CN118048335A

CN118048335A - PbAT1 protein involved in cinnamomum cassia leaf glycoside A biosynthesis, encoding gene and application thereof

Info

Publication number: CN118048335A
Application number: CN202211436940.6A
Authority: CN
Inventors: 刘涛; 杨一涵; 马延和
Original assignee: Tianjin Institute of Industrial Biotechnology of CAS
Current assignee: Tianjin Institute of Industrial Biotechnology of CAS
Priority date: 2022-11-16
Filing date: 2022-11-16
Publication date: 2024-05-17

Abstract

The invention belongs to the technical field of biology, and discloses PbAT protein participating in biosynthesis of cinnamomvine A, and a coding gene and application thereof. Specifically, the PbAT protein can catalyze the transfer reaction of the glucose group C-4 position of the cinnamoyl glycoside A to coumaroyl. The PbAT protein of the invention brings wide application space for improving the content of target components or directly producing effective components or intermediates by using biotechnology.

Description

PbAT1 protein involved in cinnamomum cassia leaf glycoside A biosynthesis, encoding gene and application thereof

Technical Field

The invention belongs to the technical field of biology, and particularly relates to PbAT protein participating in biosynthesis of cinnamomvine A, and a coding gene and application thereof.

Background

Phenylethanoid glycosides (PhGs) are important natural plant products in the plant kingdom, and have various biological activities such as anti-inflammatory, antibacterial, neuroprotective, antioxidant and the like. At present, there are at least 572 PhGs species isolated and characterized from plants (particularly medicinal plants). PhGs is characterized by having a structure formed by condensation of a hydroxyphenylethyl group with the C1 hydroxyl group of β -glucose. In addition, most of the C4 hydroxyl groups of the beta glucose groups in PhGs condense with p-coumaroyl or caffeoyl groups to form compounds with better structure and efficacy, such as echinacoside from cistanche salsa, verbascoside from rehmannia glutinosa, and ligustrin A and B in the traditional beverage Folum Ilicis. Whereas the common precursor for biosynthesis of these compounds is cinnaringin A. The cinnaringin A is PhG formed by condensing salidroside and coumaroyl, and can be used as an intermediate in a biosynthesis pathway to synthesize various PhGs due to the specificity of the chemical structure. Therefore, the production of the artocarpine A is important for further development PhGs to be applied to industries such as foods, medicines, cosmetics and the like.

With the development of subjects such as molecular biology and synthetic biology, research on plant secondary metabolites is also becoming more and more intensive. However, plant secondary metabolites are of various kinds and different in structure, secondary metabolic pathways are also various and complex, and many pathways are currently still unclear or only the general routes of synthetic pathways are known. The biosynthesis of the enzyme catalyzing salidroside to generate the cinnarin A has not been reported. Thus, there is an urgent need in the art to develop a clone-related enzyme that can increase the content of a target ingredient or directly produce an active ingredient or an intermediate.

Disclosure of Invention

The invention aims to provide PbAT protein participating in the biosynthesis of cinnamoyl glycoside A, and a coding gene and application thereof.

In a first aspect the invention provides an isolated PbAT a polypeptide selected from the group consisting of:

a) A polypeptide having the amino acid sequences shown in SEQ ID NO. 1,3, 5 and 7;

b) A derivative protein which is formed by substitution, deletion or addition of one or a plurality of amino acid residues, preferably 1 to 50, more preferably 1 to 30, still more preferably 1 to 10, most preferably 1 to 6 of the amino acid sequences shown in SEQ ID NO. 1, 3, 5 and 7 and has the activity of catalyzing salidroside;

(c) A derivative protein comprising the protein sequence of (a) or (b) in the sequence;

(d) The homology of the amino acid sequence with the amino acid sequences shown in SEQ ID NO. 1, 3,5 and 7 is more than or equal to 65%, preferably more than or equal to 80%, such as more than or equal to 88%, more preferably more than or equal to 90%, such as more than or equal to 95%, more than or equal to 98%, more than or equal to 99%, and has the activity of catalyzing salidroside.

In another preferred embodiment, the sequence (c) is a fusion protein formed by adding a tag sequence, a signal sequence or a secretion signal sequence to (a) or (b).

In another preferred embodiment, the PbAT polypeptide is from the order labia, preferably from one or more plants selected from the group consisting of: safflower, willow, robustly privet, olive, sesame and rehmannia root.

In a preferred embodiment, the PbAT polypeptide has the amino acid sequence shown in SEQ ID NO. 1, 3, 5, 7.

In a second aspect, the invention provides an isolated polynucleotide selected from the group consisting of:

(a) Nucleotide sequences of PbAT polypeptide shown as SEQ ID NO. 1, 3, 5 and 7;

(b) Nucleotide sequence shown as SEQ ID NO 2, 4, 6 or 8;

(c) Nucleotide sequence having a homology of not less than 75% (preferably not less than 80%, such as not less than 88%, more preferably not less than 90%, for example not less than 95%, not less than 98%, not less than 99%) with the sequence represented by SEQ ID NO. 2,4, 6 or 8;

(d) A nucleotide sequence formed by truncating or adding 1 to 60 (preferably 1 to 30, more preferably 1 to 10) nucleotides at the 5 'end and/or 3' end of the nucleotide sequence shown in SEQ ID NO.2, 4, 6 or 8;

(e) A nucleotide sequence complementary (preferably fully complementary) to the nucleotide sequence of any one of (a) - (d).

In a preferred embodiment, the sequence of the nucleotide is shown in SEQ ID NO. 2.

