1, 3, 5, 7;

b) 1, 3, 5 and 7 through one or several amino acid residues, preferably 1-50, more preferably 1-30, more preferably 1-10, most preferably 1-6, and has catalytic activity of cinnamic leaf glycoside A and akebia phenethyl alcohol glycoside A;

(c) a derivative protein having the sequence of the protein of (a) or (b);

(d) the homology of the amino acid sequence and the amino acid sequences shown in SEQ ID NO. 1, 3, 5 and 7 is more than or equal to 65 percent (preferably more than or equal to 80 percent, more preferably more than or equal to 90 percent, such as more than or equal to 95 percent and more than or equal to 99 percent), and has the derived protein for catalyzing the activity of the cinnamic-leaf glycosides A and the akebia-stem phenylethanoid glycosides A.

In another preferred embodiment, the sequence (c) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a) or (b).

In another preferred embodiment, the LrUGT2 polypeptide is from the order labiatae, preferably, from one or more plants selected from the group consisting of: ligustrum robustum, olive, sesame and rehmannia.

In a preferred embodiment, the amino acid sequence of the LrUGT2 polypeptide is shown in

SEQ ID NOs

1, 3, 5, 7.

In a second aspect, the present invention provides an isolated polynucleotide selected from the group consisting of:

(a) a nucleotide sequence for encoding the LrUGT2 polypeptide shown in SEQ ID NO. 1, 3, 5 and 7;

(b) a nucleotide sequence shown as

SEQ ID NO

2, 4, 6 or 8;

(c) nucleotide sequences having a homology of 75% or more (preferably 80% or more, more preferably 90% or more, for example 95% or more, 99% or more) with the sequence shown in

SEQ ID NO

2, 4, 6 or 8;

(d) a nucleotide sequence formed by truncating or adding 1-60 (preferably 1-30, more preferably 1-10) nucleotides at the 5 'end and/or the 3' end of the nucleotide sequence shown in SEQ ID NO. 2, 4, 6 or 8;

(e) a nucleotide sequence complementary, preferably fully complementary, to a nucleotide sequence as set forth in any one of (a) - (d).

In a preferred embodiment, the nucleotide sequence is shown in SEQ ID NO 2.

In another preferred embodiment, the polynucleotide having the sequence shown in SEQ ID NO. 2, 4, 6 or 8 encodes a polypeptide having the amino acid sequence shown in SEQ ID NO. 1.

In a third aspect, the present invention provides a recombinant vector comprising a polynucleotide according to the second aspect of the invention.

In some embodiments, the vector is selected from the group consisting of: an expression vector, a shuttle vector, an integration vector, or a combination thereof.

In other embodiments, the carrier is selected from the group consisting of: bacterial plasmids, bacteriophage, yeast plasmids, plant cell viruses, animal cell viruses, retroviruses, or combinations thereof.

In a preferred embodiment, the vector comprises a vector for expression in E.coli, such as a pET series vector.

In a fourth aspect, the invention provides a genetically engineered host cell comprising a recombinant vector according to the third aspect of the invention, or having integrated into its genome a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the host cell is a prokaryotic cell or a eukaryotic cell. More preferably, the host cell is selected from the group consisting of: bacteria, yeast, higher plant, insect or mammalian cells. In some embodiments, the host cell is a lower eukaryotic cell, such as a yeast cell. In other embodiments, the host cell is a higher eukaryotic cell, such as a mammalian cell. In other embodiments, the host cell is a prokaryotic cell, such as a bacterial cell, preferably, E.coli.

In a fifth aspect, the present invention provides a method for preparing LrUGT2 polypeptide, the method comprising:

(a) culturing the host cell of the fourth aspect of the invention under conditions suitable for expression;

(b) isolating the LrUGT2 polypeptide from the culture.

In a sixth aspect, the invention provides the use of LrUGT2 polypeptide or derivative polypeptide thereof according to the first aspect of the invention, a vector according to the third aspect of the invention, or a host cell according to the fourth aspect of the invention, for catalysing the following reaction, or for the preparation of a catalytic agent for catalysing the following reaction: carrying out rhamnosylation reaction on the carbon atom at the 3' -position of the glucose group of the cinnamic glycoside A to generate the cinnamic glycoside B. Or performing rhamnosylation reaction on the carbon atom at the 3' -position of the glucose group of akebia quinata phenylethanoid glycoside A to generate acteoside.

The seventh aspect of the present invention provides a method of catalyzing a reaction, comprising the steps of: carrying out a catalytic reaction of hydroxylation of carbon atom at 3' position of glucose group of cinerin A in the presence of the polypeptide of the first aspect of the invention or its derivative polypeptide.

In another preferred embodiment, the method further comprises adding the polypeptide and its derivative polypeptide separately to a catalytic reaction; and/or adding the polypeptide and its derivative polypeptide simultaneously to the catalytic reaction.

In a further preferred embodiment, the method further comprises: an additive for regulating the activity of the enzyme is provided to the reaction system.

In other embodiments, the additive for modulating enzyme activity is: additives for increasing or inhibiting the activity of an enzyme. In another preferred embodiment, the additive for regulating the enzymatic activity is selected from the group consisting of: ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺。

In a preferred embodiment, the pH of the reaction system is: 6.5-8.5, preferably pH 7.4-7.6.

In other preferred embodiments, the temperature of the reaction system is: from 25 ℃ to 35 ℃, preferably from 28 ℃ to 30 ℃.

In other preferred embodiments, the reaction time is 0.5h to 24h, preferably 1h to 10h, more preferably 2h to 3 h.

The eighth aspect of the invention provides a preparation method of cinnamic glycoside B and verbascoside, which comprises the following steps:

catalyzing cinnamic glycoside A in the presence of the polypeptide of the first aspect of the invention or a polypeptide derived therefrom to obtain cinnamic glycoside B, or catalyzing akebia stem phenethyl glycoside A to obtain verbascoside; the reaction principle is represented by the following formula:

it is understood that within the scope of the present invention, the above-mentioned technical features of the present invention and the technical features described in detail below (for example, in the embodiments) can be combined with each other to form a new technical solution, and all of the technical solutions are within the scope of the present invention. Not to be reiterated herein, but to the extent of space.

The inventor of the invention has conducted extensive and intensive research, and found the cinnamic glycoside A glycosyltransferase LrUGT2 from the Ligustrum robustum transcriptome for the first time, which is a key enzyme in the biosynthesis process of cinnamic glycoside B and verbascoside; LrUGT2 can specifically and efficiently catalyze cinerin A into cinerin B, or catalyze akebia stem phenylethanoid glycoside A into verbascoside. The two glycosylation products are closely related to the synthesis of other phenylethanoid glycosides compounds. The invention has important theoretical and practical significance for regulating and producing the plant cinnamic glycoside B and verbascoside and improving the contents of active ingredients of the phenylethanoid glycosides compound cinnamic glycoside B, verbascoside and derivatives thereof in the ligustrum robustum by biotechnology.

Drawings

FIG. 1 shows the structure of cinnamic glycoside A, cinnamic glycoside B, casuarina phenylethanoid glycoside A, verbascoside and their derivatives.

FIG. 2 shows the result of electrophoresis of the gene fragment LrUGT2 amplified by cDNA cloning.

