CN113754727A - Adeno-associated virus mutant and application thereof - Google Patents
Adeno-associated virus mutant and application thereof Download PDFInfo
- Publication number
- CN113754727A CN113754727A CN202111028956.9A CN202111028956A CN113754727A CN 113754727 A CN113754727 A CN 113754727A CN 202111028956 A CN202111028956 A CN 202111028956A CN 113754727 A CN113754727 A CN 113754727A
- Authority
- CN
- China
- Prior art keywords
- gly
- asn
- ser
- pro
- ala
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
- A61K48/0008—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy characterised by an aspect of the 'non-active' part of the composition delivered, e.g. wherein such 'non-active' part is not delivered simultaneously with the 'active' part of the composition
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/04—Inotropic agents, i.e. stimulants of cardiac contraction; Drugs for heart failure
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/85—Vectors or expression systems specially adapted for eukaryotic hosts for animal cells
- C12N15/86—Viral vectors
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14122—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2750/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssDNA viruses
- C12N2750/00011—Details
- C12N2750/14011—Parvoviridae
- C12N2750/14111—Dependovirus, e.g. adenoassociated viruses
- C12N2750/14141—Use of virus, viral particle or viral elements as a vector
- C12N2750/14143—Use of virus, viral particle or viral elements as a vector viral genome or elements thereof as genetic vector
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2800/00—Nucleic acids vectors
- C12N2800/10—Plasmid DNA
- C12N2800/106—Plasmid DNA for vertebrates
- C12N2800/107—Plasmid DNA for vertebrates for mammalian
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Medicinal Chemistry (AREA)
- Public Health (AREA)
- Molecular Biology (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Cardiology (AREA)
- Veterinary Medicine (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Heart & Thoracic Surgery (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Virology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Vascular Medicine (AREA)
- Physics & Mathematics (AREA)
- Hospice & Palliative Care (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Urology & Nephrology (AREA)
- Gastroenterology & Hepatology (AREA)
- Epidemiology (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Abstract
The invention relates to virosomes in the field of biology and application thereof, and particularly discloses an adeno-associated virus mutant with heart targeting and application thereof, wherein heterologous peptides are as follows: (a) a protein consisting of an amino acid sequence shown as SEQ ID No. 14; or (b) a protein derived from (a) by substituting, deleting or adding one or more amino acids in the amino acid sequence in (a) and having heterologous peptide activity. The recombinant adeno-associated virus virion constructed by the AAV capsid protein mutant has high specificity, good safety, low immunogenicity, wide application range, good heart infection, good targeting and long time for expressing foreign genes in a mouse body.
Description
The application is a divisional application of CN112194706A (application date is 09/30/2020/202011070091.8, application number is 202011070091.8, and name of invention is adeno-associated virus mutant and application thereof).
Technical Field
The invention relates to a virosome in the biological field and application thereof, in particular to an adeno-associated virus mutant with heart targeting and application thereof.
Background
Adeno-associated virus (AAV), also known as adeno-associated virus, belongs to the genus dependovirus of the family parvoviridae, is the single-stranded DNA-deficient virus of the simplest structure currently found, and requires a helper virus (usually adenovirus) to participate in replication. The AAV genome is a single-stranded DNA fragment of about 4.7kb, which is contained in a capsid of a regular icosahedral non-enveloped virus with a diameter of 20nm and can be divided into three functional regions: two open reading frames (Rep gene, Cap gene) and Inverted Terminal Repeats (ITRs). The open reading frame of the Rep gene encodes 4 multifunctional non-structural protein family (Rep) proteins, namely Rep40, Rep52, Rep68 and Rep78, and the main functions are related to replication, regulation and integration of transcription and assembly of AAV genome of the virus/vector genome. The open reading frame of the Cap gene encodes three capsid proteins VP1, VP2 and VP3, with molecular weights of 87, 73 and 61kDa, respectively, which are capsid proteins required for assembly into a complete virus and which play an important role in virus integration, replication and assembly. Differences between capsid protein sequences result in binding of different AAV serotypes to different cell surface receptors, which allows different AAV serotypes to have different tissue tropisms. Inverted Terminal Repeats (ITRs) form two T-shaped structures at the 5 'and 3' ends of the AAV genome, serve as origins of replication and are involved in the integration of the viral genome into the host genome, and play a critical role in the subsequent rescue of viral DNA from the integrated state.
The recombinant adeno-associated virus (rAAV) is derived from non-pathogenic wild adeno-associated virus, has been widely applied to basic research and clinical trials due to the advantages of wide host range, non-pathogenicity, low immunogenicity, long-term stable expression of foreign genes, good diffusion performance, stable physical properties and the like, is considered to be one of the most promising gene transfer vectors, and is widely applied to gene therapy and vaccine research in the world. Over 10 years of research, the biological properties of recombinant adeno-associated viruses have been well understood, and many data have been accumulated on the application effects of recombinant adeno-associated viruses in various cells, tissues and in vivo experiments. In medical research, rAAV is used in the study of gene therapy for a variety of diseases (including in vivo, in vitro experiments); meanwhile, the gene transfer vector is used as a characteristic gene transfer vector and is widely applied to the aspects of gene function research, disease model construction, gene knock-out mouse preparation and the like.
Since the beginning of the 20 th century 80 years of development of vectors for AAV2 for gene therapy, new platforms have been developed that involve a process that allows targeting of specific tissues and cell subtypes of patients, the core technology of these approaches being based on existing AAV variants (serotypes) and trial and error evaluations and in vivo selection of randomly introduced AAV capsid mutants.
Chinese patent document CN106062200B discloses a recombinant adeno-associated viral vector comprising a variant AAV2 capsid protein, said variant AAV2 capsid protein comprising at least 4 amino acid substitutions with respect to a wild-type AAV2 capsid protein, the use of a recombinant adeno-associated viral vector thereof in the manufacture of a medicament for delivering a gene product to neuronal, retinal or liver tissue of a subject; at present, the related research of the recombinant adeno-associated virus on the aspect of heart is still less, and the characteristics of the recombinant adeno-associated virus in the aspects of transgene expression and tissue specificity in vivo still need to be improved.
Disclosure of Invention
Compared with rAAV9, the recombinant adeno-associated virus virion constructed by the adeno-associated virus mutant has better infectivity to the heart, good safety, low immunogenicity, wide host range and high efficiency of infecting dividing and non-dividing cells and the like; and the AAV capsid protein mutant screened from the animal body has stable property.
In order to achieve the purpose, the invention adopts the technical scheme that:
a heterologous peptide which is:
(a) a protein consisting of an amino acid sequence shown as SEQ ID No. 14; alternatively, the first and second electrodes may be,
(b) and (b) the protein derived from the (a) and having the heterologous peptide activity, wherein the amino acid sequence in the (a) is substituted, deleted or added with one or more amino acids.
An AAV capsid protein mutant comprising the heterologous peptide described above.
In the technical scheme of the invention, an AAV9 capsid protein (the nucleic acid sequence of which is derived from SEQ ID NO:2 of patent EP1463805B 1) is inserted with any one heterologous peptide of SEQ ID NO:14 by a molecular biology technology to obtain an AAV capsid protein mutant, then the AAV capsid protein mutant is used for constructing a recombinant adeno-associated virus virion, the constructed recombinant adeno-associated virus virion carrying enhanced green fluorescent protein is transfected into a mouse by tail vein injection of the mouse, and the recombinant adeno-associated virus virion obtained by fluorescence microscope observation can improve the infection of the heart and has high expression in the heart.