In another preferred embodiment, the polynucleotide having the sequence shown in SEQ ID NO. 2, 4, 6 or 8 encodes a polypeptide having the amino acid sequence shown in SEQ ID NO. 1.

In a third aspect, the invention provides a recombinant vector comprising a polynucleotide according to the second aspect of the invention.

In some embodiments, the carrier is selected from the group consisting of: expression vectors, shuttle vectors, integration vectors, or combinations thereof.

In other embodiments, the carrier is selected from the group consisting of: bacterial plasmids, phage, yeast plasmids, plant cell viruses, animal cell viruses, retroviruses, or combinations thereof.

In a preferred embodiment, the vector comprises a vector expressed in E.coli, such as a pET series vector.

In a fourth aspect, the invention provides a genetically engineered host cell comprising a recombinant vector according to the third aspect of the invention, or having integrated into its genome a polynucleotide according to the second aspect of the invention.

In another preferred embodiment, the host cell is a prokaryotic cell or a eukaryotic cell. More preferably, the host cell is selected from the group consisting of: bacteria, yeast, higher plant, insect or mammalian cells. In some embodiments, the host cell is a lower eukaryotic cell, such as a yeast cell. In other embodiments, the host cell is a higher eukaryotic cell, such as a mammalian cell. In other embodiments, the host cell is a prokaryotic cell, such as a bacterial cell, preferably E.coli.

In a fifth aspect, the invention provides a method of producing PbAT a polypeptide, the method comprising:

(a) Culturing the host cell of the fourth aspect of the invention under conditions suitable for expression;

(b) Isolating the PbAT polypeptide from the culture.

In a sixth aspect, the invention provides the use of a PbAT polypeptide according to the first aspect of the invention or a derivative polypeptide thereof, a vector according to the third aspect of the invention, or a host cell according to the fourth aspect of the invention, to catalyse or to prepare a catalytic preparation to catalyse: and (3) carrying out acylation reaction on the coumarone at the 4' -carbon atom of the salidroside glucose group to generate the cinnaringin A.

In a seventh aspect, the invention provides a method of catalyzing a reaction comprising the steps of: the catalytic reaction of the p-coumaroyl of the carbon atom at the 4' -position of the glucose group of salidroside is carried out in the presence of the polypeptide according to the first aspect of the present invention or a polypeptide derived therefrom.

In another preferred embodiment, the method further comprises adding the polypeptides and their derivatives separately to a catalytic reaction; and/or adding the polypeptide and the polypeptide derived from the polypeptide into a catalytic reaction at the same time.

In a further preferred embodiment, the method further comprises: an additive for regulating the activity of the enzyme is provided to the reaction system.

In other embodiments, the additive for modulating enzymatic activity is: additives for increasing or inhibiting the enzymatic activity. In another preferred embodiment, the additive for modulating enzymatic activity is selected from the group consisting of: ca ²⁺、Co²⁺、Mn²⁺、Ba²⁺、Al³⁺、Ni²⁺、Zn²⁺, or Fe ²⁺.

In a preferred embodiment, the pH of the reaction system is: 6.5-8.5, preferably pH 7.4-7.6.

In other preferred embodiments, the temperature of the reaction system is: 25. the temperature is between 35 ℃ and 28 ℃ and 30 ℃ preferably.

In other preferred embodiments, the reaction system is operated for a period of time ranging from 0.5 h to 24: 24 h, preferably from 1h to 10: 10 h, more preferably from 2: 2h to 3: 3 h.

The eighth aspect of the invention provides a preparation method of the osmanthus leaf glycoside A, which comprises the following steps:

catalyzing salidroside in the presence of the polypeptide of the first aspect of the invention or a polypeptide derived therefrom to obtain cinnarioside A, wherein the reaction principle is represented by the following formula:

It is understood that within the scope of the present invention, the above-described technical features of the present invention and technical features specifically described below (e.g., in the examples) may be combined with each other to form a new technical solution, which falls within the scope of the present invention. And are limited to a space, and are not described in detail herein.

Through extensive and intensive studies, the inventor excavates rhodiola rosea acyl transferase PbAT1 from the transcriptome of safflower, jingjingjingjingjingjingjingjingjingjingjing [ Penstemon barbatus ] for the first time, and the rhodiola rosea acyl transferase is a key enzyme in the biosynthesis process of the cinnaringin A; pbAT 1A can specifically and efficiently catalyze salidroside into cinnarin A. This acylated product is closely related to the synthesis of other phenylethanoid glycosides. The invention has important theoretical and practical significance for producing the plant artocarpus hypargside A and improving the content of active ingredients of phenethyl alcohol glycoside compounds, namely artocarpus hypargside A, artocarpus hypargside B, acteoside, echinacoside and derivatives thereof in plants through biotechnology.

Drawings

FIG. 1, the structural schematic diagram of salidroside, cinnarin A, cinnarin B, acteoside and derivatives thereof.

FIG. 2, pbAT, and expression abundance of cinnarin A rhamnosyltransferase in different tissues

FIG. 3 shows the result of electrophoresis of cDNA clone amplification PbAT gene fragment.

SDS-PAGE protein electrophoresis detection of FIG. 4, pbAT.

FIG. 5, HPLC detection result of PbAT in vitro enzyme catalytic reaction conversion product using cinnarin A as substrate.

FIG. 6 is a MS test result of the conversion product of PbAT in vitro enzyme catalytic reaction using cinnarin A as substrate.

FIG. 7, rgAT, HPLC results for catalytic cinnarin A.