FIG. 3, SDS-PAGE protein electrophoretic detection image of LrUGT 2.

FIG. 4 shows HPLC detection results of conversion products of LrUGT2 in vitro enzyme catalysis reaction with Osmanthus fragrans glycoside A as a substrate.

FIG. 5 shows the MS detection results of the product of LrUGT2 in vitro enzyme catalysis reaction with Osmanthus fragrans glycoside A as substrate.

FIG. 6 shows HPLC detection results of conversion products of LrUGT2 in vitro enzyme catalysis reaction with akebia quinata phenylethanoid glycoside A as a substrate.

FIG. 7 shows the MS detection results of the conversion product of LrUGT2 in vitro enzyme catalysis reaction with akebia quinata phenylethanoid glycoside A as the substrate.

FIG. 8, SDS-PAGE verification of RgUGT prokaryotic expression.

FIG. 9 shows HPLC results of RgUGT catalyzed Osmanthus glycoside A.

FIG. 10, HPLC results of RgUGT catalysis of Mutong phenylethanoid glycoside A.

FIG. 11, SDS-PAGE verification of OlUGT prokaryotic expression.

FIG. 12, HPLC results of OlUGT catalyzed Osmanthus glycoside A.

FIG. 13, results of HPLC of OlUGT catalysis of Mutong phenylethanoid glycoside A.

FIG. 14, SDS-PAGE validation of prokaryotic expression of SiUGT.

FIG. 15 shows HPLC results of SiUGT-catalyzed cinnamic glycoside A.

FIG. 16, HPLC results of SiUGT catalysis of Mutong phenylethanoid glycoside A.

Detailed Description

As used herein, the terms "active polypeptide", "polypeptide of the invention and its derivative polypeptide", "enzyme of the invention", "LrUGT 2 of the invention", all refer to LrUGT2(SEQ ID NO:1) polypeptide and its derivative polypeptide.

As used herein, "isolated polypeptide" means that the polypeptide is substantially free of other proteins, lipids, carbohydrates or other materials with which it is naturally associated. One skilled in the art can purify the polypeptide using standard protein purification techniques. Substantially pure polypeptides are capable of producing a single major band on a non-reducing polyacrylamide gel. The purity of the polypeptide can be further analyzed by amino acid sequence.

The active polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, or a synthetic polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention also includes fragments, derivatives and analogues of the polypeptides. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the polypeptide.

A polypeptide fragment, derivative or analogue of the invention may be (i) a polypeptide in which one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, are substituted, and such substituted amino acid residues may or may not be encoded by the genetic code, or (ii) a polypeptide having a substituent group in one or more amino acid residues, or (iii) a polypeptide in which the mature polypeptide is fused to another compound, such as a compound that increases the half-life of the polypeptide, e.g. polyethylene glycol, or (iv) a polypeptide in which an additional amino acid sequence is fused to the sequence of the polypeptide (e.g. a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or a fusion protein with an antigenic IgG fragment). Such fragments, derivatives and analogs are within the purview of those skilled in the art in view of the teachings herein.

The polynucleotide of the present invention may be in the form of DNA or RNA. The form of DNA includes cDNA, genomic DNA or artificially synthesized DNA. The DNA may be single-stranded or double-stranded. The DNA may be the coding strand or the non-coding strand. The sequence of the coding region encoding the mature polypeptide may be identical to the sequence of the coding region shown in SEQ ID NO. 1 or may be a degenerate variant.

The term "polynucleotide encoding a polypeptide" may include a polynucleotide encoding the polypeptide, and may also include additional coding and/or non-coding sequences.

The present invention also relates to variants of the above polynucleotides which encode polypeptides having the same amino acid sequence as the present invention or fragments, analogs and derivatives of the polypeptides. The variant of the polynucleotide may be a naturally occurring allelic variant or a non-naturally occurring variant. These nucleotide variants include substitution variants, deletion variants and insertion variants. As is known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the polypeptide encoded thereby.

The present invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, and more preferably at least 80% identity between the two sequences. The present invention particularly relates to polynucleotides hybridizable under stringent conditions (or stringent conditions) with the polynucleotides of the present invention.

The invention also relates to nucleic acid fragments which hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides in length. The nucleic acid fragments can be used in nucleic acid amplification techniques (e.g., PCR) to determine and/or isolate polynucleotides encoding LrUGT2 protein.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, more preferably purified to homogeneity.

The full-length nucleotide sequence or its fragment of the present invention can be obtained by PCR amplification, recombination, or artificial synthesis. For PCR amplification, primers can be designed based on the nucleotide sequences disclosed herein, particularly open reading frame sequences, and the sequences can be amplified using commercially available cDNA libraries or cDNA libraries prepared by conventional methods known to those skilled in the art as templates. When the sequence is long, two or more PCR amplifications are often required, and then the amplified fragments are spliced together in the correct order.

Once the sequence of interest has been obtained, it can be obtained in large quantities by recombinant methods. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

In addition, the sequence can be synthesized by artificial synthesis, especially when the fragment length is short. Generally, fragments with long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, DNA sequences encoding the proteins of the present invention (or fragments or derivatives thereof) have been obtained completely by chemical synthesis. The DNA sequence may then be introduced into various existing DNA molecules (or vectors, for example) and cells known in the art. Furthermore, mutations can also be introduced into the protein sequences of the invention by chemical synthesis.

A method of amplifying DNA/RNA using PCR technology is preferably used to obtain the gene of the present invention. Particularly, when it is difficult to obtain a full-length cDNA from a library, it is preferable to use the RACE method (RACE-cDNA terminal rapid amplification method), and primers used for PCR can be appropriately selected based on the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The term "recombinant expression vector" refers to a bacterial plasmid, bacteriophage, yeast plasmid, plant cell virus, mammalian cell virus such as adenovirus, retrovirus, or other vectors well known in the art. Any plasmid or vector may be used as long as it can replicate and is stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translation control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing LrUGT2 polypeptide and encoding DNA sequences and appropriate transcription/translation control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to a suitable promoter in an expression vector to direct mRNA synthesis. Representative examples of such promoters are: lac or trp promoter of E.coli; a lambda phage PL promoter; eukaryotic promoters include CMV immediate early promoter, HSV thymidine kinase promoter, early and late SV40 promoter, LTRs of retrovirus, and other known promoters capable of controlling gene expression in prokaryotic or eukaryotic cells or viruses. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

Furthermore, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences described above, together with appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: escherichia coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, COS, 293 cells, or Bowes melanoma cells.

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase transcription of a gene. Examples include the SV40 enhancer at the late side of the replication origin at 100 to 270 bp, the polyoma enhancer at the late side of the replication origin, and adenovirus enhancers.

It will be clear to one of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of a host cell with recombinant DNA can be carried out using conventional techniques well known to those skilled in the art. When the host is prokaryotic, such as E.coli, competent cells capable of DNA uptake can be harvested after the exponential growth phase and treated by the CaCl method using procedures well known in the art. Another method is to use MgCl 2. If desired, transformation can also be carried out by electroporation. When the host is a eukaryote, the following DNA transfection methods may be used: calcium phosphate coprecipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The obtained transformant can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culturing is performed under conditions suitable for growth of the host cell. After the host cells have been grown to an appropriate cell density, the selected promoter is induced by suitable means (e.g., temperature shift or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed intracellularly or on the cell membrane, or secreted extracellularly. If necessary, the recombinant protein can be isolated and purified by various separation methods using its physical, chemical and other properties. These methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (such as salt precipitation), centrifugation, cell lysis by osmosis, sonication, ultracentrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, High Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques, and combinations thereof.