As a preferred embodiment of the AAV capsid protein mutant of the present invention, the AAV capsid protein mutant is obtained by inserting or substituting a heterologous peptide into a continuous stretch of 5 amino acids to 20 amino acids of AAV capsid protein.
As a preferred embodiment of the AAV capsid protein mutant of the invention, the insertion site of the heterologous peptide is located between AAV capsid protein amino acid positions 411-650.
Through different experimental researches, the amino acid positions 411-650 of the AAV capsid protein are main regions targeted by AAV tissues, and the targeting of the tissues can be changed by inserting a specific peptide segment into the region.
As a preferred embodiment of the AAV capsid protein mutant of the present invention, the insertion site for the heterologous peptide is located between AAV capsid protein amino acids 588 and 589.
The recombinant adeno-associated virus virion obtained by construction has good infectivity to heart by inserting heterologous peptide between amino acids 588 and 589 of AAV capsid protein-VP 1 protein, and when the heterologous peptide with sequence SEQ ID No:14 is inserted between amino acids 588 and 589 in AAV9 capsid protein or at the corresponding position of capsid protein of other serotype virus virions, the infectivity to heart cells is better and the targeting property is good by immunofluorescence detection.
The invention also provides a recombinant adeno-associated virus virion, comprising:
a. AAV capsid protein mutants described above; and
b. a heterologous polynucleotide encoding a heterologous gene product.
As a preferred embodiment of the recombinant adeno-associated virus virion of the present invention, the gene product is a polypeptide, which can be a tumor targeting polypeptide, a bioactive polypeptide, a cardiac peptide, and a heart protecting polypeptide.
As a preferred embodiment of the recombinant adeno-associated virus virion according to the invention, the gene product is one of an interfering RNA, an aptamer, an endonuclease, a guide RNA.
In addition, another object of the present invention is to provide a use of the recombinant adeno-associated virus virion as described above in the preparation of a medicament for delivering a gene product to a tissue of a subject.
As a preferred embodiment of the use according to the invention, the tissue is selected from cardiac tissue.
In addition, another object of the present invention is to provide the use of the recombinant adeno-associated virus virion in the preparation of a medicament for preventing or treating heart diseases.
As a preferred embodiment of the use according to the invention, the heart disease is selected from the group consisting of myocardial infarction, myocardial ischemic injury, coronary heart disease, myocardial hypertrophy and myocardial fibrosis.
Compared with the prior art, the recombinant adeno-associated virus virion has high specificity, good safety, low immunogenicity and wide application range, can be applied to tissues such as heart and the like, has good infectivity to the heart and good targeting property, and has long time for expressing exogenous genes in a mouse body.
Drawings
FIG. 1 is a schematic diagram of the structure of a random 7 peptide vector library constructed according to the present invention;
FIG. 2 is a schematic structural diagram of a mutant Rep-CAP plasmid constructed in accordance with the present invention;
FIG. 3 is a schematic representation of microscopic examination of the effect of rAAV9 virus as a control group on mouse hearts;
FIG. 4A is a schematic microscopic examination of the effect of AAV capsid protein mutant 1 on mouse heart;
FIG. 4B is a schematic microscopic examination of the effect of AAV capsid protein mutant 2 on mouse heart;
FIG. 4C is a schematic microscopic examination of the effect of AAV capsid protein mutant 3 on mouse heart;
FIG. 4D is a schematic microscopic examination of the effect of AAV capsid protein mutant 4 on mouse heart;
FIG. 5 is a statistical chart of immunofluorescence contrast between rAAV9 virus and AAV capsid protein mutants 1-4.
Detailed Description
To better illustrate the objects, aspects and advantages of the present invention, the present invention will be further described with reference to the accompanying drawings and specific embodiments.
In the following examples, the AAV9 nucleic acid sequence was derived from SEQ ID NO 2 of patent EP1463805B1, the AAV5 nucleic acid sequence was derived from http:// www.ncbi.nlm.nih.gov/nuccore/NC006152, and the AAV2 nucleic acid sequence was derived from http:// www.ncbi.nlm.nih.gov/nuccore/NC 001401.
Example 1 construction of AAV9 capsid protein mutant library backbone vectors and mutant Rep-CAP vectors
1. Constructing AAV9 capsid protein mutant library backbone plasmids:
the framework vector comprises an AAV5 p41 promoter fragment, an AAV2 rep splicing signal sequence and a mutation frameshifting AAV9 CAP sequence (wherein the AAV9 CAP sequence mutates K at an original amino acid site 449 into R, the nucleic acid sequence mutates tcaaag into tctaga, an XbaI enzyme cutting site is introduced, the nucleic acid sequence of an amino acid G at an original amino acid site 594 is mutated from ggc into ggt, a BshTI enzyme cutting site is introduced, a 34bp sequence containing a termination code is inserted between an original amino acid site 588 and a site 589 to cause frameshifting of the sequence and avoid pollution caused by incomplete enzyme cutting of the framework vector), and an SV 40A polysequence is added after the CAP sequence. The sequences are synthesized by a gene synthesis method and inserted between ITR sequences of rAAV vectors to form AAV9 capsid protein mutant library skeleton plasmids.
2. Constructing a mutant Rep-CAP plasmid:
the method for inserting stop codon in 50bp after the initiation codon of VP1, VP2 and VP3 proteins of CAP sequence in AAV9 makes Rep-CAP vector only express Rep protein and not VP1, VP2 and VP3 proteins of CAP sequence, thereby avoiding the contamination of CAP sequence in original AAV9, and the designed above-mentioned sequences are synthesized by gene synthesis method and inserted with CAP sequence replacing the Rep-CAP vector (see FIG. 2).
3. Constructing a random 7 peptide vector library:
design 2 primers using oligo6, including primer 1(5'- > 3'):
ACTCATCGACCAATACTTGTACTATCTCTCTAGAAC
primer 2(5'- > 3'):
GTATTCCTTGGTTTTGAACCCAACCGGTCTGCGCCTGTGCMNNMNNMNNMNNMNNMNNMNNTTGGGCACTCTGGTGGTTTGTG
one of the 21bp nucleic acid sequences contains random 7 peptide, and AAV9 capsid protein mutant library skeleton vector is used as template to perform PCR amplification to obtain a fragment containing random sequence (see FIG. 1). And (3) carrying out gel electrophoresis on the fragments and recovering target size fragments by using gel to obtain the purified nucleic acid fragment of the random 7 peptide library. The fragment is connected into AAV9 capsid protein mutant library framework vector by means of Gibson homologous recombination connection (through XbaI and BshTI double digestion and gel recovery and purification). The ligated vector was purified by PCR product purification kit and digested with Plasmid-Safe DNase enzyme to remove non-ligated fragments. And finally, purifying by a PCR product purification kit to obtain the constructed AAV9 random 7 peptide vector library.
4. Constructing a random 7 peptide virus mutant library:
co-transferring the mutated Rep-Cap plasmid, AAV9 random 7 peptide vector library plasmid and pHelper plasmid into HEK-293T cell in proper amount by means of 3 plasmid transfection, purifying AAV virus by iodixanol gradient ultra-high speed centrifugation, measuring virus titer at 1012GC/mL-1013GC/mL was the appropriate titer and left at-80 ℃ until use.
5. Screening for AAV capsid protein mutants:
the random 7 peptide virus mutant library constructed above was expressed as 1011The GC dose is injected into a C57 mouse body in a tail vein injection mode, after the mouse body is raised in an SPF level environment for 1 week, the mouse is dissected, the heart is drawn, and tissues obtained after the heart is placed at-80 ℃ for storage.