FIG. 8, oeAT, HPLC results of catalytic cinnarin A.

Fig. 9, siAT1, HPLC results of catalytic cinnarin a.

Detailed Description

As used herein, the terms "active polypeptide", "polypeptide of the invention and its derivatives", "enzyme of the invention", "PbAT 1 of the invention", all refer to PbAT1 (SEQ ID NO: 1) polypeptide and its derivatives.

As used herein, an "isolated polypeptide" means that the polypeptide is substantially free of other proteins, lipids, carbohydrates, or other substances with which it is naturally associated. The person skilled in the art is able to purify the polypeptides using standard protein purification techniques. Substantially pure polypeptides can produce a single main band on a non-reducing polyacrylamide gel. The purity of the polypeptide can also be further analyzed by amino acid sequence.

The active polypeptide of the present invention may be a recombinant polypeptide, a natural polypeptide, a synthetic polypeptide. The polypeptides of the invention may be naturally purified products, or chemically synthesized products, or produced from prokaryotic or eukaryotic hosts (e.g., bacteria, yeast, plants) using recombinant techniques.

The invention also includes fragments, derivatives and analogues of the polypeptides. As used herein, the terms "fragment," "derivative," and "analog" refer to a polypeptide that retains substantially the same biological function or activity as the polypeptide.

The polypeptide fragments, derivatives or analogues of the invention may be (i) polypeptides having one or more conserved or non-conserved amino acid residues, preferably conserved amino acid residues, substituted, which may or may not be encoded by the genetic code, or (ii) polypeptides having a substituent in one or more amino acid residues, or (iii) polypeptides formed by fusion of a mature polypeptide with another compound, such as a compound that extends the half-life of the polypeptide, for example polyethylene glycol, or (iv) polypeptides formed by fusion of an additional amino acid sequence to the polypeptide sequence, such as a leader or secretory sequence or a sequence used to purify the polypeptide or a proprotein sequence, or fusion proteins with the formation of an antigen IgG fragment. Such fragments, derivatives and analogs are within the purview of one skilled in the art and would be well known in light of the teachings herein.

The polynucleotides of the invention may be in the form of DNA or RNA. DNA forms include cDNA, genomic DNA, or synthetic DNA. The DNA may be single-stranded or double-stranded. The DNA may be a coding strand or a non-coding strand. The coding region sequence encoding the mature polypeptide may be identical to the coding region sequence set forth in SEQ ID NO. 1 or a degenerate variant.

The term "polynucleotide encoding a polypeptide" may include polynucleotides encoding the polypeptide, or may include additional coding and/or non-coding sequences.

The invention also relates to variants of the above polynucleotides which encode polypeptides having the same amino acid sequence as the invention or fragments, analogs and derivatives of the polypeptides. Variants of the polynucleotide may be naturally occurring allelic variants or non-naturally occurring variants. Such nucleotide variants include substitution variants, deletion variants and insertion variants. As known in the art, an allelic variant is a substitution of a polynucleotide, which may be a substitution, deletion, or insertion of one or more nucleotides, without substantially altering the function of the encoded polypeptide.

The invention also relates to polynucleotides which hybridize to the sequences described above and which have at least 50%, preferably at least 70%, more preferably at least 80% identity between the two sequences. The invention relates in particular to polynucleotides which hybridize under stringent conditions (or stringent conditions) to the polynucleotides of the invention.

The invention also relates to nucleic acid fragments which hybridize to the sequences described above. As used herein, a "nucleic acid fragment" is at least 15 nucleotides, preferably at least 30 nucleotides, more preferably at least 50 nucleotides, and most preferably at least 100 nucleotides or more in length. The nucleic acid fragments may be used in nucleic acid amplification techniques (e.g., PCR) to determine and/or isolate polynucleotides encoding PbAT protein.

The polypeptides and polynucleotides of the invention are preferably provided in isolated form, and more preferably purified to homogeneity.

The full-length nucleotide sequence or a fragment thereof of the present invention can be usually obtained by a PCR amplification method, a recombinant method or an artificial synthesis method. For the PCR amplification method, primers can be designed according to the nucleotide sequences disclosed in the present invention, particularly the open reading frame sequences, and amplified to obtain the relevant sequences using a commercially available cDNA library or a cDNA library prepared according to a conventional method known to those skilled in the art as a template. When the sequence is longer, it is often necessary to perform two or more PCR amplifications, and then splice the amplified fragments together in the correct order.

Once the relevant sequences are obtained, recombinant methods can be used to obtain the relevant sequences in large quantities. This is usually done by cloning it into a vector, transferring it into a cell, and isolating the relevant sequence from the propagated host cell by conventional methods.

Furthermore, the sequences concerned, in particular fragments of short length, can also be synthesized by artificial synthesis. In general, fragments of very long sequences are obtained by first synthesizing a plurality of small fragments and then ligating them.

At present, it is already possible to obtain the DNA sequences encoding the proteins of the invention (or fragments or derivatives thereof) entirely by chemical synthesis. The DNA sequence can then be introduced into a variety of existing DNA molecules (or vectors, for example) and cells known in the art. In addition, mutations can be introduced into the protein sequences of the invention by chemical synthesis.

Methods of amplifying DNA/RNA using PCR techniques are preferred for obtaining the genes of the present invention. In particular, when it is difficult to obtain full-length cDNA from a library, it is preferable to use RACE method (RACE-cDNA end rapid amplification method), and primers for PCR can be appropriately selected according to the sequence information of the present invention disclosed herein and synthesized by a conventional method. The amplified DNA/RNA fragments can be isolated and purified by conventional methods, such as by gel electrophoresis.