The invention will be further illustrated with reference to the following specific examples. It should be understood that these examples are for illustrative purposes only and are not intended to limit the scope of the present invention. Experimental procedures without specific conditions noted in the following examples, generally followed by conventional conditions, such as Sambrook et al, molecular cloning: the conditions described in the Laboratory Manual (New York: Cold Spring Harbor Laboratory Press,1989), or according to the manufacturer's recommendations. Unless otherwise indicated, percentages and parts are percentages and parts by weight.

Apparatus, materials and reagents

Mastercycler pro (Eppendorf) was used for PCR.

The isothermal culture was carried out using AN SGSP-03300X 35 isothermal incubator (Hengfeng Huangshi medical instruments Co., Ltd.) and a ZQZY-75AN isothermal shaking incubator (Tianjin Boxin Biotech Co., Ltd.).

Centrifugation used a 5418R high speed refrigerated centrifuge and a 5418 mini centrifuge (Eppendorf).

OD600 was measured using a UV-1800 UV-visible spectrophotometer (Shimadzu).

High performance liquid chromatography was performed using an LC-20AD liquid chromatography system (Shimadzu).

The liquid chromatography-mass spectrometry combination was measured by an Agilent 1200HPLC liquid chromatography system in tandem with a Bruker-MicroTOF-II mass spectrometer.

Ultrasonic cell disruption was performed using a Scientz-IID cell disrupter (Ningbo Xinzhi Biotechnology Co., Ltd.)

Oligonucleotide primers were purchased from Jinzhi Biotechnology, Inc.

Coli strains DH5 alpha, BL21(DE3) and pET-28a (+) vector were used for gene cloning and protein expression.

Standard compounds, cinnamic glycoside B and verbascoside, were purchased from all-purpose phytochemical pure biotechnology, Inc.

The akebia phenylethanoid glycoside a standard was purchased from Chemfaces.

The cinnamic glycoside A is synthesized by the laboratory, and the purity is more than 90 percent.

UDP-rhamnose was purchased from Solebao Biotechnology Ltd.

The gel recovery kit and the plant total RNA extraction kit are purchased from Tiangen Biotechnology Co., Ltd.

The reverse transcription kit TransScript One-step gDNA Removal and cDNA Synthesis Supermix was purchased from Kyoto Seiki GmbH.

Phanta Max ultra high fidelity DNA polymerase was purchased from Novowed Biotech priority.

The seamless cloning kit was purchased from Biyuntian Biotechnology Limited.

Example 1 recombinant preparation of LrUGT2 Gene and protein encoding same

Excavation of LrUGT2 Gene

Sequence analysis was performed on transcriptome data of root and leaf tissues of Ligustrum robustum, and 94 glycosyltransferase candidate genes were found in total. After analyzing the expression quantity and the genetic relationship of the glycosyltransferase candidate gene, LrUGT2 which has the highest leaf expression quantity and low root expression quantity and belongs to a glycosyl-specific glycosyltransferase family is obtained as a candidate gene, and the DNA coding nucleotide sequence and the amino acid of the protein are respectively shown as SEQ ID NO. 2 and SEQ ID NO. 1. Therefore, the inventors of the present invention screened a novel LrUGT2 protein involved in the biosynthesis of cinnamic glycoside B and verbascoside from a species of Ligustrum robustum (ligustum robustum) through the above-mentioned studies.

2. Preparation of cDNA of leaf of Ligustrum robustum

Fresh leaves of plant ligustrum robustum are organized into liquid nitrogen and quick-frozen, a plant total RNA extraction kit of Tiangen is adopted, RNA is extracted according to the operation steps of the kit, and after the RNA is verified to be qualified, the cDNA is prepared by reverse transcription of the RNA by referring to TransScript One-step gDNA Removal and cDNA Synthesis Supermix reverse transcription kit of the whole formula gold.

Cloning of LrUGT2 Gene and construction of expression plasmid

Design and synthesis of primers (upstream primer:CGCGGCAGCCATATGGCTAGCATGTCTGATTTTGAGAA ATCAAAGCTTC, respectively; a downstream primer:TGCGGCCGCAAGCTTGTCGACCTAAAGCTCAGAAAGACTATTGAT GAAATTATC, respectively; underlined parts, base sequences of homologous arms), and a sequence of homologous arm complementary to pET-28a (+) was introduced into the upstream and downstream of the gene, respectively, by PCR amplification using cDNA as a template. PCR amplification System (50. mu.L): 10 μ L of 5 XSF buffer, 1 μ L of dNTP Mix, Primer1/Primer2 to a final concentration of 0.2 μ M; cDNA<200 ng; the remaining volume was made up with sterile distilled water. And (3) PCR reaction conditions: pre-denaturation at 95 ℃ for 2 min, followed by denaturation at 95 ℃ for 30s, annealing at 55 ℃ for 30s, and extension at 72 ℃ for 60s, for 35 cycles.

Agarose gel electrophoresis detected a band of about 1.5kb (FIG. 2), and the target fragment was recovered using the Tiangen gel recovery kit.

The recovered fragment was ligated with NheI and SalI digested pET28a vector using a seamless cloning kit (Biyuntian Biotech Co., Ltd.). Seamless cloning system (20 μ L): 10 μ L of 2X Seamless Cloning Mix, 50ng linearized vector, 10ng recovered fragment; the remaining volume was made up to 20. mu.L with sterile distilled water. Seamless cloning reaction conditions: incubate at 50 ℃ for 30 min.

The seamless cloning product is transformed into escherichia coli DH5 alpha competent cells, plasmids with positive colony PCR verification are sent to Jinzhi biotechnology limited for sequencing, the obtained DNA coding sequences and proteins are respectively shown as SEQ ID NO. 2 and SEQ ID NO. 1, and the recombinant plasmid is pET28a-LrUGT 2.

Expression of LrUGT2

The recombinant plasmid pET28a-LrUGT2 was transformed into competent cells of Escherichia coli BL21(DE3), spread on LB solid medium (kanamycin 50. mu.g/mL), and cultured overnight at 37 ℃ to obtain recombinant strain BL21(DE3)/pET28a-LrUGT 2. Single colonies were picked up in 5mL LB liquid medium (kanamycin 50. mu.g/mL), cultured overnight, transferred to 50mL fresh LB liquid medium, and cultured at 200rpm to OD₆₀₀0.6-0.8, the inducer IPTG was added to a final concentration of 0.1mM, and the culture was continued at 200rpm at 16 ℃ for 20 hours. After BL21(DE3) was transformed with the blank plasmid pET28a, the recombinant strain BL21(DE3)/pET28a was obtained.

After the expression was completed, the expression was examined by SDS-PAGE: the supernatant was discarded by centrifugation (4000rpm, 30min), resuspended in 15mL lysis buffer (50mM Tris-HCl, pH7.5, 100mM NaCl), sonicated on ice to obtain lysate, and subjected to refrigerated centrifugation (12000rpm, 15min, 4 ℃). The cell lysate, supernatant and pellet were separately subjected to SDS-PAGE to verify the protein expression (FIG. 3).