Extracting AAV genomes in the random 7-peptide virus mutant library by a tissue DNA extraction kit, designing corresponding primers for PCR amplification, carrying out gel electrophoresis on amplified PCR products to confirm the size of a band, cutting off a target band segment, and recycling the products by using a gel recycling kit. And (3) recombining and connecting the recovered PCR product fragment with an enzyme cutting framework (XbaI and BshTI are subjected to double enzyme cutting and gel recovery of the framework fragment), converting the connected product into stbl3 competent cells, coating an Amp resistant plate, culturing overnight, and selecting a monoclonal colony for sequencing the next day. Meanwhile, the amplified PCR fragment product is used for the construction of a random library in the next round, and the process of screening in the animal body is repeated. After 2-4 rounds of screening, and by comparing the sequencing results, highly repetitive enriched sequences were found. Taking the highly repetitive sequence as a candidate AAV capsid protein mutant, wherein the AAV capsid protein mutant has a heterologous peptide with any one of the nucleic acid sequences of SEQ ID No. 1-SEQ ID No. 12, the amino acid sequence of the heterologous peptide is shown as SEQ ID No. 13-SEQ ID No. 24, the candidate AAV capsid protein mutant is respectively marked as AAV capsid protein mutants 1-4 (the heterologous peptides with the nucleic acid sequences of SEQ ID No. 1-SEQ ID No. 4 in sequence), and the nucleic acid sequences are shown as SEQ ID No. 25, SEQ ID No. 27, SEQ ID No. 29 and SEQ ID No. 31; the amino acid sequence is shown as SEQ ID No. 26, SEQ ID No. 28, SEQ ID No. 30 and SEQ ID No. 32, and then the animal experiment is further verified.
Example 2 construction of AAV capsid protein mutants
1. Construction of mutant serotype vectors:
1) enzyme cutting skeleton: carrying out double digestion on the Rep-CAP plasmid of AAV9 by BsiWI and AfeI, carrying out gel electrophoresis, cutting a band with the size of a target fragment, and carrying out gel recovery;
2) the target fragment: carrying out double digestion on the AAV capsid protein mutant of the target plasmid obtained by screening by BsiWI and AfeI, carrying out gel electrophoresis, cutting a band with the size of a target fragment, and carrying out gel recovery;
3) connecting: marking 1 clean 200uL PCR tube, placing the tube on an ice box, preparing reaction liquid from the enzyme digestion skeleton and the target fragment according to the mol ratio of 1:3, and reacting in a PCR instrument at 16 ℃ for 30min for connection;
4) and (3) transformation: 50 μ L of competent cells were thawed on ice; 10 μ L of the ligation product was mixed with stbl3 competent cells and left on ice for 20-30 min; heat shock is carried out for 45 seconds at 42 ℃; rapidly placing on ice bath for 2 minutes, adding 400 μ L SOC culture medium (without antibiotic), culturing at 37 deg.C and 200rpm for 1 h; uniformly coating the solution on Amp+Resistant plates were incubated at 37 ℃ for 14-16 hours.
5) Shaking the bacteria: the monoclonal bacteria were selected and cultured in 4ml of liquid LB medium (Amp)+Resistance) and cultured at 37 ℃ for 14-16 hours.
2. Plasmid extraction:
centrifuging the obtained bacterial liquid at 12000rpm for 1 minute, and pouring out a supernatant culture medium; adding 250 mu L of buffer P1/RNaseA mixed solution, and carrying out high-speed vortex to resuspend bacteria; adding 250 μ L of buffer P2, and reversing the upper part and the lower part 8-10 times; adding 350 mu L of buffer P3, immediately reversing and uniformly mixing 8-10 times to completely neutralize the solution; centrifuging at 13000rpm for 10 minutes, taking the supernatant and passing through a column; centrifuging for 1 minute at 12000, pouring out waste liquid, adding 500 μ L PW1, centrifuging for 1 minute at 12000, and pouring out waste liquid; adding 600 μ L PW2, centrifuging for 1 min at 12000, and removing supernatant; adding 600 μ L PW2, centrifuging for 1 min at 12000, and removing supernatant; idling at 12000rpm for 2 minutes; adding preheated eluent of 30-50 μ L at 55 deg.C, standing for 2 min, and centrifuging at 12000rpm for 1 min. The concentration of the obtained plasmid is detected, 10 mu L of positive plasmid identified by enzyme digestion is taken out and sequenced, and the positive plasmid is stored at-20 ℃. The sequencing result shows that the obtained plasmid can encode the variant capsid protein VP 1.
3. Packaging and purification of mutant serotype virions
The obtained Rep-Cap plasmid containing mutant serotype expresses a plasmid pAAV-CAG-eGFP of green fluorescent protein eGFP, pHelper plasmid is cotransferred into HEK-293T cells in proper amount, AAV virus is purified by iodixanol gradient ultra-high speed centrifugation, and the virus titer is measured to be 1013GC/mL was the appropriate titer and left at-80 ℃ until use.
Example 3 Effect of AAV capsid protein mutants on mouse Heart
The experimental steps are as follows:
1) tail vein injection mouse
Selecting male SPF grade C57 mice of 6-8 weeks, 18-20g, using rAAV9 virus as control group, AAV capsid protein mutant as experimental group, each group comprises at least 5 mice, and each mouse is injected into tail vein by 1012GC virus amount, mice were heart-harvested 1 week later.
2) Mouse heart tissue section and immunofluorescence contrast
A. Preparation of frozen sections
1. Tissue fixation: and (3) fixing the fresh tissue fixing solution for more than 24 hours, taking out the tissue from the fixing solution, and flattening the tissue of the target part by using a scalpel.
2. And (3) dehydrating: placing the trimmed tissue in 15% sucrose solution, dehydrating and precipitating at 4 deg.C in refrigerator, transferring into 30% sucrose solution, dehydrating and precipitating at 4 deg.C in refrigerator.
3, OCT embedding: taking out the dehydrated tissue, slightly absorbing surface water with filter paper, placing the tissue on an embedding platform with the section upward, dripping OCT embedding agent around the tissue, placing the embedding platform on a quick-freezing platform of a freezing microtome for quick-freezing embedding, and slicing after the OCT turns white and becomes hard. The direct frozen section of the fresh tissue does not need to be fixed and dehydrated, and the target part tissue is directly flattened by a scalpel to obtain an OCT embedding medium embedding section.
4. Slicing: fixing the embedding table on a slicer, roughly cutting, trimming and flattening the tissue surface to start slicing, wherein the slicing thickness is 8-10 μm, and flatly placing a clean glass slide on the cut tissue piece to stick the tissue on the glass slide. After the label is written on the slice, the slice is stored at the temperature of minus 20 ℃ for standby.
B. Immunofluorescence and photographic film
1. Freezing and fixing the section: the frozen section was taken out of the refrigerator and rewarmed, dried in air, fixed for 10min with paraformaldehyde, and after complete drying of the paraformaldehyde, washed 3 times on a decolouring shaker for 5min each time, with shaking in PBS (pH 7.4).
2. Antigen retrieval: the tissue slices were placed in a reconditioning box filled with EDTA antigen reconditioning buffer (pH9.0) for antigen reconditioning in a microwave oven. Stopping the fire for 8min, and stopping the fire for 7min, wherein excessive evaporation of the buffer solution should be prevented during the process, and the dry tablets should not be cut. After natural cooling, the slides were washed 3 times for 5min in PBS (pH7.4) with shaking on a destaining shaker. (the repair buffer may be determined for different tissues and may be commercially available)
3. And (3) sealing the circled serum: after the section is slightly dried, a circle is drawn around the tissue by a organizing pen (to prevent the antibody from flowing away), PBS is dried by drying, BSA is dripped, and the section is sealed for 30 min.