The term "recombinant expression vector" refers to bacterial plasmids, phages, yeast plasmids, plant cell viruses, mammalian cell viruses such as adenoviruses, retroviruses or other vectors well known in the art. Any plasmid or vector may be used as long as it is replicable and stable in the host. An important feature of expression vectors is that they generally contain an origin of replication, a promoter, a marker gene and translational control elements.

Methods well known to those skilled in the art can be used to construct expression vectors containing PbAT a polypeptide, coding DNA sequences, and appropriate transcriptional/translational control signals. These methods include in vitro recombinant DNA techniques, DNA synthesis techniques, in vivo recombinant techniques, and the like. The DNA sequence may be operably linked to an appropriate promoter in an expression vector to direct mRNA synthesis. Representative examples of these promoters are: the lac or trp promoter of E.coli; a lambda phage PL promoter; eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, LTRs from retroviruses, and other known promoters that control the expression of genes in prokaryotic or eukaryotic cells or viruses thereof. The expression vector also includes a ribosome binding site for translation initiation and a transcription terminator.

In addition, the expression vector preferably comprises one or more selectable marker genes to provide phenotypic traits for selection of transformed host cells, such as dihydrofolate reductase, neomycin resistance and Green Fluorescent Protein (GFP) for eukaryotic cell culture, or tetracycline or ampicillin resistance for E.coli.

Vectors comprising the appropriate DNA sequences as described above, as well as appropriate promoter or control sequences, may be used to transform appropriate host cells to enable expression of the protein.

The host cell may be a prokaryotic cell, such as a bacterial cell; or lower eukaryotic cells, such as yeast cells; or higher eukaryotic cells, such as mammalian cells. Representative examples are: coli, streptomyces; bacterial cells of salmonella typhimurium; fungal cells such as yeast; a plant cell; insect cells of Drosophila S2 or Sf 9; CHO, COS, 293 cells, or Bowes melanoma cells.

When the polynucleotide of the present invention is expressed in higher eukaryotic cells, transcription will be enhanced if an enhancer sequence is inserted into the vector. Enhancers are cis-acting elements of DNA, usually about 10 to 300 base pairs, that act on a promoter to increase the transcription of a gene. Examples include the SV40 enhancer 100 to 270 base pairs on the late side of the origin of replication, the polyoma enhancer on the late side of the origin of replication, and adenovirus enhancers.

It will be clear to a person of ordinary skill in the art how to select appropriate vectors, promoters, enhancers and host cells.

Transformation of host cells with recombinant DNA can be performed using conventional techniques well known to those skilled in the art. When the host is a prokaryote such as E.coli, competent cells, which are capable of absorbing DNA, can be obtained after an exponential growth phase and treated by the CaCl method using procedures well known in the art. Another approach is to use MgCl2. Transformation can also be performed by electroporation, if desired. When the host is eukaryotic, the following DNA transfection methods may be used: calcium phosphate co-precipitation, conventional mechanical methods such as microinjection, electroporation, liposome encapsulation, etc.

The transformant obtained can be cultured by a conventional method to express the polypeptide encoded by the gene of the present invention. The medium used in the culture may be selected from various conventional media depending on the host cell used. The culture is carried out under conditions suitable for the growth of the host cell. After the host cells have grown to the appropriate cell density, the selected promoters are induced by suitable means (e.g., temperature switching or chemical induction) and the cells are cultured for an additional period of time.

The recombinant polypeptide in the above method may be expressed in a cell, or on a cell membrane, or secreted outside the cell. If desired, the recombinant proteins can be isolated and purified by various separation methods using their physical, chemical and other properties. Such methods are well known to those skilled in the art. Examples of such methods include, but are not limited to: conventional renaturation treatment, treatment with a protein precipitant (salting-out method), centrifugation, osmotic sterilization, super-treatment, super-centrifugation, molecular sieve chromatography (gel filtration), adsorption chromatography, ion exchange chromatography, high Performance Liquid Chromatography (HPLC), and other various liquid chromatography techniques and combinations of these methods.

The invention will be further illustrated with reference to specific examples. It is to be understood that these examples are illustrative of the present invention and are not intended to limit the scope of the present invention. The experimental procedure, which does not address the specific conditions in the examples below, is generally followed by routine conditions, such as, for example, sambrook et al, molecular cloning: conditions described in the laboratory Manual (New York: cold Spring Harbor Laboratory Press, 1989) or as recommended by the manufacturer. Percentages and parts are weight percentages and parts unless otherwise indicated.

Apparatus, materials and reagents

The PCR was performed using MASTERCYCLER PRO (Eppendorf).

The culture was performed at constant temperature using SGSP-03X 35 incubator (Huang Danheng Feng medical instruments Co., ltd.) and ZQZY-75AN full-temperature shake incubator (Tianjin Boxin Biotech Co., ltd.).

Centrifugation uses 5418R high-speed refrigerated centrifuges and 5418 mini centrifuges (Eppendorf).

OD600 was measured using a UV-1800 UV-Vis spectrophotometer (Shimadzu).

High performance liquid chromatography uses LC-20AD liquid chromatography system (shimadzu).

The liquid chromatography-mass spectrometry combination is measured by an Agilent 1200 HPLC liquid chromatography system tandem Bruker-MicroTOF-II mass spectrometer.

Ultrasonic cell disruption Using Scientz-IID cell disruptor (Ningbo Xinzhi biotechnology Co., ltd.)