Example 2 in vitro functional characterization of LrUGT2

1. Obtaining crude enzyme liquid of LrUGT2

The single colony BL21(DE3)/pET28a-LrUGT2 was inoculated into 5mL LB liquid medium (containing 50. mu.g/mL), cultured overnight at 37 ℃ and 200rpm, transferred to 50mL of fresh LB medium, cultured at 37 ℃ and 200rpm until OD600 became 0.6-0.8, then IPTG was added to a final concentration of 0.1mM, and the culture was continued at 16 ℃ and 200rpm for 20 hours. The BL21(DE3) recombinant strain carrying pET28a was used as a blank control, and the procedure was as above. Centrifuging to collect bacteria, using 15mL lysis buffer for resuspension, carrying out ultrasonic disruption in an ice-water mixture, and centrifuging at 12000rpm for 15min to obtain a supernatant which is the crude enzyme liquid of LrUGT 2.

2. Crude enzyme catalyzed reaction

The total volume of the crude enzyme reaction system is 100 mu L, and the crude enzyme reaction system comprises: 0.1mM of cinnamic glycoside A or akebia quinata phenethyl alcohol glycoside A, 1mM of UDP-rhamnose, 50 μ L of LrUGT2 crude enzyme solution, and the volume is made up to 100 μ L by using lysis buffer. After mixing the system, the reaction was carried out at 30 ℃ for 6 hours, and 100. mu.L of methanol was added to terminate the reaction. After centrifugation (12000rpm, 10min) of the reaction mixture, product analysis was performed using HPLC and LC-MS.

3. Product detection

The HPLC detection parameters were as follows: column SilGreen C18(5 μm, 4.6X 250 mm); the column temperature is 40 ℃; intercepting the wavelength to be 312 nm; the mobile phase consists of solution A (0.1% formic acid aqueous solution) and solution B (acetonitrile), and the gradient elution method comprises the following steps: maintaining 18% of mobile phase B at 0-5min, and increasing the content of mobile phase B from 18% to 21% at 5-35min with flow rate of 1 ml/min.

For LC-MS analysis, mobile phase A was changed to an aqueous solution containing 5mM ammonium acetate, and the remaining chromatographic conditions were unchanged. The mass spectrometry conditions were as follows: the chemical mode is Electrospray (ESI) negative ions, the capillary voltage is 4500V, the atomization gas pressure is 1bar, the desolvation gas is nitrogen, the flow rate is 6.0L/min, the desolvation temperature and the ion source temperature are both 180 ℃, the scanning range m/z is 50-1000, the LC-MS data collection software is MassLynx 4.0(Waters, USA), and sodium trifluoroacetate is used as a correction fluid for accurate molecular weight.

The HPLC result of the catalytic cinerin A by the LrUGT2 is shown in figure 4, and an absorption peak (RT ═ 24.8min) of cinerin B appears in a reaction system of the crude enzyme LrUGT2, while a blank strain BL21(DE3)/pET28a does not appear, which indicates that the LrUGT2 can effectively convert a substrate cinerin A to generate a new product. Precise molecular weight ([ M-H) of this compound as detected by LC-MS (FIG. 5)]^-591.2123) is the exact molecular weight of cinnamic glycoside a plus one rhamnosyl group. Therefore, the product is identified as the cinerin B. Using the reaction system described above, the final conversion of the reaction was 94.96%.

The HPLC result of the catalysis of Lardizabalamin A by LrUGT2 is shown in FIG. 6, and the absorption peak (RT ═ 10.1min) of verbascoside appears in the reaction system of LrUGT2 crude enzyme, while the blank strain BL21(DE3)/pET28a does not appear, which indicates that LrUGT2 can effectively convert the substrate Lardbalamin A into a new product. The exact molecular weight of this compound ([ M-H ] - ═ 623.1488) was determined by LC-MS (fig. 7) as the exact molecular weight of akenylethanoid a plus one rhamnosyl group. Thus, the product was identified as verbascoside. Using the above reaction system, the final conversion of the reaction was 2.41%.

Example 3 in vitro functional characterization of the homologous Gene RgUGT of LrUGT2

RgUGT sequence acquisition

The homologous gene of LrUGT2 is searched by using a local Blastp program for the Rehmannia (Rehmannia glutaminosa) transcriptome data, the homologous gene with the consistency of more than 80 percent is obtained and is called RgUGT, and the DNA coding sequence and the protein sequence are respectively shown as SEQ ID NO:4 and SEQ ID NO: 3.

RgUGT prokaryotic expression and crude enzyme liquid acquisition

The DNA coding sequence for RgUGT was synthesized by Biotech, and cloned between the NheI and SalI sites of pET-28a (+) vector to give plasmid pET28 a-RgUGT. The recombinant plasmid pET28a-RgUGT was transformed into competent cells of E.coli BL21(DE3), spread on LB solid medium (kanamycin 50. mu.g/mL), and cultured overnight at 37 ℃ to obtain the recombinant strain BL21(DE3)/pET28 a-RgUGT. After overnight culture, the single colonies were transferred to 50mL of fresh LB liquid medium, cultured at 200rpm until OD600 became 0.6-0.8, and then cultured with IPTG (inducer) at 200rpm and 16 ℃ for 20 hours. After BL21(DE3) was transformed with the blank plasmid pET28a, the recombinant strain BL21(DE3)/pET28a was obtained. After the expression was completed, the expression was examined by SDS-PAGE: the supernatant was discarded by centrifugation (4000rpm, 30min), resuspended in 15mL lysis buffer (50mM Tris-HCl, pH7.5, 100mM NaCl), sonicated on ice to obtain lysate, and subjected to refrigerated centrifugation (12000rpm, 15min, 4 ℃). The cell lysate, supernatant and pellet were separately subjected to SDS-PAGE to verify the protein expression (FIG. 8).

The supernatant is the RgUGT crude enzyme solution. The total volume of the crude enzyme reaction system is 100 mu L, and the crude enzyme reaction system comprises: 0.1mM of cinnamic glycoside A or akebia quinata phenethyl alcohol glycoside A, 1mM of UDP-rhamnose, 50 μ L of LrUGT2 crude enzyme solution, and the volume is made up to 100 μ L by using lysis buffer. After mixing the system, the reaction was carried out at 30 ℃ for 6 hours, and 100. mu.L of methanol was added to terminate the reaction. After centrifugation (12000rpm, 10min) of the reaction mixture, product analysis was performed using HPLC.

3. Product detection

The HPLC result of RgUGT catalysis of the cinnamic glycoside A is shown in figure 9, and the absorption peak (RT is 24.8min) of the cinnamic glycoside B appears in the reaction system of RgUGT crude enzyme, while the blank strain BL21(DE3)/pET28a does not appear, which indicates that RgUGT can effectively convert the substrate cinnamic glycoside A to generate the cinnamic glycoside B. Using the above reaction system, the final conversion of the reaction was 95.23%.

The HPLC result of the RgUGT catalysis of the akebia saponin A is shown in figure 10, and the absorption peak (RT ═ 10.1min) of the verbascoside appears in the reaction system of the crude enzyme of the RgUGT, while the blank strain BL21(DE3)/pET28a does not appear, which indicates that the RgUGT can effectively convert the substrate akebia saponin A to generate the verbascoside. Using the above reaction system, the final conversion of the reaction was 18.36%.