4. Adding a primary antibody: PBS is dripped on the slices to prepare primary antibody according to a certain proportion, and the slices are flatly placed in a wet box to be incubated overnight at 4 ℃. (Small amount of water added in wet box to prevent evaporation of antibody)
5. Adding a secondary antibody: slides were washed 3 times in PBS (pH7.4) with shaking on a destaining shaker for 5min each time. After the section is slightly dried, a secondary antibody covering tissue corresponding to the primary antibody is dripped into the ring, and the section is incubated for 50min at room temperature in a dark place.
DAPI counterstained nuclei: slides were washed 3 times in PBS (pH7.4) with shaking on a destaining shaker for 5min each time. After the section is slightly dried, DAPI dye liquor is dripped into the circle, and the section is incubated for 10min at room temperature in a dark place.
7. Sealing: slides were washed 3 times in PBS (pH7.4) with shaking on a destaining shaker for 5min each time. The slices were slightly spun dry and mounted with an anti-fluorescent quenching mounting agent.
8. And (5) microscopic examination and photographing: the sections were observed under a fluorescent microscope and images were collected (photographed using consistent exposure times and conditions). (DAPI ultraviolet excitation wavelength 330-.
9. Average fluorescence intensity statistics: the immunofluorescence pictures were processed using ImageJ software to obtain fluorescence intensity values and statistically analyzed.
The experimental results of the AAV capsid protein mutants on the heart of the mouse show that the rAAV9 virus as the microscopic examination of the control group (refer to fig. 3) shows that, compared to the control group, the AAV capsid protein mutants 1 to 12 of the present invention have better infectivity on the heart of the mouse, wherein the AAV capsid protein mutants 1 to 4 have better infectivity on the heart of the mouse (refer to fig. 4A, 4B, 4C and 4D), and the AAV capsid protein mutants have the best infectivity on the heart of the mouse.
According to FIG. 5, the mean fluorescence intensity ratio of AAV capsid protein mutants 1-4 is higher than that of rAAV9 virus, wherein the mean fluorescence intensity ratio is highest for AAV capsid protein mutant 1.
Finally, it should be noted that the above embodiments are only used for illustrating the technical solutions of the present invention and not for limiting the protection scope of the present invention, and although the present invention is described in detail with reference to the preferred embodiments, it should be understood by those skilled in the art that modifications or equivalent substitutions can be made on the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention.
SEQUENCE LISTING
<110> Guangzhou Pachy Biotechnology Ltd
<120> adeno-associated virus mutant and application thereof
<130> 2020.09.25
<160> 32
<170> PatentIn version 3.5
<210> 1
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 1
tcgaatgcga cgcgtctggt t 21
<210> 2
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 2
ccgaggagtt ctacggagag g 21
<210> 3
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 3
tctctgactc gtgcttcgat g 21
<210> 4
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 4
gggaatttga ttcggaataa t 21
<210> 5
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 5
actaatttga ctaagccgta t 21
<210> 6
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 6
acgccgaata atcgtgtgca g 21
<210> 7
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 7
tttgcgccga atggtactcg g 21
<210> 8
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 8
atgccgaaga gtccgatgtc g 21
<210> 9
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 9
atgcttcata agcctaatag t 21
<210> 10
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 10
cgtacgacgt atgggccgaa t 21
<210> 11
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 11
cgggcttctt cgcaggcgtc t 21
<210> 12
<211> 21
<212> DNA
<213> Artificial Synthesis
<400> 12
atgaatgata ttcggtctcg t 21
<210> 13
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 13
Ser Asn Ala Thr Arg Leu Val
1 5
<210> 14
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 14
Pro Arg Ser Ser Thr Glu Arg
1 5
<210> 15
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 15
Ser Leu Thr Arg Ala Ser Met
1 5
<210> 16
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 16
Gly Asn Leu Ile Arg Asn Asn
1 5
<210> 17
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 17
Thr Asn Leu Thr Lys Pro Tyr
1 5
<210> 18
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 18
Thr Pro Asn Asn Arg Val Gln
1 5
<210> 19
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 19
Phe Ala Pro Asn Gly Thr Arg
1 5
<210> 20
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 20
Met Pro Lys Ser Pro Met Ser
1 5
<210> 21
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 21
Met Leu His Lys Pro Asn Ser
1 5
<210> 22
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 22
Arg Thr Thr Tyr Gly Pro Asn
1 5
<210> 23
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 23
Arg Ala Ser Ser Gln Ala Ser
1 5
<210> 24
<211> 7
<212> PRT
<213> Artificial Synthesis
<400> 24
Met Asn Asp Ile Arg Ser Arg
1 5
<210> 25
<211> 2232
<212> DNA
<213> nucleic acid sequence of AAV capsid protein mutant 1
<400> 25
atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga aggaattcgc 60
gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac 120
aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac 180
aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240
cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 300
caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360
gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 420
ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 480
aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag 540
tcagtcccag accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600
cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660
gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 720
accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780
tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 840
tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 900
ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 960
caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 1020
acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 1080
gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 1140
acgcttaatg atggaagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200
ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260
cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 1320
gaccaatact tgtactatct ctctagaact attaacggtt ctggacagaa tcaacaaacg 1380
ctaaaattca gtgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 1440
ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500
tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560
ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 1620
ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 1680
accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 1740
gccacaaacc accagagtgc ccaatcgaat gcgacgcgtc tggttgcaca ggcgcagacc 1800
ggttgggttc aaaaccaagg aatacttccg ggtatggttt ggcaggacag agatgtgtac 1860
ctgcaaggac ccatttgggc caaaattcct cacacggacg gcaactttca cccttctccg 1920
ctgatgggag ggtttggaat gaagcacccg cctcctcaga tcctcatcaa aaacacacct 1980
gtacctgcgg atcctccaac ggccttcaac aaggacaagc tgaactcttt catcacccag 2040
tattctactg gccaagtcag cgtggagatc gagtgggagc tgcagaagga aaacagcaag 2100
cgctggaacc cggagatcca gtacacttcc aactattaca agtctaataa tgttgaattt 2160
gctgttaata ctgaaggtgt atatagtgaa ccccgcccca ttggcaccag atacctgact 2220
cgtaatctgt aa 2232
<210> 26
<211> 743
<212> PRT
<213> amino acid sequence of AAV capsid protein mutant 1
<400> 26
Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser
1 5 10 15
Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro
20 25 30
Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro
35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro
50 55 60
Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp
65 70 75 80
Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala
85 90 95
Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly
100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro
115 120 125
Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg
130 135 140
Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly
145 150 155 160
Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175
Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro
180 185 190
Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly
195 200 205
Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser
210 215 220
Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile
225 230 235 240
Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu
245 250 255
Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn
260 265 270
Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg
275 280 285
Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn
290 295 300
Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile
305 310 315 320
Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn
325 330 335
Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu
340 345 350
Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro
355 360 365
Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp
370 375 380
Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe
385 390 395 400
Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu
405 410 415
Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu
420 425 430
Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser
435 440 445
Arg Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser
450 455 460
Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro
465 470 475 480
Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn
485 490 495
Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn
500 505 510
Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys
515 520 525
Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly
530 535 540
Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile
545 550 555 560
Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser
565 570 575
Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ser Asn Ala Thr
580 585 590
Arg Leu Val Ala Gln Ala Gln Thr Gly Trp Val Gln Asn Gln Gly Ile
595 600 605
Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro
610 615 620
Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser Pro
625 630 635 640
Leu Met Gly Gly Phe Gly Met Lys His Pro Pro Pro Gln Ile Leu Ile
645 650 655
Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr Ala Phe Asn Lys Asp
660 665 670
Lys Leu Asn Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val
675 680 685
Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro
690 695 700
Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Asn Asn Val Glu Phe
705 710 715 720
Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr
725 730 735
Arg Tyr Leu Thr Arg Asn Leu
740
<210> 27
<211> 2232
<212> DNA
<213> nucleic acid sequence of AAV capsid protein mutant 2
<400> 27
atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga aggaattcgc 60
gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac 120
aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac 180
aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240
cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 300
caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360
gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 420
ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 480
aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag 540
tcagtcccag accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600
cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660
gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 720
accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780
tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 840
tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 900
ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 960
caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 1020
acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 1080
gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 1140
acgcttaatg atggaagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200
ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260
cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 1320
gaccaatact tgtactatct ctctagaact attaacggtt ctggacagaa tcaacaaacg 1380
ctaaaattca gtgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 1440
ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500
tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560
ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 1620
ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 1680
accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 1740
gccacaaacc accagagtgc ccaaccgagg agttctacgg agagggcaca ggcgcagacc 1800
ggttgggttc aaaaccaagg aatacttccg ggtatggttt ggcaggacag agatgtgtac 1860
ctgcaaggac ccatttgggc caaaattcct cacacggacg gcaactttca cccttctccg 1920
ctgatgggag ggtttggaat gaagcacccg cctcctcaga tcctcatcaa aaacacacct 1980
gtacctgcgg atcctccaac ggccttcaac aaggacaagc tgaactcttt catcacccag 2040
tattctactg gccaagtcag cgtggagatc gagtgggagc tgcagaagga aaacagcaag 2100
cgctggaacc cggagatcca gtacacttcc aactattaca agtctaataa tgttgaattt 2160
gctgttaata ctgaaggtgt atatagtgaa ccccgcccca ttggcaccag atacctgact 2220
cgtaatctgt aa 2232
<210> 28
<211> 743
<212> PRT
<213> amino acid sequence of AAV capsid protein mutant 2
<400> 28
Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser
1 5 10 15
Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro
20 25 30
Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro
35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro
50 55 60
Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp
65 70 75 80
Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala
85 90 95
Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly
100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro
115 120 125
Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg
130 135 140
Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly
145 150 155 160
Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175
Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro
180 185 190
Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly
195 200 205
Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser
210 215 220
Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile
225 230 235 240
Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu
245 250 255
Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn
260 265 270
Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg
275 280 285
Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn
290 295 300
Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile
305 310 315 320
Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn
325 330 335
Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu
340 345 350
Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro
355 360 365
Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp
370 375 380
Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe
385 390 395 400
Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu
405 410 415
Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu
420 425 430
Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser
435 440 445
Arg Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser
450 455 460
Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro
465 470 475 480
Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn
485 490 495
Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn
500 505 510
Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys
515 520 525
Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly
530 535 540
Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile
545 550 555 560
Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser
565 570 575
Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Pro Arg Ser Ser
580 585 590
Thr Glu Arg Ala Gln Ala Gln Thr Gly Trp Val Gln Asn Gln Gly Ile
595 600 605
Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro
610 615 620
Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser Pro
625 630 635 640
Leu Met Gly Gly Phe Gly Met Lys His Pro Pro Pro Gln Ile Leu Ile
645 650 655
Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr Ala Phe Asn Lys Asp
660 665 670
Lys Leu Asn Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val
675 680 685
Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro
690 695 700
Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Asn Asn Val Glu Phe
705 710 715 720
Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr
725 730 735
Arg Tyr Leu Thr Arg Asn Leu
740
<210> 29
<211> 2232
<212> DNA
<213> nucleic acid sequence of AAV capsid protein mutant 3
<400> 29
atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga aggaattcgc 60
gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac 120
aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac 180
aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240
cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 300
caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360
gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 420
ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 480
aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag 540
tcagtcccag accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600
cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660
gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 720
accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780
tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 840
tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 900
ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 960
caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 1020
acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 1080
gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 1140
acgcttaatg atggaagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200
ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260
cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 1320
gaccaatact tgtactatct ctctagaact attaacggtt ctggacagaa tcaacaaacg 1380
ctaaaattca gtgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 1440
ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500
tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560
ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 1620
ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 1680
accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 1740
gccacaaacc accagagtgc ccaatctctg actcgtgctt cgatggcaca ggcgcagacc 1800
ggttgggttc aaaaccaagg aatacttccg ggtatggttt ggcaggacag agatgtgtac 1860
ctgcaaggac ccatttgggc caaaattcct cacacggacg gcaactttca cccttctccg 1920
ctgatgggag ggtttggaat gaagcacccg cctcctcaga tcctcatcaa aaacacacct 1980
gtacctgcgg atcctccaac ggccttcaac aaggacaagc tgaactcttt catcacccag 2040
tattctactg gccaagtcag cgtggagatc gagtgggagc tgcagaagga aaacagcaag 2100
cgctggaacc cggagatcca gtacacttcc aactattaca agtctaataa tgttgaattt 2160
gctgttaata ctgaaggtgt atatagtgaa ccccgcccca ttggcaccag atacctgact 2220
cgtaatctgt aa 2232
<210> 30
<211> 743
<212> PRT
<213> amino acid sequence of AAV capsid protein mutant 3
<400> 30
Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser
1 5 10 15
Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro
20 25 30
Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro
35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro
50 55 60
Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp
65 70 75 80
Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala
85 90 95
Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly
100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro
115 120 125
Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg
130 135 140
Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly
145 150 155 160
Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175
Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro
180 185 190
Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly
195 200 205
Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser
210 215 220
Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile
225 230 235 240
Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu
245 250 255
Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn
260 265 270
Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg
275 280 285
Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn
290 295 300
Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile
305 310 315 320
Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn
325 330 335
Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu
340 345 350
Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro
355 360 365
Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp
370 375 380
Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe
385 390 395 400
Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu
405 410 415
Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu
420 425 430
Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser
435 440 445
Arg Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser
450 455 460
Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro
465 470 475 480
Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn
485 490 495
Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn
500 505 510
Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys
515 520 525
Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly
530 535 540
Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile
545 550 555 560
Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser
565 570 575
Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Ser Leu Thr Arg
580 585 590
Ala Ser Met Ala Gln Ala Gln Thr Gly Trp Val Gln Asn Gln Gly Ile
595 600 605
Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro
610 615 620
Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser Pro
625 630 635 640
Leu Met Gly Gly Phe Gly Met Lys His Pro Pro Pro Gln Ile Leu Ile
645 650 655
Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr Ala Phe Asn Lys Asp
660 665 670
Lys Leu Asn Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val
675 680 685
Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro
690 695 700
Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Asn Asn Val Glu Phe
705 710 715 720
Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr
725 730 735
Arg Tyr Leu Thr Arg Asn Leu
740
<210> 31
<211> 2232
<212> DNA
<213> nucleic acid sequence of AAV capsid protein mutant 4
<400> 31
atggctgccg atggttatct tccagattgg ctcgaggaca accttagtga aggaattcgc 60
gagtggtggg ctttgaaacc tggagcccct caacccaagg caaatcaaca acatcaagac 120
aacgctcgag gtcttgtgct tccgggttac aaataccttg gacccggcaa cggactcgac 180
aagggggagc cggtcaacgc agcagacgcg gcggccctcg agcacgacaa ggcctacgac 240
cagcagctca aggccggaga caacccgtac ctcaagtaca accacgccga cgccgagttc 300
caggagcggc tcaaagaaga tacgtctttt gggggcaacc tcgggcgagc agtcttccag 360
gccaaaaaga ggcttcttga acctcttggt ctggttgagg aagcggctaa gacggctcct 420
ggaaagaaga ggcctgtaga gcagtctcct caggaaccgg actcctccgc gggtattggc 480
aaatcgggtg cacagcccgc taaaaagaga ctcaatttcg gtcagactgg cgacacagag 540
tcagtcccag accctcaacc aatcggagaa cctcccgcag ccccctcagg tgtgggatct 600
cttacaatgg cttcaggtgg tggcgcacca gtggcagaca ataacgaagg tgccgatgga 660
gtgggtagtt cctcgggaaa ttggcattgc gattcccaat ggctggggga cagagtcatc 720
accaccagca cccgaacctg ggccctgccc acctacaaca atcacctcta caagcaaatc 780
tccaacagca catctggagg atcttcaaat gacaacgcct acttcggcta cagcaccccc 840
tgggggtatt ttgacttcaa cagattccac tgccacttct caccacgtga ctggcagcga 900
ctcatcaaca acaactgggg attccggcct aagcgactca acttcaagct cttcaacatt 960
caggtcaaag aggttacgga caacaatgga gtcaagacca tcgccaataa ccttaccagc 1020
acggtccagg tcttcacgga ctcagactat cagctcccgt acgtgctcgg gtcggctcac 1080
gagggctgcc tcccgccgtt cccagcggac gttttcatga ttcctcagta cgggtatctg 1140
acgcttaatg atggaagcca ggccgtgggt cgttcgtcct tttactgcct ggaatatttc 1200
ccgtcgcaaa tgctaagaac gggtaacaac ttccagttca gctacgagtt tgagaacgta 1260
cctttccata gcagctacgc tcacagccaa agcctggacc gactaatgaa tccactcatc 1320
gaccaatact tgtactatct ctctagaact attaacggtt ctggacagaa tcaacaaacg 1380
ctaaaattca gtgtggccgg acccagcaac atggctgtcc agggaagaaa ctacatacct 1440
ggacccagct accgacaaca acgtgtctca accactgtga ctcaaaacaa caacagcgaa 1500
tttgcttggc ctggagcttc ttcttgggct ctcaatggac gtaatagctt gatgaatcct 1560
ggacctgcta tggccagcca caaagaagga gaggaccgtt tctttccttt gtctggatct 1620
ttaatttttg gcaaacaagg aactggaaga gacaacgtgg atgcggacaa agtcatgata 1680
accaacgaag aagaaattaa aactactaac ccggtagcaa cggagtccta tggacaagtg 1740
gccacaaacc accagagtgc ccaagggaat ttgattcgga ataatgcaca ggcgcagacc 1800
ggttgggttc aaaaccaagg aatacttccg ggtatggttt ggcaggacag agatgtgtac 1860