Oligonucleotide primers were purchased from Jin Weizhi Biotechnology Inc.

Coli DH5 alpha, BL21 (DE 3) strain and pET-28a (+) vector are used for gene cloning and protein expression.

Standard compound, cinnarin B, was purchased from adult plant labeling pure biotechnology limited.

The cinnaringin A is synthesized by the laboratory, and the purity is more than 90%.

P-coumaroyl-coa was purchased from vickers biotechnology limited, inc.

The gel recovery kit and the total plant RNA extraction kit are purchased from Tiangen Biochemical technologies Co.

Reverse transcription kit TRANSSCRIPT ONE-step gDNA Removal AND CDNA SYNTHESIS Supermix was purchased from Beijing full gold Co., ltd.

Phanta Max ultra-high fidelity DNA polymerase was purchased from Norvezan Biotechnology Inc.

The seamless cloning kit was purchased from south Beijing nuowan biotechnology Co., ltd.

Examples 1, pbAT recombinant preparation of the Gene and the protein encoded thereby

Digging of PbAT1 Gene

Transcriptome data of root, stem and leaf tissues of the safflower Bell fish [ Penstemon barbatus ] were subjected to sequence analysis based on homology, and 31 candidate genes of protein belonging to BAHD family of acylases and 28 SCPL families of acylases were found. After analysis of the expression amounts of the candidate gene of the acylase in each tissue, pbAT1 which is consistent with the tissue-specific expression pattern of the cinnamoyl glycoside A rhamnosyltransferase in the carthamus tinctorius is obtained as a candidate gene (figure 2), and the DNA coding nucleotide sequence and the amino acid of the protein are respectively shown as SEQ ID NO. 2 and SEQ ID NO. 1. Therefore, the present inventors have studied as described above to screen a novel PbAT protein involved in the biosynthesis of cinnarin A from the species Salix carthami [ Penstemon barbatus ].

2. Preparation of safflower, bell and willow leaf cDNA

Taking fresh leaf tissue of plant carthamus tinctorius, quick freezing with liquid nitrogen, extracting RNA by adopting a Tiangen total plant RNA extraction kit according to the operation steps of the kit, and preparing cDNA by referring to a TRANSSCRIPT ONE-step gDNA Removal AND CDNA SYNTHESIS Supermix reverse transcription kit of full-scale gold after verification is qualified, and reverse transcribing RNA.

PbAT1 Gene cloning and expression plasmid construction

Primers (upstream primer: GGTGCCGCGCGGCAGCCATATGGCTAGCATGGTGACTCTCAAATCCACTCAC; downstream primer: GCGGCCGCAAGCTTGTCGACTCAAATATCATCGTAGAAACATTTCTTGAATGAACC; underlined portion, homologous arm base sequence) were designed and synthesized, PCR amplification was performed using cDNA as a template, and homologous arm sequences complementary to pET-28a (+) were introduced upstream and downstream of the gene, respectively. PCR amplification System (50. Mu.L): 10. Mu.L of 5 XSF buffer, 1. Mu.L of dNTP Mix, primer1/Primer2 final concentration 0.2. Mu.M; cDNA <200ng; the remaining volume was made up with sterile distilled water. PCR reaction conditions: pre-denaturation at 95℃for 2min, then denaturation at 95℃for 30s, annealing at 55℃for 30s, extension at 72℃for 60s,35 cycles.

Agarose gel electrophoresis detected a band of about 1.5kb (FIG. 3) and the fragment of interest was recovered using Tiangen gel recovery kit.

The recovered fragment was ligated with the NheI and SalI digested pET28a vector using a seamless cloning kit (Biyun biotechnology Co., ltd.). Seamless cloning system (20 μl): 10. Mu.L 2X Seamless Cloning Mix,50ng of linearized vector, 10ng of recovered fragment; the remaining volume was made up to 20. Mu.L with sterile distilled water. Seamless cloning reaction conditions: incubate at 50℃for 30min.

The seamless cloning product is transformed into competent cells of escherichia coli DH5 alpha, plasmid which is positive in colony PCR verification is sent to Jin Weizhi biotechnology Co-Ltd for sequencing, the obtained DNA coding sequence and protein are respectively shown as SEQ ID NO. 2 and SEQ ID NO. 1, and the recombinant plasmid is pET28a-PbAT1.

Expression of PbAT1

The recombinant plasmid pET28a-PbAT1 was transformed into competent cells of E.coli BL21 (DE 3), spread on LB solid medium (kanamycin 50. Mu.g/mL), and cultured overnight at 37℃to give recombinant strain BL21 (DE 3)/pET 28a-PbAT1. Single colonies were picked up to 5mL of LB liquid medium (kanamycin 50. Mu.g/mL), cultured overnight, transferred to 50mL of fresh LB liquid medium, cultured at 200rpm to OD ₆₀₀ = 0.6-0.8, added with inducer IPTG to a final concentration of 0.1mM, and cultured at 200rpm and 22℃for 20 hours. After transformation of BL21 (DE 3) with blank plasmid pET28a, recombinant strain BL21 (DE 3)/pET 28a is obtained.

After the end of expression, the expression was checked using SDS-PAGE: the bacterial liquid was centrifuged (4000 rpm,30 min), the supernatant was discarded, resuspended in 15mL of lysis buffer (50 mM Tris-HCl, pH7.5, 100mM NaCl), and the cell lysate was obtained by ultrasonication on ice and frozen for centrifugation (12000 rpm,15min,4 ℃). Protein expression was confirmed by SDS-PAGE using cell lysates, supernatants and pellet.