Example 4 in vitro functional characterization of the homologous Gene OlUGT of LrUGT2

OlUGT sequence acquisition

In the homologous gene of LrUGT2, the protein sequence from Olea europaea is more than 80% identical to LrUGT2 and is respectively called as OlUGT, and the DNA coding sequence and the protein sequence are respectively shown as SEQ ID NO. 6 and 5 in NCBI by using a Blastp program.

OlUGT prokaryotic expression and crude enzyme liquid acquisition

The DNA coding sequence for OlUGT was synthesized by Biotech, and cloned into pET-28a (+) vector between NheI and SalI cleavage sites to obtain plasmid pET28 a-OlUGT. The recombinant plasmid pET28a-OlUGT was transformed into competent cells of E.coli BL21(DE3), spread on LB solid medium (kanamycin 50. mu.g/mL), and cultured overnight at 37 ℃ to obtain the recombinant strain BL21(DE3)/pET28 a-OlUGT. After overnight culture, the single colonies were transferred to 50mL of fresh LB liquid medium, cultured at 200rpm until OD600 became 0.6-0.8, and then cultured with IPTG (inducer) at 200rpm and 16 ℃ for 20 hours. After BL21(DE3) was transformed with the blank plasmid pET28a, the recombinant strain BL21(DE3)/pET28a was obtained. After the expression was completed, the expression was examined by SDS-PAGE: the supernatant was discarded by centrifugation (4000rpm, 30min), resuspended in 15mL lysis buffer (50mM Tris-HCl, pH7.5, 100mM NaCl), sonicated on ice to obtain lysate, and subjected to refrigerated centrifugation (12000rpm, 15min, 4 ℃). The cell lysate, supernatant and pellet were separately subjected to SDS-PAGE to verify the protein expression (FIG. 11).

The supernatant is the crude OlUGT enzyme solution. The total volume of the crude enzyme reaction system is 100 mu L, and the crude enzyme reaction system comprises: 0.1mM of cinnamic glycoside A or akebia quinata phenethyl alcohol glycoside A, 1mM of UDP-rhamnose, 50 μ L of LrUGT2 crude enzyme solution, and the volume is made up to 100 μ L by using lysis buffer. After mixing the system, the reaction was carried out at 30 ℃ for 6 hours, and 100. mu.L of methanol was added to terminate the reaction. After centrifugation (12000rpm, 10min) of the reaction mixture, product analysis was performed using HPLC.

3. Product detection

The HPLC result of the Osmanthus glycoside A catalyzed by OlUGT is shown in figure 12, and the reaction system of crude OlUGT enzyme has an absorption peak of Osmanthus glycoside B (RT is 24.8min), while a blank strain BL21(DE3)/pET28a does not appear, which indicates that OlUGT can effectively convert the substrate Osmanthus glycoside A to generate Osmanthus glycoside B. Using the reaction system described above, the final conversion of the reaction was 94.31%.

The HPLC result of the Akebetoside A catalyzed by OlUGT is shown in FIG. 13, and the reaction system of crude enzyme of OlUGT has a verbascoside absorption peak (RT ═ 10.1min), while the blank strain BL21(DE3)/pET28a does not appear, which indicates that OlUGT can effectively convert the substrate Akebetoside A into verbascoside. Using the above reaction system, the final conversion of the reaction was 2.34%.

Example 5 in vitro functional characterization of homologous Gene SiUGT of LrUGT2

SiUGT sequence acquisition

In the homologous gene of LrUGT2 searched by the Blastp program on NCBI, the consistency of the protein sequence of sesame [ Sesamum indicum ] and LrUGT2 is more than 80 percent and is respectively called SiUGT, and the DNA coding sequence and the protein sequence are respectively shown as SEQ ID NO:8 and 7.

Expressing and obtaining crude enzyme liquid by SiUGT pronucleus

The DNA coding sequence of SiUGT was synthesized by Biotech, and cloned between the NheI and SalI sites of pET-28a (+) vector to obtain plasmid pET28 a-SiUGT. The recombinant plasmid pET28a-SiUGT was transformed into competent cells of Escherichia coli BL21(DE3), spread on LB solid medium (kanamycin 50. mu.g/mL), and cultured overnight at 37 ℃ to obtain recombinant strain BL21(DE3)/pET28 a-SiUGT. After overnight culture, the single colonies were transferred to 50mL of fresh LB liquid medium, cultured at 200rpm until OD600 became 0.6-0.8, and then cultured with IPTG (inducer) at 200rpm and 16 ℃ for 20 hours. After BL21(DE3) was transformed with the blank plasmid pET28a, the recombinant strain BL21(DE3)/pET28a was obtained. After the expression was completed, the expression was examined by SDS-PAGE: the supernatant was discarded by centrifugation (4000rpm, 30min), resuspended in 15mL lysis buffer (50mM Tris-HCl, pH7.5, 100mM NaCl), sonicated on ice to obtain lysate, and subjected to refrigerated centrifugation (12000rpm, 15min, 4 ℃). The cell lysate, supernatant and pellet were separately subjected to SDS-PAGE to verify the protein expression (FIG. 14).

The supernatant is SiUGT crude enzyme solution. The total volume of the crude enzyme reaction system is 100 mu L, and the crude enzyme reaction system comprises: 0.1mM of cinnamic glycoside A or akebia quinata phenethyl alcohol glycoside A, 1mM of UDP-rhamnose, 50 μ L of LrUGT2 crude enzyme solution, and the volume is made up to 100 μ L by using lysis buffer. After mixing the system, the reaction was carried out at 30 ℃ for 6 hours, and 100. mu.L of methanol was added to terminate the reaction. After centrifugation (12000rpm, 10min) of the reaction mixture, product analysis was performed using HPLC.

3. Product detection

The HPLC result of SiUGT catalysis of the cinnamic glycoside A is shown in figure 15, and the absorption peak (RT ═ 24.8min) of the cinnamic glycoside B appears in the reaction system of the crude enzyme of SiUGT, while the blank strain BL21(DE3)/pET28a does not appear, which indicates that the SiUGT can effectively convert the substrate cinnamic glycoside A to generate the cinnamic glycoside B. Using the above reaction system, the final conversion of the reaction was 93.1%.

The HPLC result of SiUGT catalysis of akebia saponin A is shown in figure 16, and the SiUGT crude enzyme reaction system has a verbascoside absorption peak (RT ═ 10.1min), while the blank strain BL21(DE3)/pET28a does not appear, which indicates that SiUGT can effectively convert the substrate akebia saponin A to generate verbascoside. Using the above reaction system, the final conversion of the reaction was 1.94%.

All documents referred to herein are incorporated by reference into this application as if each were individually incorporated by reference. Furthermore, it should be understood that various changes and modifications of the present invention can be made by those skilled in the art after reading the above teachings of the present invention, and these equivalents also fall within the scope of the present invention as defined by the appended claims.

Sequence listing

<110> institute of biotechnology for Tianjin industry of Chinese academy of sciences

<120> LrUGT2 protein participating in biosynthesis of cinnamic glycoside B and verbascoside, and coding gene and application thereof

<160> 10

<170> PatentIn version 3.5

<210> 1

<211> 456

<212> PRT

<213> Ligustrum robustum

<400> 1

MSDFEKSKLHLAMFPWLAMGHITPFIHLSNELAKRGHKISFLLPNKALIQLGNNNFYPDLIKFHVVAVPQVEGLPPGAETASDIDITGKNPLAIAFDSMAEQVEVLLSELKPDFVFYDFADWIPKLATKLGFKTICYNVICASCLAIGIVPARKIPKDRPLTVEELMEPPKGYPSSTVVLRGQEARTLSFIAMVYGATTFDVRITAAMKGCDAISIRTCQELEGPMCDYLSSQYGKPVILTGPVLPVTPKGQLEEKWDKWLNQFEPKSVVYCAFGSQLILQQNQFQELVLGFEMSGLPFFIALSKPAGANSIEEALPEGFEERVKGRGVVYGGWVQQTQILSHPSVGCFVSHCGFGSMWESLLSDSQIVLVPRLADQILNTRLLAEELKVAVEVERGDMGWFSKEDLCKAIKSVMDKDSEIGNLIRRNHSKWKETLVSPGFMDNYIDNFINSLSEL 456

<210> 2

<211> 1371

<212> DNA

<213> Ligustrum robustum

<400> 2

ATGTCTGATTTTGAGAAATCAAAGCTTCATCTTGCCATGTTCCCATGGCTAGCCATGGGGCACATAACTCCATTCATCCATCTATCCAATGAGCTAGCTAAGAGAGGCCATAAGATCAGCTTCTTGTTGCCGAATAAGGCTTTGATTCAATTGGGCAACAACAACTTTTACCCAGATTTAATCAAGTTCCATGTTGTTGCTGTTCCTCAAGTTGAAGGCCTGCCACCGGGTGCAGAAACTGCTTCTGATATAGACATCACTGGCAAGAATCCACTCGCTATAGCCTTTGATTCCATGGCTGAACAAGTTGAGGTCTTGTTGAGTGAATTGAAGCCTGATTTTGTGTTCTATGATTTTGCCGATTGGATTCCCAAATTGGCTACCAAGCTTGGGTTCAAGACTATTTGTTATAATGTTATTTGTGCTTCTTGTTTAGCTATTGGGATTGTTCCGGCCAGGAAAATTCCCAAAGACAGGCCTTTGACTGTGGAGGAGCTGATGGAGCCACCCAAAGGGTACCCTTCTTCCACGGTGGTGCTCCGTGGGCAGGAGGCACGTACCTTATCATTCATAGCTATGGTTTACGGCGCAACCACTTTTGATGTGCGTATCACTGCTGCAATGAAGGGTTGTGATGCGATCTCTATAAGGACTTGCCAAGAATTGGAAGGGCCAATGTGTGATTATTTGTCAAGCCAGTATGGGAAGCCTGTGATTCTAACAGGGCCAGTTTTGCCAGTGACACCCAAAGGACAACTAGAAGAAAAGTGGGACAAATGGCTAAACCAATTTGAGCCAAAATCTGTGGTGTACTGTGCATTTGGGAGCCAATTGATCCTCCAACAGAACCAATTTCAAGAACTTGTATTGGGTTTTGAAATGTCAGGGCTACCATTTTTCATAGCCCTTTCAAAACCAGCAGGAGCAAATTCTATAGAAGAAGCACTGCCGGAGGGTTTCGAAGAGAGGGTCAAAGGAAGAGGGGTTGTCTATGGTGGCTGGGTGCAACAGACTCAGATTCTCAGCCACCCCTCAGTAGGGTGTTTTGTGAGTCATTGTGGTTTTGGATCCATGTGGGAGTCTTTGCTAAGTGACAGCCAAATTGTGCTTGTGCCAAGACTTGCCGACCAAATCTTGAATACACGGCTGCTGGCGGAGGAGCTCAAGGTGGCGGTGGAGGTGGAGAGAGGCGATATGGGATGGTTTTCGAAGGAGGATTTATGCAAGGCCATTAAATCTGTGATGGATAAAGACAGTGAAATTGGAAATTTGATCAGGAGAAACCACTCCAAATGGAAAGAAACTCTGGTAAGCCCAGGATTTATGGACAATTACATAGATAATTTCATCAATAGTCTTTCTGAGCTTTAG 1371

<210> 3

<211> 456

<212> PRT

<213> Rehmannia glutinosa

<400> 3

MPEFEKPKLHITMFPWVAIGHITPFIHLANELAKRGHSISILIPKKAHTQLGHNNLYPDLIKFHIVTVPHVEGLPAGAETASDIDITAKNPLAIAFDAMYEQVETLLYGLKPDIVFYDFADWIPKLAAQIGFKTVCYNVICASCMAIGIVPARHIPKDRPLTEEELMTPPEGYPSSTVVLRGQEARTLSFIGMDYGATKFDVRITAAMQGCDAIGIRTCRELEGPMCDYLSAQYNKPVFLSGPVLPESPKGPLEEKWEKWLNKFEPKSVVYCAFGSQMILQKNQFQELVLGFEMTGLPFFVALSKPHGADSIEEALPEGFLERVGDRGVVHGGWVQQTQILNHQSVGCFVSHCGFGSMWESLLSDSQIVLVPRLADQILNTRLLAEELKVAVEVERGDMGWFSKEDLCKAIKSVMDEESEVGKLVKKNHAKWRETLVSPGYMDNYLEDFIQQLYGL 456

<210> 4

<211> 1371

<212> DNA

<213> Rehmannia glutinosa

<400> 4

ATGCCTGAATTTGAAAAGCCTAAGCTTCACATAACCATGTTCCCATGGGTAGCCATAGGCCACATCACTCCATTCATCCATCTCGCCAACGAGCTCGCCAAAAGAGGCCATTCTATCTCCATTTTGATCCCCAAAAAGGCCCATACTCAGCTCGGCCACAACAATCTCTACCCAGATCTCATCAAATTCCACATCGTCACCGTGCCTCATGTCGAAGGCCTACCTGCCGGCGCCGAGACTGCTTCCGATATCGACATCACCGCCAAAAATCCACTCGCCATAGCCTTCGACGCCATGTACGAACAAGTCGAAACCCTATTGTACGGCCTTAAACCTGACATCGTGTTCTACGATTTCGCCGATTGGATCCCCAAGCTCGCCGCTCAGATTGGCTTCAAAACTGTTTGTTATAATGTCATCTGCGCTTCGTGTATGGCGATTGGTATTGTTCCGGCGAGGCATATCCCGAAAGACCGGCCGTTGACGGAGGAGGAACTGATGACGCCGCCGGAAGGGTACCCTTCGTCCACCGTGGTCCTCCGCGGACAGGAGGCGCGGACTCTGTCTTTCATCGGCATGGATTACGGCGCCACCAAGTTCGACGTGCGTATCACCGCCGCGATGCAGGGCTGCGACGCTATTGGTATTCGTACTTGCCGCGAGCTGGAGGGCCCCATGTGCGATTACTTATCCGCACAGTACAATAAGCCCGTTTTTCTATCCGGCCCGGTTTTGCCGGAGTCTCCTAAAGGCCCGCTGGAGGAGAAATGGGAAAAATGGCTCAACAAATTCGAGCCCAAATCCGTCGTCTACTGCGCTTTCGGAAGCCAAATGATTCTCCAAAAAAATCAATTTCAGGAATTAGTGTTAGGTTTCGAGATGACGGGTTTGCCCTTTTTCGTAGCTCTCTCGAAACCCCACGGCGCGGACTCCATTGAAGAAGCTCTGCCGGAGGGGTTTTTGGAGAGGGTGGGCGATAGAGGAGTGGTCCACGGCGGTTGGGTCCAGCAGACCCAGATCCTGAACCACCAATCAGTGGGCTGCTTCGTGAGCCATTGCGGGTTCGGGTCGATGTGGGAGTCATTGCTGAGTGACAGCCAGATAGTGCTAGTGCCGCGTTTGGCGGATCAGATATTGAACACGCGGCTGCTGGCGGAGGAGCTGAAGGTGGCGGTGGAGGTGGAGAGAGGGGATATGGGGTGGTTTTCCAAGGAGGATTTGTGTAAGGCGATTAAGAGTGTGATGGATGAGGAGAGTGAGGTGGGGAAATTGGTGAAGAAGAATCATGCTAAGTGGAGGGAGACTTTGGTGAGCCCTGGATATATGGATAATTATCTTGAGGATTTTATTCAGCAATTGTATGGGCTTTAA 1371