ctgcaaggac ccatttgggc caaaattcct cacacggacg gcaactttca cccttctccg 1920
ctgatgggag ggtttggaat gaagcacccg cctcctcaga tcctcatcaa aaacacacct 1980
gtacctgcgg atcctccaac ggccttcaac aaggacaagc tgaactcttt catcacccag 2040
tattctactg gccaagtcag cgtggagatc gagtgggagc tgcagaagga aaacagcaag 2100
cgctggaacc cggagatcca gtacacttcc aactattaca agtctaataa tgttgaattt 2160
gctgttaata ctgaaggtgt atatagtgaa ccccgcccca ttggcaccag atacctgact 2220
cgtaatctgt aa 2232
<210> 32
<211> 743
<212> PRT
<213> amino acid sequence of AAV capsid protein mutant 4
<400> 32
Met Ala Ala Asp Gly Tyr Leu Pro Asp Trp Leu Glu Asp Asn Leu Ser
1 5 10 15
Glu Gly Ile Arg Glu Trp Trp Ala Leu Lys Pro Gly Ala Pro Gln Pro
20 25 30
Lys Ala Asn Gln Gln His Gln Asp Asn Ala Arg Gly Leu Val Leu Pro
35 40 45
Gly Tyr Lys Tyr Leu Gly Pro Gly Asn Gly Leu Asp Lys Gly Glu Pro
50 55 60
Val Asn Ala Ala Asp Ala Ala Ala Leu Glu His Asp Lys Ala Tyr Asp
65 70 75 80
Gln Gln Leu Lys Ala Gly Asp Asn Pro Tyr Leu Lys Tyr Asn His Ala
85 90 95
Asp Ala Glu Phe Gln Glu Arg Leu Lys Glu Asp Thr Ser Phe Gly Gly
100 105 110
Asn Leu Gly Arg Ala Val Phe Gln Ala Lys Lys Arg Leu Leu Glu Pro
115 120 125
Leu Gly Leu Val Glu Glu Ala Ala Lys Thr Ala Pro Gly Lys Lys Arg
130 135 140
Pro Val Glu Gln Ser Pro Gln Glu Pro Asp Ser Ser Ala Gly Ile Gly
145 150 155 160
Lys Ser Gly Ala Gln Pro Ala Lys Lys Arg Leu Asn Phe Gly Gln Thr
165 170 175
Gly Asp Thr Glu Ser Val Pro Asp Pro Gln Pro Ile Gly Glu Pro Pro
180 185 190
Ala Ala Pro Ser Gly Val Gly Ser Leu Thr Met Ala Ser Gly Gly Gly
195 200 205
Ala Pro Val Ala Asp Asn Asn Glu Gly Ala Asp Gly Val Gly Ser Ser
210 215 220
Ser Gly Asn Trp His Cys Asp Ser Gln Trp Leu Gly Asp Arg Val Ile
225 230 235 240
Thr Thr Ser Thr Arg Thr Trp Ala Leu Pro Thr Tyr Asn Asn His Leu
245 250 255
Tyr Lys Gln Ile Ser Asn Ser Thr Ser Gly Gly Ser Ser Asn Asp Asn
260 265 270
Ala Tyr Phe Gly Tyr Ser Thr Pro Trp Gly Tyr Phe Asp Phe Asn Arg
275 280 285
Phe His Cys His Phe Ser Pro Arg Asp Trp Gln Arg Leu Ile Asn Asn
290 295 300
Asn Trp Gly Phe Arg Pro Lys Arg Leu Asn Phe Lys Leu Phe Asn Ile
305 310 315 320
Gln Val Lys Glu Val Thr Asp Asn Asn Gly Val Lys Thr Ile Ala Asn
325 330 335
Asn Leu Thr Ser Thr Val Gln Val Phe Thr Asp Ser Asp Tyr Gln Leu
340 345 350
Pro Tyr Val Leu Gly Ser Ala His Glu Gly Cys Leu Pro Pro Phe Pro
355 360 365
Ala Asp Val Phe Met Ile Pro Gln Tyr Gly Tyr Leu Thr Leu Asn Asp
370 375 380
Gly Ser Gln Ala Val Gly Arg Ser Ser Phe Tyr Cys Leu Glu Tyr Phe
385 390 395 400
Pro Ser Gln Met Leu Arg Thr Gly Asn Asn Phe Gln Phe Ser Tyr Glu
405 410 415
Phe Glu Asn Val Pro Phe His Ser Ser Tyr Ala His Ser Gln Ser Leu
420 425 430
Asp Arg Leu Met Asn Pro Leu Ile Asp Gln Tyr Leu Tyr Tyr Leu Ser
435 440 445
Arg Thr Ile Asn Gly Ser Gly Gln Asn Gln Gln Thr Leu Lys Phe Ser
450 455 460
Val Ala Gly Pro Ser Asn Met Ala Val Gln Gly Arg Asn Tyr Ile Pro
465 470 475 480
Gly Pro Ser Tyr Arg Gln Gln Arg Val Ser Thr Thr Val Thr Gln Asn
485 490 495
Asn Asn Ser Glu Phe Ala Trp Pro Gly Ala Ser Ser Trp Ala Leu Asn
500 505 510
Gly Arg Asn Ser Leu Met Asn Pro Gly Pro Ala Met Ala Ser His Lys
515 520 525
Glu Gly Glu Asp Arg Phe Phe Pro Leu Ser Gly Ser Leu Ile Phe Gly
530 535 540
Lys Gln Gly Thr Gly Arg Asp Asn Val Asp Ala Asp Lys Val Met Ile
545 550 555 560
Thr Asn Glu Glu Glu Ile Lys Thr Thr Asn Pro Val Ala Thr Glu Ser
565 570 575
Tyr Gly Gln Val Ala Thr Asn His Gln Ser Ala Gln Gly Asn Leu Ile
580 585 590
Arg Asn Asn Ala Gln Ala Gln Thr Gly Trp Val Gln Asn Gln Gly Ile
595 600 605
Leu Pro Gly Met Val Trp Gln Asp Arg Asp Val Tyr Leu Gln Gly Pro
610 615 620
Ile Trp Ala Lys Ile Pro His Thr Asp Gly Asn Phe His Pro Ser Pro
625 630 635 640
Leu Met Gly Gly Phe Gly Met Lys His Pro Pro Pro Gln Ile Leu Ile
645 650 655
Lys Asn Thr Pro Val Pro Ala Asp Pro Pro Thr Ala Phe Asn Lys Asp
660 665 670
Lys Leu Asn Ser Phe Ile Thr Gln Tyr Ser Thr Gly Gln Val Ser Val
675 680 685
Glu Ile Glu Trp Glu Leu Gln Lys Glu Asn Ser Lys Arg Trp Asn Pro
690 695 700
Glu Ile Gln Tyr Thr Ser Asn Tyr Tyr Lys Ser Asn Asn Val Glu Phe
705 710 715 720
Ala Val Asn Thr Glu Gly Val Tyr Ser Glu Pro Arg Pro Ile Gly Thr
725 730 735
Arg Tyr Leu Thr Arg Asn Leu
740
Claims (12)
1. A heterologous peptide, wherein the heterologous peptide is:
(a) a protein consisting of an amino acid sequence shown as SEQ ID No. 14; alternatively, the first and second electrodes may be,
(b) and (b) the protein derived from the (a) and having the heterologous peptide activity, wherein the amino acid sequence in the (a) is substituted, deleted or added with one or more amino acids.
2. An AAV capsid protein mutant, wherein said AAV capsid protein mutant comprises the heterologous peptide of claim 1.
3. The AAV capsid protein mutant according to claim 2, wherein the AAV capsid protein mutant is obtained by inserting or replacing a heterologous peptide into a contiguous stretch of 5 amino acids to 20 amino acids of an AAV capsid protein.
4. The AAV capsid protein mutant according to claim 3, wherein the insertion site for the heterologous peptide is located between AAV capsid protein amino acid positions 411-650.
5. The AAV capsid protein mutant according to claim 4, wherein the insertion site for the heterologous peptide is located between AAV capsid protein amino acids 588 and 589.
6. A recombinant adeno-associated virus virion, comprising:
a. an AAV capsid protein mutant according to any one of claims 1 to 5; and
b. a heterologous polynucleotide encoding a heterologous gene product.
7. The recombinant adeno-associated virus virion of claim 6, wherein the gene product is a polypeptide.
8. The recombinant adeno-associated viral virion of claim 6, wherein the gene product is one of an interfering RNA, an aptamer, an endonuclease, and a guide RNA.
9. Use of the recombinant adeno-associated virus virion of any of claims 6 to 8 in the preparation of a medicament for delivering a gene product to a tissue of a subject.
10. The use of claim 9, wherein the tissue is selected from cardiac tissue.
11. Use of the recombinant adeno-associated virus virion according to any one of claims 6 to 8 in the preparation of a medicament for the prevention or treatment of a cardiac disorder.
12. The use of claim 11, wherein the heart disease is selected from the group consisting of myocardial infarction, myocardial ischemic injury, coronary heart disease, myocardial hypertrophy, and myocardial fibrosis.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111028956.9A CN113754727B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202011070091.8A CN112194706B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
| CN202111028956.9A CN113754727B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202011070091.8A Division CN112194706B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113754727A true CN113754727A (en) | 2021-12-07 |
| CN113754727B CN113754727B (en) | 2022-07-12 |
Family
ID=74013071
Family Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111028958.8A Active CN113754728B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
| CN202111028956.9A Active CN113754727B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
| CN202111029031.6A Active CN113717248B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
| CN202011070091.8A Active CN112194706B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
Family Applications Before (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111028958.8A Active CN113754728B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
Family Applications After (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111029031.6A Active CN113717248B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
| CN202011070091.8A Active CN112194706B (en) | 2020-09-30 | 2020-09-30 | Adeno-associated virus mutant and application thereof |
Country Status (2)
| Country | Link |
|---|---|
| CN (4) | CN113754728B (en) |
| WO (1) | WO2022067935A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN115925819A (en) * | 2022-12-30 | 2023-04-07 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and application thereof |
| WO2024077815A1 (en) * | 2022-10-09 | 2024-04-18 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and use thereof |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN114057840B (en) * | 2021-10-14 | 2022-09-20 | 和元生物技术（上海）股份有限公司 | Recombinant adeno-associated viral particles comprising variant AAV9 capsid proteins |