In vitro functional identification of example 2, pbAT1

1. Obtaining PbAT1 crude enzyme solution

The single colony BL21 (DE 3)/pET 28a-PbAT1 to 5mL LB liquid medium (containing 50. Mu.g/mL) was inoculated, cultured overnight at 37℃and 200rpm, 1mL of the culture was transferred to 50mL of fresh LB medium, cultured at 37℃and 200rpm until OD600 = 0.6-0.8, and then IPTG was added to a final concentration of 0.1mM, and the culture was continued at 16℃and 200rpm for 20 hours. BL21 (DE 3) recombinant strain carrying pET28a was used as a blank control, and was operated as above. And (3) centrifuging to collect bacteria, re-suspending the bacteria by using 5mL of lysis buffer solution, performing ultrasonic crushing in an ice-water mixture, and centrifuging at 12000rpm for 15min to obtain supernatant which is PbAT crude enzyme liquid.

2. Catalytic reaction of crude enzyme

The total volume of the crude enzyme reaction system was 110. Mu.L, including: 1mM A, 1mM P-coumaroyl-CoA, 90. Mu.L of PbAT A crude enzyme solution, and the volume was made up to 110. Mu.L with lysis buffer. After the mixture was reacted at 30℃for 1 hour, 110. Mu.L of methanol was added to terminate the reaction. After centrifugation (12000 rpm,10 min) of the reaction mixture, product analysis was performed using HPLC and LC-MS.

3. Product detection

The HPLC detection parameters were as follows: chromatographic column SILGREEN C (5 μm, 4.6X1250 mm); column temperature 40 ℃; intercepting wavelength to 312nm; the mobile phase consists of a solution A (0.1% formic acid aqueous solution) and a solution B (acetonitrile), and the gradient elution method comprises the following steps: maintaining 5% mobile phase B for 0-5min, increasing mobile phase B from 5% to 13.2% at 5-18min, and increasing mobile phase from 18% to 21.6% at 18-43min, with flow rate of 1ml/min.

When LC-MS analysis was performed, mobile phase A was replaced with an aqueous solution containing 5mM ammonium acetate, and the remaining chromatographic conditions were unchanged. The mass spectrometry conditions were as follows: the chemical mode is Electrospray (ESI) negative ions, the capillary voltage is 4500V, the atomization air pressure is 1 bar, the solvent removing gas is nitrogen, the flow rate is 6.0L/min, the solvent removing temperature and the ion source temperature are 180 ℃, the scanning range m/z is 50-1000, the LC-MS data collection software is MassLynx 4.0 (Waters, USA), and sodium trifluoroacetate is used as a correction fluid for accurate molecular weight.

As shown in FIG. 5, the HPLC result of PbAT for catalyzing salidroside shows that an absorption peak of the cinnamoyl glycoside B (RT=38.48, min) appears in a reaction system of PbAT1 crude enzyme, and a blank strain BL21 (DE 3)/pET 28a does not appear, which indicates that PbAT1 can effectively convert substrates of the salidroside and the coumaroyl cofactor A to generate a new product. The exact molecular weight of this compound ([ M-H ] ^- = 445.1528) was determined by LC-MS (fig. 6) as the exact molecular weight of salidroside plus one coumaroyl group. Thus, the product was identified as cinnaringin A. Using the above reaction system, the final conversion of the reaction was 5.2%.

In vitro functional identification of homologous Gene RgAT of example 3, pbAT1

1. RgAT1 sequence acquisition

The homologous gene of PbAT is searched for by using a local Blastp program on the transcriptome data of rehmannia glutinosa [ REHMANNIA GLUTINOSA ] to obtain the homologous gene with the consistency of 89.2%, which is named RgAT1, and the DNA coding sequence and the protein sequence of the homologous gene are respectively shown as SEQ ID NO. 4 and SEQ ID NO. 3.

2. RgAT1 prokaryotic expression and crude enzyme liquid acquisition

The DNA coding sequence of RgAT1 was synthesized by Biotech and cloned between the NheI and SalI cleavage sites of the pET-28a (+) vector to give plasmid pET28a-RgAT1. The recombinant plasmid pET28a-RgAT1 was transformed into competent cells of E.coli BL21 (DE 3), spread on LB solid medium (kanamycin 50. Mu.g/mL), and cultured overnight at 37℃to give recombinant strain BL21 (DE 3)/pET 28a-RgAT1. Single colonies were picked up to 5mL of LB liquid medium (kanamycin 50. Mu.g/mL), cultured overnight, transferred to 50mL of fresh LB liquid medium, cultured at 200rpm to OD600 = 0.6-0.8, added with inducer IPTG to a final concentration of 0.1mM, and cultured at 200rpm and 16℃for 20 hours. After transformation of BL21 (DE 3) with blank plasmid pET28a, recombinant strain BL21 (DE 3)/pET 28a is obtained. After the end of expression, the expression was checked using SDS-PAGE: the bacterial liquid was centrifuged (4000 rpm,30 min), the supernatant was discarded, resuspended in 5mL of lysis buffer (50 mM Tris-HCl, pH7.5, 100mM NaCl), and the cell lysate was obtained by ultrasonication on ice and frozen for centrifugation (12000 rpm,15min,4 ℃). Protein expression was confirmed by SDS-PAGE using cell lysates, supernatants and pellet.

The supernatant is RgAT1 crude enzyme solution. The total volume of the crude enzyme reaction system was 110. Mu.L, including: 1mM A, 1mM P-coumaroyl-CoA, 90. Mu.L of RgAT A crude enzyme solution, and the volume was made up to 110. Mu.L with lysis buffer. After the mixture was reacted at 30℃for 1 hour, 110. Mu.L of methanol was added to terminate the reaction. After centrifugation (12000 rpm,10 min) of the reaction mixture, product analysis was performed using HPLC.

3. Product detection

As shown in FIG. 7, the HPLC result of RgAT1 for catalyzing salidroside shows that an absorption peak of the cinnaringin A appears in the reaction system of RgAT1 crude enzyme (RT=38.48 min), which indicates that RgAT1 can effectively convert the substrate salidroside and p-coumaroyl-CoA to generate cinnaringin A. Using the above reaction system, the final conversion of the reaction was 0.59%.

In vitro functional identification of homologous Gene OeAT1 of examples 4, pbAT1

1. OeAT1 sequence acquisition

The homologous gene PbAT was searched by Blastp program on NCBI, the protein sequence from olive [ Olea europaea ] has a degree of identity of 82.1% with PbAT, called OeAT, and the DNA coding sequence and the protein sequence are shown as SEQ ID NO:6 and SEQ ID NO:5, respectively.

2. OeAT1 prokaryotic expression and crude enzyme liquid acquisition

The DNA coding sequence of OeAT1 was synthesized by Biotech and cloned between the NheI and SalI cleavage sites of the pET-28a (+) vector to give plasmid pET28a-OeAT1. The recombinant plasmid pET28a-OeAT1 was transformed into competent cells of E.coli BL21 (DE 3), spread on LB solid medium (kanamycin 50. Mu.g/mL), and cultured overnight at 37℃to give recombinant strain BL21 (DE 3)/pET 28a-OeAT1. Single colonies were picked up to 5mL of LB liquid medium (kanamycin 50. Mu.g/mL), cultured overnight, transferred to 50mL of fresh LB liquid medium, cultured at 200rpm to OD600 = 0.6-0.8, added with inducer IPTG to a final concentration of 0.1mM, and cultured at 200rpm and 16℃for 20 hours. After transformation of BL21 (DE 3) with blank plasmid pET28a, recombinant strain BL21 (DE 3)/pET 28a is obtained. After the end of expression, the expression was checked using SDS-PAGE: the bacterial liquid was centrifuged (4000 rpm,30 min), the supernatant was discarded, resuspended in 5mL of lysis buffer (50 mM Tris-HCl, pH7.5, 100mM NaCl), and the cell lysate was obtained by ultrasonication on ice and frozen for centrifugation (12000 rpm,15min,4 ℃). Protein expression was confirmed by SDS-PAGE using cell lysates, supernatants and pellet.

The supernatant is OeAT1 crude enzyme solution. The total volume of the crude enzyme reaction system was 110. Mu.L, including: 1mM A, 1mM P-coumaroyl-CoA, 90. Mu.L of OeAT A crude enzyme solution, and the volume was made up to 110. Mu.L with lysis buffer. After the mixture was reacted at 30℃for 1 hour, 110. Mu.L of methanol was added to terminate the reaction. After centrifugation (12000 rpm,10 min) of the reaction mixture, product analysis was performed using HPLC.

3. Product detection

As shown in FIG. 8, the HPLC result of OeAT1 for catalyzing salidroside shows that an absorption peak of the cinnamomvine B (RT=38.48 min) appears in the reaction system of OeAT1 crude enzyme, which indicates that OeAT1 can effectively convert the substrates of the salidroside and the coumaroyl-coa to generate a new product. Using the reaction system described above, the final conversion of the reaction was 0.067%.

In vitro functional identification of homologous Gene SiAT1 of examples 5, pbAT1

1. SiAT1 sequence acquisition

The homologous gene PbAT was searched for by Blastp program on NCBI, the protein sequence from sesame [ Sesamum indicum ] had 88.8% identity with PbAT1, called SiAT1, and the DNA coding sequence and protein sequence were shown in SEQ ID NO. 8 and 7, respectively.

2. SiAT1 prokaryotic expression and crude enzyme liquid acquisition

The DNA coding sequence of SiAT1 was synthesized by Biotech and cloned between the NheI and SalI cleavage sites of the pET-28a (+) vector to give plasmid pET28a-SiAT1. The recombinant plasmid pET28a-SiAT1 was transformed into competent cells of E.coli BL21 (DE 3), spread on LB solid medium (kanamycin 50. Mu.g/mL), and cultured overnight at 37℃to give recombinant strain BL21 (DE 3)/pET 28a-SiAT1. Single colonies were picked up to 5mL of LB liquid medium (kanamycin 50. Mu.g/mL), cultured overnight, transferred to 50mL of fresh LB liquid medium, cultured at 200rpm to OD600 = 0.6-0.8, added with inducer IPTG to a final concentration of 0.1mM, and cultured at 200rpm and 16℃for 20 hours. After transformation of BL21 (DE 3) with blank plasmid pET28a, recombinant strain BL21 (DE 3)/pET 28a is obtained. After the end of expression, the expression was checked using SDS-PAGE: the bacterial liquid was centrifuged (4000 rpm,30 min), the supernatant was discarded, resuspended in 5mL of lysis buffer (50 mM Tris-HCl, pH7.5, 100mM NaCl), and the cell lysate was obtained by ultrasonication on ice and frozen for centrifugation (12000 rpm,15min,4 ℃). Protein expression was confirmed by SDS-PAGE using cell lysates, supernatants and pellet.

The supernatant is SiAT1 crude enzyme solution. The total volume of the crude enzyme reaction system was 110. Mu.L, including: 1mM A, 1mM P-coumaroyl-CoA, 90. Mu.L of SiAT A crude enzyme solution, and the volume was made up to 110. Mu.L with lysis buffer. After the mixture was reacted at 30℃for 1 hour, 110. Mu.L of methanol was added to terminate the reaction. After centrifugation (12000 rpm,10 min) of the reaction mixture, product analysis was performed using HPLC.

3. Product detection

As shown in FIG. 9, the HPLC result of SiAT1 for catalyzing salidroside shows that the absorption peak of the cinnamoyl glycoside A (RT=38.48, min) appears in the reaction system of SiAT1 crude enzyme, while the blank strain BL21 (DE 3)/pET 28a does not appear, which indicates that SiAT1 can effectively convert the substrates of salidroside and coumaroyl-coa to generate a new product. Using the above reaction system, the final conversion of the reaction was 13.9%.

All documents mentioned in this disclosure are incorporated by reference in this disclosure as if each were individually incorporated by reference. Further, it will be appreciated that various changes and modifications may be made by those skilled in the art after reading the above teachings, and such equivalents are intended to fall within the scope of the application as defined in the appended claims.

Claims

1. An isolated PbAT1 polypeptide, wherein said polypeptide is selected from any one of the group consisting of:

a) A polypeptide having an amino acid sequence as set forth in SEQ ID NO.1, 3, 5 or 7;

b) A derivative protein with the activity of catalyzing salidroside, which is formed by substitution, deletion or addition of one or a plurality of amino acid residues, preferably 1 to 50, more preferably 1 to 30, still more preferably 1 to 10, most preferably 1 to 6 of the amino acid sequences shown in SEQ ID NO.1, 3,5 or 7;

c) Derived proteins comprising the protein sequence of a) or b), for example fusion proteins formed by the addition of a tag sequence, a signal sequence or a secretion signal sequence;

d) The homology of the amino acid sequence with the amino acid sequence shown in SEQ ID NO.1, 3, 5 or 7 is more than or equal to 65%, preferably more than or equal to 80%, such as more than or equal to 88%, more preferably more than or equal to 90%, such as more than or equal to 95%, more than or equal to 98%, more than or equal to 99%, and has the activity of catalyzing salidroside.

2. The PbAT polypeptide of claim 1, which is from the order labia, preferably from a plant selected from the group consisting of: red flower, willow, ligustrum robustum, olive, sesame and rehmannia root.

3. An isolated polynucleotide, wherein the polynucleotide is selected from any one of the group consisting of:

a) A nucleotide sequence encoding a PbAT polypeptide as set forth in SEQ ID NO. 1, 3, 5 or 7;

b) Nucleotide sequence shown as SEQ ID NO 2, 4, 6 or 8;

c) Nucleotide sequences having a homology of not less than 75%, preferably not less than 80%, such as not less than 88%, more preferably not less than 90%, for example not less than 95%, not less than 98% and not less than 99% with the sequence shown in SEQ ID NO. 2,4, 6 or 8;

d) A nucleotide sequence of 1 to 60, preferably 1 to 30, more preferably 1 to 10 nucleotides truncated or added at the 5 'end and/or 3' end of the nucleotide sequence shown in SEQ ID NO. 2,4, 6 or 8;

e) A nucleotide sequence complementary to any of the nucleotide sequences described under a) -d).

4. A recombinant vector comprising the polynucleotide of claim 3, preferably wherein the starting vector is a bacterial plasmid, a phage, a yeast plasmid, a plant cell virus, an animal cell virus, or a retrovirus.

5. A recombinant host cell comprising the recombinant vector of claim 4, or a polynucleotide of claim 3 integrated into its genome; preferably, it is a bacterial, yeast, higher plant, insect or mammalian cell, more preferably Saccharomyces cerevisiae, E.coli.

6. A method of producing PbAT a polypeptide, said method comprising:

(a) Culturing the host cell of claim 5 under conditions suitable for expression;

(b) Isolating the PbAT polypeptide from the culture.

7. Use of the PbAT polypeptide of claim 1 or 2, the recombinant vector of claim 4, or the host cell of claim 5 to catalyze or to prepare a catalytic formulation that catalyzes the following reaction: and (3) carrying out acylation reaction on the C-4 position of the glucose group of the salidroside to generate the cinnaringin A.

8. A method for carrying out a catalytic reaction for the acylation of coumarone at the C-4 position of the glucose group of salidroside, characterized in that coumarone is acylated at the C-4 position of the glucose group of salidroside with the PbAT polypeptide of claim 1 or 2.

9. The preparation method of the osmanthus leaf glycoside A is characterized by comprising the following steps of: catalyzing a reaction of salidroside with a PbAT a polypeptide according to any one of claims 1 to 2 to obtain cinnarin a, preferably wherein an enzyme activity additive is further added in the catalyzing reaction, more preferably wherein the enzyme activity additive is selected from the group consisting of: ca2+, co2+, mn2+, ba2+, al3+, ni2+, zn2+, or fe2+; or a substance that can generate ca2+, co2+, mn2+, ba2+, al3+, ni2+, zn2+, or fe2+.

10. The method of claim 9, wherein the pH of the catalytic reaction system is: 6.5-8.5, preferably pH 7.4-7.6; the reaction temperature is as follows: 25. the temperature is between 35 ℃ and 28 ℃ and 30 ℃ preferably; the reaction time is 0.5 h-24 h, preferably 1 h-10 h, more preferably 2 h-3 h.