<210> 5

<211> 456

<212> PRT

<213> Olea europaea

<400> 5

MPDFEKSKLHLVMFPWLAMGHITPFIHLSNELAKRGHKISFLLPKKALIQLGNNNLYPDLIKFHVVAVPQVEGLPPGAETASDIDITGKNPLAIAFDSMAEQVEVLLSDLKPDFVFYDFADWIPKLATKIGFKTICYNVICASCLAIGIVPARKIPKDRPMTVEELMEPPKGYPSSTVVLRGQEARTLSFIAMDYGTTTFDVRITAAMKGCDAISIRTCQELEGPMCDYLSSQYGKPVILTGPVLPETPEGQLEEKWDKWLNQFEPKSVVYCAFGSQLILQKNQFQELVLGFEMTGLPFFIAVSKPAGANSIEEALPEGFEERIEGRGVVYGGWVQQTQILSHPSVGCFVSHCGFGSMWESLLSDSQIVLVPRLADQILNTRLLAEELKVAVEVERGDMGWFSKEDLCKAIKSVMDKDSEIGNLIKKNHSKWKETLVSPGYMDNYIDNFINSLYEL 456

<210> 6

<211> 1371

<212> DNA

<213> Olea europaea

<400> 6

ATGCCTGATTTTGAGAAGTCAAAGCTTCATCTTGTCATGTTCCCATGGCTAGCCATGGGGCACATAACTCCATTCATCCATCTATCCAATGAGTTAGCTAAAAGAGGCCATAAGATCAGCTTCTTGTTGCCCAAAAAGGCTTTGATTCAACTGGGCAACAACAACTTGTACCCAGATTTAATTAAATTCCATGTTGTTGCTGTTCCTCAAGTCGAGGGCCTGCCTCCAGGTGCAGAAACTGCTTCTGATATAGACATCACTGGCAAGAATCCACTGGCTATAGCCTTTGATTCCATGGCTGAACAAGTTGAAGTCTTGTTGAGTGATCTAAAGCCAGATTTTGTGTTCTATGATTTTGCCGATTGGATTCCCAAATTGGCAACCAAGATTGGGTTCAAGACTATTTGTTATAATGTTATTTGTGCTTCTTGTTTGGCTATTGGGATTGTTCCGGCGAGGAAAATTCCCAAAGACAGGCCTATGACGGTGGAGGAACTGATGGAGCCACCCAAAGGGTACCCTTCTTCCACGGTGGTGCTGCGTGGGCAGGAGGCGCGTACCTTATCATTCATAGCTATGGATTACGGCACAACCACTTTTGATGTGCGTATTACGGCTGCAATGAAGGGTTGTGATGCAATCTCTATAAGGACTTGCCAAGAATTGGAAGGGCCAATGTGTGATTATTTGTCAAGCCAGTACGGGAAGCCTGTGATTCTAACAGGGCCGGTTTTGCCAGAGACGCCTGAAGGACAACTAGAAGAAAAGTGGGACAAATGGCTAAACCAATTTGAGCCAAAATCTGTAGTGTACTGTGCATTTGGGAGCCAATTGATCCTCCAAAAGAACCAATTTCAAGAACTTGTATTGGGTTTTGAAATGACAGGGCTACCATTTTTCATAGCCGTTTCGAAACCAGCAGGTGCAAATTCGATAGAAGAAGCACTACCTGAGGGTTTTGAAGAGAGGATCGAAGGTAGAGGGGTTGTTTATGGTGGCTGGGTGCAGCAGACACAGATTCTCAGCCACCCCTCAGTAGGGTGTTTTGTGAGTCATTGTGGTTTTGGATCCATGTGGGAGTCTTTGTTAAGTGACAGCCAAATTGTGCTTGTGCCAAGACTTGCCGACCAAATTTTGAATACACGGCTGCTGGCGGAGGAGCTGAAGGTGGCGGTGGAGGTGGAGAGAGGCGATATGGGGTGGTTTTCGAAGGAGGATTTATGCAAGGCCATTAAATCTGTGATGGATAAAGACAGTGAAATTGGCAATTTGATCAAGAAAAACCACTCCAAGTGGAAAGAAACTTTAGTAAGCCCAGGATATATGGACAATTACATTGATAATTTCATCAACAGTCTTTATGAGCTTTAG 1371

<210> 7

<211> 456

<212> PRT

<213> Sesamum indicum

<400> 7

MPEFEKSKLHIAMFPWVAIGHITPFIHLANELAKRGHSISILIPNKPLLQLGHHSLYPDLIKFHVVTIPQVEGLPPGAETASDIDITAKNPLAIAFDATAEQVETILSGLKPDIVFYDFADWIPKMAARVGFKTVCYNVICASCMAIGIVPARHIPKDRRLTEEELGQPPKGYPSSTVVLRGQEALTLSFIAMDYGATKFDVRITAAMQGCDAIGIRTCRELEGPMCDYLSEQYNKPVFLSGPVLPENPKGALEEKWDKWLSKFKPKSVVYCAFGSQLMLQKKQFQEMVLGFEMTGLPFFVAVSKPHGADSIEEALPEGFLERVGDRGVVHGGWVQQTQGLNHPSVGCFVSHCGFGSMWESLLSESQIVLVPRLADQILNTRLLAEELKVAVEVERGEMGWFSKEDLSKAIKSVMDEESEVGKLVKENHGKWRETLMSPEFMDNYVDNFIRQLYQLL 456

<210> 8

<211> 1371

<212> DNA

<213> Sesamum indicum

<400> 8

ATGCCTGAGTTTGAGAAGTCAAAGCTTCACATAGCCATGTTTCCATGGGTGGCCATTGGCCACATCACTCCCTTCATCCATCTCGCCAACGAGCTCGCCAAAAGGGGCCACTCTATCTCCATTTTGATTCCCAATAAACCTCTTCTTCAGCTCGGCCACCACAGTCTCTACCCAGATCTCATCAAATTTCATGTTGTTACTATTCCTCAAGTAGAGGGCCTGCCGCCCGGCGCTGAGACTGCTTCCGATATCGACATCACAGCCAAGAATCCACTAGCCATAGCCTTCGATGCTACGGCCGAACAAGTCGAGACCATTTTATCCGGGCTGAAACCTGATATCGTGTTTTACGATTTCGCCGACTGGATCCCCAAGATGGCAGCCCGGGTTGGCTTTAAAACTGTTTGTTATAATGTCATCTGCGCTTCTTGTATGGCGATTGGTATTGTTCCCGCCAGGCATATTCCTAAAGACAGGCGGCTGACGGAGGAGGAACTCGGGCAGCCCCCCAAAGGGTACCCTTCTTCCACGGTGGTGCTTCGCGGCCAAGAGGCACTGACTCTATCTTTCATCGCCATGGATTACGGCGCCACCAAGTTTGACGTGCGTATTACCGCCGCGATGCAGGGCTGCGACGCTATTGGCATCCGAACTTGCCGCGAGCTGGAGGGCCCTATGTGCGATTACTTGTCGGAACAGTACAATAAACCCGTCTTCCTAAGCGGGCCGGTTTTGCCGGAGAATCCAAAAGGGGCGCTGGAGGAGAAGTGGGACAAGTGGCTGAGCAAATTCAAGCCCAAATCCGTTGTCTACTGCGCGTTCGGGAGCCAACTGATGCTGCAAAAGAAGCAGTTTCAAGAAATGGTGTTGGGTTTCGAGATGACGGGGCTGCCGTTCTTCGTAGCCGTGTCGAAACCCCATGGAGCGGACTCCATAGAAGAAGCTCTGCCGGAGGGATTCTTGGAGAGGGTGGGAGATAGAGGAGTGGTTCATGGCGGGTGGGTCCAGCAGACCCAGGGCCTGAACCACCCGTCAGTGGGTTGCTTCGTGAGCCACTGCGGGTTCGGATCCATGTGGGAGTCTCTGCTGAGCGAGAGCCAGATAGTGCTGGTGCCGCGGTTGGCGGATCAAATACTGAACACACGGCTGCTGGCGGAGGAGCTGAAGGTGGCGGTGGAGGTAGAAAGAGGGGAGATGGGGTGGTTTTCCAAGGAGGATCTAAGCAAGGCGATCAAGAGTGTGATGGATGAGGAGAGTGAGGTGGGGAAATTGGTGAAGGAGAATCATGGCAAGTGGAGGGAGACTCTGATGAGCCCTGAATTTATGGATAATTACGTTGATAACTTCATCCGACAATTGTATCAACTGTTATAG

<210> 9

<211> 1377

<212> DNA

<213> Artificial sequence

<400> 9

CGCGGCAGCCATATGGCTAGCATGTCTGATTTTGAGAAATCAAAGCTTC 49

<210> 10

<211> 54

<212> DNA

<213> Artificial sequence

<400> 10

TGCGGCCGCAAGCTTGTCGACCTAAAGCTCAGAAAGACTATTGATGAAATTATC 54

Claims

1. An isolated LrUGT2 polypeptide, wherein the polypeptide is selected from any one of the group consisting of:

a) a polypeptide having an amino acid sequence shown as SEQ ID NO. 1, 3, 5 or 7;

b) 1, 3, 5 or 7 through one or several amino acid residues, preferably 1-50, more preferably 1-30, more preferably 1-10, most preferably 1-6, and has catalytic activity of cinnamic leaf glycoside A, akebia saponin A derivative protein;

c) derived proteins whose sequence contains the protein sequence described under a) or b), such as fusion proteins formed by adding a tag sequence, a signal sequence or a secretion signal sequence;

d) the homology of the amino acid sequence and the amino acid sequence shown in SEQ ID NO. 1, 3, 5 or 7 is more than or equal to 65%, preferably more than or equal to 80%, more preferably more than or equal to 90%, such as more than or equal to 95% and more than or equal to 99%, and the derivative protein has the activity of catalyzing the cinnamic-leaf glycosides A and the akebia-stem phenylethanoid glycosides A.

2. LrUGT2 polypeptide according to claim 1, derived from the order labiatae, preferably from a plant selected from the group consisting of: ligustrum robustum, olive, sesame and rehmannia glutinosa.

3. An isolated polynucleotide selected from any one of the group consisting of:

a) a nucleotide sequence encoding the LrUGT2 polypeptide shown in SEQ ID No. 1, 3, 5 or 7;

b) a nucleotide sequence shown as SEQ ID NO 2, 4, 6 or 8;

c) nucleotide sequences having a homology of 75% or more, preferably 80% or more, more preferably 90% or more, for example 95% or more, 99% or more, with the sequence shown in SEQ ID NO 2, 4, 6 or 8;

d) a nucleotide sequence formed by truncating or adding 1-60, preferably 1-30, more preferably 1-10 nucleotides at the 5 'end and/or the 3' end of the nucleotide sequence shown in SEQ ID NO. 2, 4, 6 or 8;

e) a nucleotide sequence complementary to any one of the nucleotide sequences described in a) -d).

4. A recombinant vector comprising the polynucleotide of claim 3, preferably wherein the starting vector is a bacterial plasmid, a bacteriophage, a yeast plasmid, a plant cell virus, an animal cell virus, a retrovirus.

5. A recombinant host cell comprising the vector of claim 4, or having integrated into its genome the polynucleotide of claim 3; preferably, it is a bacterial, yeast, higher plant, insect or mammalian cell, more preferably saccharomyces cerevisiae, escherichia coli.

6. A method of producing LrUGT2 polypeptide, the method comprising:

(a) culturing the host cell of claim 5 under conditions suitable for expression;

(b) isolating the LrUGT2 polypeptide from the culture.

7. Use of LrUGT2 polypeptide according to claim 1 or 2, the recombinant vector according to claim 4, or the host cell according to claim 5, for catalyzing the following reaction, or for preparing a catalytic preparation for catalyzing the following reaction: rhamnosylation reaction is carried out on C-3 position of glucose group of the cinnamic leaf glycoside A or the akebia stem phenethyl alcohol glycoside A to respectively generate cinnamic leaf glycoside B and verbascoside.

8. A method of catalyzing a reaction, comprising the steps of: the catalytic reaction of rhamnosyl group C-3 of the glucose group of cinnamic glycoside A or akebia saponin A is carried out in the presence of LrUGT2 polypeptide of claim 1 or 2.

9. A preparation method of cinnamic glycoside B or acteoside is characterized by comprising the following steps: catalyzing cinerin a or quindoxide a in the presence of LrUGT2 polypeptide according to any one of claims 1 to 2 to yield cinerin B and verbascoside, respectively, preferably with the addition of enzymatic activity, more preferably with the addition of enzymatic activity selected from the group consisting of: ca²⁺、Co² ⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺(ii) a Or can generate Ca²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺Or Fe²⁺The substance of (1).

10. The method according to claim 9, wherein the reaction system has a pH of: 6.5-8.5, preferably pH 7.4-7.6; the temperature of the reaction system is as follows: 25 ℃ to 35 ℃, preferably 28 ℃ to 30 ℃; the reaction time is 0.5h-24h, preferably 1h-10h, more preferably 2h-3 h.