| WO2023215546A2 (en) * | 2022-05-06 | 2023-11-09 | Capsida, Inc. | Adeno-associated virus compositions having increased brain enrichment |
| CN115838399B (en) * | 2022-12-08 | 2023-08-11 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and application thereof |
| CN115838725B (en) * | 2022-12-30 | 2023-09-08 | 广州派真生物技术有限公司 | Promoter sequence of specific promoter gene in mammal heart and application thereof |
| CN116041443B (en) * | 2022-12-30 | 2023-09-22 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and application thereof |
| CN116693633B (en) * | 2023-02-21 | 2023-12-22 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and application thereof |
| CN117903261A (en) * | 2023-06-09 | 2024-04-19 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and application thereof |
| CN116836237B (en) * | 2023-06-16 | 2023-12-05 | 广州译码基因科技有限公司 | AAV capsid protein mutant for improving retina targeting and application thereof |
| CN117624311B (en) * | 2023-11-29 | 2024-05-28 | 广州译码基因科技有限公司 | Capsid protein mutant capable of improving nerve targeting of AAV virus and application thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107532177A (en) * | 2015-03-24 | 2018-01-02 | 加利福尼亚大学董事会 | Adeno-associated virus variant and its application method |
| CN108699565A (en) * | 2015-12-11 | 2018-10-23 | 加州理工学院 | Targeting peptides for orienting adeno-associated virus (AAV) |
| CN110709511A (en) * | 2017-08-28 | 2020-01-17 | 加利福尼亚大学董事会 | Adeno-associated virus capsid variants and methods of use thereof |
| CN111065742A (en) * | 2017-06-06 | 2020-04-24 | 马萨诸塞大学 | Self-regulating AAV vectors for safe expression of MECP2 in Rett syndrome |
Family Cites Families (16)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0777748A1 (en) * | 1994-08-18 | 1997-06-11 | Cytogen Corporation | Peptide librairies as a source of syngenes |
| JP2001527393A (en) * | 1997-04-01 | 2001-12-25 | メリウクス オラバクス | Identification of a polynucleotide encoding a novel Helicobacter polypeptide in the Helicobacter genome |
| US6156303A (en) * | 1997-06-11 | 2000-12-05 | University Of Washington | Adeno-associated virus (AAV) isolates and AAV vectors derived therefrom |
| ES2664505T3 (en) * | 2001-12-17 | 2018-04-19 | The Trustees Of The University Of Pennsylvania | Sequences of serotype 9 of adeno-associated virus (AAV), vectors containing them, and uses thereof |
| WO2012135137A2 (en) * | 2011-03-25 | 2012-10-04 | Proterro, Inc. | Regulated gene expression systems and constructs thereof |
| EP3693025B1 (en) * | 2011-04-22 | 2021-10-13 | The Regents of The University of California | Adeno-associated virus virions with variant capsid and methods of use thereof |
| US9938541B2 (en) * | 2012-12-25 | 2018-04-10 | Takara Bio Inc. | AAV variant |
| GB201403684D0 (en) * | 2014-03-03 | 2014-04-16 | King S College London | Vector |
| KR20230039779A (en) * | 2016-07-29 | 2023-03-21 | 더 리젠츠 오브 더 유니버시티 오브 캘리포니아 | Adeno-associated virus virions with variant capsid and methods of use thereof |
| PT3684423T (en) * | 2017-09-20 | 2023-06-09 | 4D Molecular Therapeutics Inc | Adeno-associated virus variant capsids and methods of use thereof |
| CA3097375A1 (en) * | 2018-04-27 | 2019-10-31 | Universitat Heidelberg | Modified aav capsid polypeptides for treatment of muscular diseases |
| US20210277066A1 (en) * | 2018-07-11 | 2021-09-09 | The Brigham And Women`S Hospital, Inc. | Methods and compositions for delivery of agents across the blood-brain barrier |
| CN110950934B (en) * | 2019-12-31 | 2022-11-04 | 复旦大学 | Adeno-associated virus capsid protein, vector, construction method and application thereof |
| CN111349148A (en) * | 2020-03-13 | 2020-06-30 | 辉大(上海)生物科技有限公司 | Adeno-associated virus vector and application thereof |
| CN115925817A (en) * | 2020-05-22 | 2023-04-07 | 中国医学科学院血液病医院(中国医学科学院血液学研究所) | Adeno-associated virus mutant and application thereof |
| CN111850045B (en) * | 2020-07-16 | 2022-03-08 | 四川大学 | Adeno-associated virus vector targeting to heart vascular endothelium and application thereof |
-
2020
- 2020-09-30 CN CN202111028958.8A patent/CN113754728B/en active Active
- 2020-09-30 CN CN202111028956.9A patent/CN113754727B/en active Active
- 2020-09-30 CN CN202111029031.6A patent/CN113717248B/en active Active
- 2020-09-30 CN CN202011070091.8A patent/CN112194706B/en active Active
- 2020-10-29 WO PCT/CN2020/124683 patent/WO2022067935A1/en active Application Filing
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN107532177A (en) * | 2015-03-24 | 2018-01-02 | 加利福尼亚大学董事会 | Adeno-associated virus variant and its application method |
| CN108699565A (en) * | 2015-12-11 | 2018-10-23 | 加州理工学院 | Targeting peptides for orienting adeno-associated virus (AAV) |
| CN111065742A (en) * | 2017-06-06 | 2020-04-24 | 马萨诸塞大学 | Self-regulating AAV vectors for safe expression of MECP2 in Rett syndrome |
| CN110709511A (en) * | 2017-08-28 | 2020-01-17 | 加利福尼亚大学董事会 | Adeno-associated virus capsid variants and methods of use thereof |
Non-Patent Citations (1)
| Title |
|---|
| HILDEGARD BÜNING ET AL: "Capsid Modifications for Targeting and Improving the Efficacy of AAV Vectors", 《MOLECULAR THERAPY: METHODS & CLINICAL DEVELOPMENT》 * |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2024077815A1 (en) * | 2022-10-09 | 2024-04-18 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and use thereof |
| CN115925819A (en) * | 2022-12-30 | 2023-04-07 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and application thereof |
| CN115925819B (en) * | 2022-12-30 | 2023-10-13 | 广州派真生物技术有限公司 | Adeno-associated virus mutant and application thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| WO2022067935A1 (en) | 2022-04-07 |
| CN112194706A (en) | 2021-01-08 |
| CN113754728B (en) | 2022-07-12 |
| CN113754728A (en) | 2021-12-07 |
| CN113754727B (en) | 2022-07-12 |
| CN113717248B (en) | 2022-07-08 |
| CN113717248A (en) | 2021-11-30 |
| CN112194706B (en) | 2022-03-08 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113754728B (en) | Adeno-associated virus mutant and application thereof | |
| EP2198016B1 (en) | Porcine adeno-associated viruses | |
| US7943379B2 (en) | Production of rAAV in vero cells using particular adenovirus helpers | |
| Muramatsu et al. | Nucleotide sequencing and generation of an infectious clone of adeno-associated virus 3 | |
| Mori et al. | Two novel adeno-associated viruses from cynomolgus monkey: pseudotyping characterization of capsid protein | |
| AU2008202032B2 (en) | A library of modified structural genes or capsid modified particles useful for the identification of viral clones with desired cell tropism | |
| JP2005512569A5 (en) | ||
| CN104520421A (en) | Cell line for production of adeno-associated virus | |
| WO2004020600A2 (en) | Modified aav | |
| JP2023171525A (en) | Aav chimeras | |
| CN108330147A (en) | A kind of foundation of recombined glandulae correlation viral vectors production technology | |
| JP2020533973A (en) | Adeno-associated virus (AAV) containing a modified phospholipase domain | |
| CN106701691B (en) | AAV capable of efficiently infecting immune cells, preparation method and application thereof | |
| CN113913464A (en) | Expression vector, recombinant adeno-associated virus and application of recombinant adeno-associated virus in preparation of 2019 novel coronavirus vaccine | |
| Qiu et al. | Processing of adeno-associated virus RNA | |
| CN115850392A (en) | Adeno-associated virus mutant of capsid protein fusion cell penetrating peptide and application thereof | |
| Qiu et al. | Molecular characterization of caprine adeno-associated virus (AAV-Go. 1) reveals striking similarity to human AAV5 | |
| JP2001502549A (en) | AAV DNA containing helper virus sequences | |
| JP2021505610A (en) | Formulation optimization for viral particles | |
| WO2024017387A1 (en) | Novel aav capsids for targeting nervous system and uses thereof | |
| WO2024119031A1 (en) | Adeno-associated virus production platform | |
| CN116419974A (en) | Method for producing recombinant AAV | |
| CN116789772A (en) | AAV5 capacity-expansion capsid mutant and capacity-expansion detection method thereof | |
| CN117802161A (en) | Accurate recombinant adeno-associated virus vector and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |