CN113736803B

CN113736803B - Recombinant bacillus subtilis for expressing acetaldehyde dehydrogenase and application thereof

Info

Publication number: CN113736803B
Application number: CN202111051308.5A
Authority: CN
Inventors: 张娟; 陈坚; 汪冉; 堵国成
Original assignee: Jiangnan University
Current assignee: Jiangnan University
Priority date: 2021-09-08
Filing date: 2021-09-08
Publication date: 2023-07-25
Anticipated expiration: 2041-09-08
Also published as: CN113736803A

Abstract

The invention discloses recombinant bacillus subtilis for expressing acetaldehyde dehydrogenase and application thereof, and belongs to the technical field of bioengineering. According to the invention, an expression system for expressing acetaldehyde dehydrogenase derived from candida tropicalis (Candida tropicalis) LBBE-W1 is constructed, pP43-NMK is used as an expression vector, and B.subtilis WB600 expression vector is used to obtain a recombinant strain with the enzyme activity as high as 110.55U/mL and the specific activity as high as 40.2U/mg; the enzyme activity data of the acetaldehyde dehydrogenase prepared by the method is 5.5 times that of the acetaldehyde dehydrogenase prepared by fermentation of candida tropicalis (Candida tropicalis) LBBE-W1 (20.06U/mL).

Description

Recombinant bacillus subtilis for expressing acetaldehyde dehydrogenase and application thereof

Technical Field

The invention relates to recombinant bacillus subtilis for expressing acetaldehyde dehydrogenase and application thereof, belonging to the technical field of bioengineering.

Background

Acetaldehyde dehydrogenase, abbreviated ALDH, one of the aldehyde dehydrogenases, is responsible for catalyzing the oxidation of acetaldehyde to acetic acid, alcohol dehydrogenase in the liver is responsible for oxidizing ethanol (a component of wine) to acetaldehyde, and the resulting acetaldehyde is further converted as a substrate to harmless acetic acid (i.e., a component of vinegar) under the catalysis of acetaldehyde dehydrogenase.

Many scholars currently attempt to express human acetaldehyde dehydrogenase ALDH2 in E.coli-based prokaryotic systems and Pichia-based eukaryotic systems, wherein the human ALDH2 gene was introduced into E.coli in Qiu Lizhen 2005Escherichia coliIn BL21, human ALDH2 was efficiently expressed. Specific enzyme activity of ALDH2 reaches 331.7U mg ^-1 .2010 Huang et al connected the humanized ALDH2 gene to pPIC9K plasmid, constructed recombinant plasmid pPIC9K-ALDH2, and electrically transformed into Pichia pastorisP.PastorisIn SMD1168, the enzyme activity of the purified ALDH reaches 0.115U mL ^-1 .2010 Zhao Jin et al were supraBased on the experiment, the signal peptide of pPIC9K-ALDH2 is removed, and the target gene ALDH2 is expressed in cells by methanol induction, so that the enzyme activity of the purified ALDH reaches 0.944U mL ^-1 。

ALDHs are also widely found in animals, plants and microorganisms, and researchers have begun to conduct related studies on ALDHs of different microbial origin and of the same origin but of different classifications. In 2009 Huang Rui et al, the ALDH gene of Saccharomyces cerevisiae was cloned and expressed, and the ALDH gene was linked with an expression vector pEtac to obtain a recombinant plasmid pEtac-ALDH, which was transformed into E.coli JM109 to efficiently express the ALDH. The specific enzyme activity of ALDH reaches 15U mg ^-1 . In 2011, yao Zhengying is obtained by screening a strain of Issatchenkia terrestris Issatchenkia terricola XJ-2 from Marin grape in Nanjing orchard, and researching the ALDH produced by the strain, the enzyme activity of the crude enzyme solution reaches 6.28U mL ^-1 . Then, the ALDH gene construction fusion expression vector in Liu Shengyi Saccharomycetes I. Terricola XJ-2 was subjected to heterologous expression in JM 109. The enzyme activity of the recombinant ALDH reaches 44.23U mL ^-1 The specific enzyme activity reaches 10.95U mg ^-1 (Issatchenkia terricola XJ-2 purification and nature of acetaldehyde dehydrogenase and cloning and expression of its gene); the enzyme activity of the ALDH crude enzyme solution extracted from the dry yeast with low sugar content in Xuefeng in 2011 Chen Gui is 3.56U mL ^-1 (extraction of acetaldehyde dehydrogenase in Xuefeng dry yeast and research on enzymatic properties thereof).

Yang Ya plain utilization in 2013S. CerevisiaeThe INVsl expression system expresses ADH2 gene and ALDH6 gene in beer yeast beer. Yeast respectively, and the obtained ADH2 specific enzyme activity is 0.49U mg ^-1 The method comprises the steps of carrying out a first treatment on the surface of the The specific enzyme activity of the ALDH6 of the recombinant bacterium is 0.11U mg ^-1 . And the ADH2 gene and the ALDH6 gene are connected to an expression vector pYES2 together, and the ADH2 and the ALDH6 are co-expressed in INVs1, so that experiments prove that the highest ADH enzyme activity of the recombinant bacterium I-ADH2-ALDH6 is 0.32U.mg ^-1 The maximum ALDH6 enzyme activity is 0.082U mg ^-1 。

The acetaldehyde dehydrogenase from different sources has the problem of low expression quantity and low enzyme activity, the escherichia coli is a pathogenic bacterium, and methanol is needed to be used for inducing when the pichia pastoris expresses ALDH2, so that the acetaldehyde dehydrogenase has a certain influence on the safety of a product, and cannot be really put into practical application. Bacillus subtilis is nonpathogenic (westerns et al 2004), has no significant codon bias (Shields and Sharp, 1987), high genetic engineering capacity and high density fermentation capacity (Harwood and Cranenburgh, 2008) compared to e.coli and other expression systems. Bacillus subtilis is used in traditional foods (natto in japan, kimchi in korea and 42-cured mangoes) and food supplements (lactpan Plus in italy, biosporin in uk, primal Defense TM in us) (Cutting, 2011; jeon et al, 2017; ragul et al, 2017) bacillus subtilis is also agreed to be "recognized as safe" (GRAS) (V avrov a et al, 2010).

Therefore, how to obtain a safe and efficient expression system with high acetaldehyde dehydrogenase activity becomes a hot spot and a difficult point of research.

Disclosure of Invention

In order to solve the problems of low enzyme activity and unsafe expression system of acetaldehyde dehydrogenase in the prior art, the invention constructs and expresses the strain derived from candida tropicalisCandida tropicalis) The expression system of the acetaldehyde dehydrogenase of LBBE-W1 obtains a recombinant strain with the enzyme activity as high as 110.55U/mL and the specific activity of 40.2U/mg.

The candida tropicalis is preparedCandida tropicalis) LBBE-W1 is described in the Chinese patent publication No. CN 113046252A. The candida tropicalis is preparedCandida tropicalis) LBBE-W1 was deposited under the accession number GDMCC NO 61401 in the Guangdong province microorganism strain collection on 31 th month of 2020.

The invention provides a gene for encoding acetaldehyde dehydrogenase, and the sequence of the gene is shown as SEQ ID NO. 1.

In one embodiment of the present invention, the amino acid sequence of the acetaldehyde dehydrogenase is shown as SEQ ID NO. 2.

The invention also provides a recombinant bacillus subtilis which contains the gene for encoding acetaldehyde dehydrogenase.

In one embodiment of the invention, the recombinant bacillus subtilis uses pP43-NMK as an expression vector.

In one embodiment of the present invention, the recombinant bacillus subtilis is used forB. subtilisWB600 is the expression host.

The invention also provides a method for constructing the recombinant bacillus subtilis, which comprises the steps of cloning genes encoding acetaldehyde dehydrogenase through PCR, and connecting the genes obtained by cloning with an expression vector to obtain a recombinant expression vector; and then the recombinant expression vector is transformed into a host cell to construct the recombinant bacillus subtilis.

The invention provides a method for degrading acetaldehyde, which comprises the step of adding acetaldehyde dehydrogenase prepared by fermenting recombinant bacillus subtilis into an environment containing acetaldehyde for degradation.

In one embodiment of the present invention, the acetaldehyde dehydrogenase is added to the reaction system in an amount of at least 10. Mu.L/300. Mu.L.

In one embodiment of the invention, the reaction conditions are: the reaction was carried out at 37℃for 5min.

The invention also provides a method for improving the candida tropicalisCandida tropicalis) A method for the enzymatic activity of an acetaldehyde dehydrogenase of LBBE-W1, comprisingB. subtilisWB600 is the expression host, and pP43-NMK is adopted as the expression vector; expresses the expression of candida tropicalisCandida tropicalis) An acetaldehyde dehydrogenase of LBBE-W1.

The invention also provides a recombinant vector or recombinant cell containing the gene.

The invention also provides application of the gene, the recombinant bacillus subtilis, the recombinant vector or the recombinant cell in preparing products for degrading acetaldehyde.

Advantageous effects

(1) The invention constructs and expresses candida tropicalisCandida tropicalis) The expression system of the acetaldehyde dehydrogenase of LBBE-W1 takes ALDH-P43 as an expression vector, andB. subtilisthe WB600 expression vector obtains an enzyme activity as high as 11055. 55U/mL, recombinant strain with specific activity of 40.2U/mg; the acetaldehyde dehydrogenase prepared by the method has the enzyme activity data of candida tropicalisCandida tropicalis) LBBE-W1 was fermented to give 5.5 times the enzyme activity of acetaldehyde dehydrogenase (20.06U/mL).

(2) The acetaldehyde dehydrogenase prepared by fermenting the recombinant bacillus subtilis prepared by the invention has the acetaldehyde degradation rate reaching 44.9% in 2h, realizes the technical effect of rapidly degrading acetaldehyde, and has wide application in industrial production.

Drawings

Fig. 1: extraction of total RNA of candida tropicalis.

Fig. 2: ALDH gene amplification electrophoresis pattern after double-stranded DNA synthesis.

Fig. 3: colony PCR electrophoretogram constructed by ALDH-P43 expression vector.

Fig. 4: ALDH-P43-WB600 SDS-PAGE electrophoresis.

Fig. 5: acetaldehyde standard curve.

Fig. 6: and detecting acetaldehyde results by headspace sample injection gas chromatography, wherein A is control group acetaldehyde, and B is experimental group acetaldehyde.

Fig. 7: SDS-PAGE electrophoresis of ALDH-P43-WB600 after purification.

Fig. 8: ALDH optimum reaction temperature.

Fig. 9: ALDH temperature stability.

Fig. 10: ALDH was optimal for reaction pH.

Fig. 11: ALDH pH stability.

Detailed Description

The following examples relate to the following media:

LB liquid medium (g/L): peptone 10, yeast powder 5, naCl 10.

Fermentation medium (g/L): sucrose 30, peptone 20, yeast powder 10, KH ₂ PO ₄ 3，MgSO ₄ 0.3，Na ₂ HPO ₄ 6

Carbon-free medium (g/L): (NH) ₄ ) ₂ SO ₄ 5 ，KH ₂ PO ₄ 1，NaCl 0.1，MgSO ₄ ·7H ₂ 0 0.5，CaCl ₂ 0.1, and yeast extract 0.1.

Disulfiram plate: on the basis of a carbon-free culture medium, agar 20 g/L, absolute ethyl alcohol 20 g/L and disulfiram with a certain concentration are added.

YPD liquid culture Medium (g/L): peptone 20, yeast powder 10 and glucose 20.

YPD solid culture Medium (g/L): 2% agar was added to YPD liquid medium.

The detection method involved in the following examples is as follows:

detection of enzyme activity of acetaldehyde dehydrogenase:

definition of enzyme activity: the change in the amount of 0.001 (1. Mu. Mol) per minute OD340 nm at 35℃was defined as 1 viability unit.

The enzyme activity determination method comprises the following steps: mixing all substances except enzyme solution according to the addition amount of the table, carrying out warm bath for 10 min at 35 ℃, then adding the enzyme solution for catalytic reaction, rapidly measuring the change of the absorbance value of the whole reaction system under 340 nm by using an enzyme labeling instrument, reading the absorbance value under 340 nm once every 1 min under the condition setting, carrying out the whole reaction process for 5min, and finally calculating the enzyme activity of ALDH according to the change of the absorbance value per minute.

The enzyme activity assay system is shown in Table 1.

Table 1: enzyme activity measuring system

The enzyme activity calculation formula of ALDH is:

enzyme activity (U m L) ^-1 ) = (Δa340 nm x dilution factor)/(enzyme solution addition x 10) ^-3 ）

Acetaldehyde standard curve preparation:

the standard solutions of acetaldehyde series are precisely prepared, and the concentrations are 5, 10, 15, 20 and 25 mg/L respectively. 3mL of acetaldehyde standard solution is respectively added into a headspace bottle of 20 mL, the mixture is placed in a water bath at 75 ℃ for heating for 30 min, the gas on the 1 mL liquid is sucked by a 2 mL injector, and the gas is rapidly injected into a gas chromatograph for detection. A linear regression equation was applied to the acetaldehyde concentration x with the peak area y, see FIG. 5.

Test conditions: chromatographic column: HP-INNOWax capillary column (30 m ×0.25 mm ×0.5 μm); column temperature: keeping the temperature at 40 ℃ for 5min, heating to 150 ℃ by a program of 5 ℃/min, and keeping the temperature at 250 ℃ for 2min at 20 ℃/min to finish analysis; a detector: 200 ℃; sample inlet: 200 ℃; carrier gas (high purity nitrogen) flow rate 1.2 mL/min; split ratio: 25:1, a step of; hydrogen 40 mL/min, air 400 mL/min, nitrogen 45 mL/min. The peak time of the acetaldehyde standard was 2.97 min.

Example 1: candida tropicalisCandida tropicalis) Production of acetaldehyde dehydrogenase by LBBE-W1 fermentation

The method comprises the following specific steps:

(1) Culturing strains:

candida tropicalis is selected from YPD slant culture mediumCandida tropicalis) LBBE-W1 single colonies were inoculated into 50 mL centrifuge tubes containing 5mL of YPD liquid medium, cultured overnight (12 h) at 30℃and 220 rpm, and inoculated into 250 mL shake flasks containing 50 mL of YPD liquid medium at an inoculum size of 2% (v/v); fermentation 36 h was performed at 30℃and 220 rpm to obtain a fermentation broth.

(2) Extracting crude enzyme liquid:

the fermentation broth obtained above was centrifuged at 12000 rpm for 2min, the supernatant was removed to collect cells, the cells were diluted with physiological saline, and then sonicated (on 4 s, off 5 s, working time 6 min), and the supernatant was centrifuged at 12000 rpm for 2min to obtain a crude enzyme solution, followed by measurement of enzyme activity.

The results show that the enzyme activity of the acetaldehyde dehydrogenase prepared by fermenting the original strain is 20.06U/mL.

Example 2: cloning of acetaldehyde dehydrogenase Gene

The method comprises the following specific steps:

1. extraction of Yeast Total RNA

Total RNA of wild type Candida tropicalis LBBE-W1 in the logarithmic growth phase was extracted (as shown in FIG. 1). Before extraction, 120 mg/mL snailase was added for 10 min, and then the subsequent procedure was performed according to the instructions of the cultured cell/bacterial total RNA extraction kit (DP 430) from Tiangen Biochemical technology Co., ltd. The total RNA extracted is subjected to ultraviolet absorption to detect the concentration and purity, the quality of the RNA is ensured to meet the requirements, and meanwhile, the extracted RNA is subjected to electrophoresis detection, so that at least two bands are ensured to be clearly visible.

2. Synthesis of double-stranded cDNA

Double-stranded cDNA was synthesized using the FastKing RT Kit (With gDNase) (KR 116) Kit from Tiangen Biochemical Co., ltd.

3. Full length cloning of acetaldehyde dehydrogenase ALDH gene

The primers F-ALDH and R-ALDH are designed by taking acetaldehyde dehydrogenase genes (XM_002546977, XM_002546984) of candida tropicalis (Candida tropicalis) provided by NCBI database as templates, then the acetaldehyde dehydrogenase genes ALDH in candida tropicalis are amplified by taking double-stranded cDNA as templates, and the double-stranded cDNA is sent to Shanghai industrial sequencing, so that the ALDH gene sequence with the total length of 1500bp is obtained (an ALDH gene amplification electrophoresis diagram after double-stranded DNA synthesis is shown in figure 2), and the sequence of the genes is shown in SEQ ID NO. 1.

F-ALDH: atgtttaacaaagcattaccattagttgca

R-ALDH:ttatggaagtgggttaagtttcattctgacag

Example 3: recombinant bacillus subtilisB. subtilisConstruction and culture of WB600/pP43NMK-ALDH

The method comprises the following specific steps:

1. construction of recombinant plasmids

The plasmid is adopted: pP43NMK, target gene: the acetaldehyde dehydrogenase ALDH (synthesized in example 2) was designed and ligated according to the one-step cloning ligation principle.

(1) Acetaldehyde dehydrogenase ALDH PCR amplification

PCR reaction System (50. Mu.L): 2X Taq DNA Polymerase. Mu.L; F-ALDH 1. Mu.L; R-ALDH 1. Mu.L; template 1. Mu.L; ddH ₂ O22 μl; reaction conditions: pre-denaturation at 94℃for 3 min; denaturation temperature 94℃for 30s; annealing temperature is 55 ℃,30 and s; the extension temperature is 72 ℃ for 1 min; after 34 cycles, the extension was carried out at 72℃for 10 min.

(2) pP43NMK PCR amplification

PCR reaction System (50. Mu.L): prime STARMax DNA Polymerase 25 μL; F-P43. Mu.L; R-P43. Mu.L; template 1. Mu.L; ddH ₂ O22 μl; reaction conditions: pre-denaturation at 98℃for 3 min; denaturation temperature 98 ℃,10 s; annealing temperature is 55 ℃,10 and s; the extension temperature is 72 ℃ for 1 min; after 34 cycles, the extension was carried out at 72℃for 10 min.

(3) Amplifying pP43NMK and ALDH gene fragments respectively, purifying, connecting according to a one-step cloning kit (Nuo Wei ZAN) instruction, transforming E.coli JM109 competent cells with a recombinant expression vector pP43NMK-ALDH to prepare transformants, performing colony PCR verification on the grown transformants (colony PCR electrophoresis diagram constructed by the ALDH-P43 expression vector is shown in figure 3), and if positive cloning is performed, carrying out sample feeding to a Shanghai worker for sequencing, and obtaining recombinant bacteria containing the recombinant expression vector pP43NMK-ALDH after correct sequencing.

2. Recombinant bacillus subtilisB. subtilisConstruction of WB600/pP43NMK-ALDH

Streaking recombinant strain with correct sequencing result, picking single colony in 50 mL centrifuge tube containing 5mL LB liquid medium, culturing overnight at 220 rpm and 37 deg.C, extracting plasmid, and transformingB. subtilisWB600 competent cells are prepared to obtain transformants, the grown transformants are subjected to colony PCR verification, and if positive clones are obtained, samples are sent to Shanghai worker for sequencing. Preserving the strain with correct sequencing result to obtain recombinant strainB. subtilisWB600/pP43NMK-ALDH。

According to the above method, the difference is that the blank plasmid pP43NMK is transferred into the host cellB. subtilisControl strains were prepared in WB 600:B. subtilisWB600/pP43NMK。

example 4: expression of acetaldehyde dehydrogenase

The method comprises the following specific steps:

(1) Picking single coloniesB. subtilisWB600/pP43NMK-ALDH was cultured in a 50 mL centrifuge tube containing 5mL LB liquid medium at 220 rpm and 37℃for 12 h to prepare seed liquid;

(2) Inoculating the prepared seed solution with an inoculum size of 2% (v/v) into a 250 mL shake flask containing 50 mL fermentation medium, and culturing at 220 rpm and 37 ℃ for 24 h to obtain a fermentation broth;

(3) Sucking up the 4 mL fermentation broth, at 12000×gCentrifuging for 1 min under the condition, collecting thalli, adding 4 mL of PBS buffer solution with pH of 7.4 into the thalli, suspending cells, performing ultrasonic disruption in ice water bath, performing operation for 4 s, stopping 5 s, performing total operation for 20min, centrifuging for 12000 Xg for 2min, collecting supernatant, namely crude enzyme solution, and determining the activity of acetaldehyde dehydrogenase.

According to the method, byB. subtilisThe WB600/pP43NMK strain was used as a control, and the supernatant of the WB600 disruption solution containing pP43NMK was prepared, and SDS-PAGE results (shown in FIG. 4) showed that the target band appeared at the position of the protein with the molecular weight of about 55kDa, which demonstrated that acetaldehyde dehydrogenase was expressed.

Example 5: determination of acetaldehyde dehydrogenase Activity

The method comprises the following specific steps:

mixing all substances except enzyme solution according to the addition amount of the table, carrying out warm bath for 10 min at 35 ℃, then adding the crude enzyme solution prepared in the example 4 for catalytic reaction, rapidly measuring the change of absorbance value of the whole reaction system under 340 nm by using an enzyme labeling instrument, reading the absorbance value under 340 nm once every 1 min by setting the conditions, carrying out the whole reaction process for 5min, and finally calculating the enzyme activity of ALDH according to the change of absorbance value per minute. The enzyme activity assay system is shown in Table 1.

The enzyme activity calculation formula of ALDH is:

Finally, the enzyme activity is 110.55U/mL and the specific activity is 40.2U/mg; the enzyme activity of the obtained acetaldehyde dehydrogenase is 5.5 times that of the acetaldehyde dehydrogenase prepared by fermenting the original strain.

Example 6: enzymatic Properties of acetaldehyde dehydrogenase

The optimal reaction temperature of the ALDH is detected, the enzyme activity system and the detection method are unchanged, and the enzyme activity of the recombinant ALDH reaction system after nickel column purification (SDS-PAGE electrophoresis diagram after ALDH-P43-WB600 purification is shown in figure 7) is detected at different temperatures (30, 40, 50, 60, 70, 80 and 90 ℃), and the optimal reaction temperature of the recombinant ALDH is shown in figure 8 to be 50-70 ℃.

When the temperature stability of ALDH is investigated, the enzyme solution is placed at different temperatures for different times (10 min, 15 min, 20min, 30 min, 40min, 50min, 60 min, 90min, 120 min), and as can be seen from FIG. 9, the recombinant ALDH is incubated at 30 ℃ and 40 ℃ for 2 hours, the enzyme activity is basically kept stable, the enzyme activity is slightly reduced after incubation at 50 ℃ for 2 hours, and the enzyme activity is reduced to less than 20% after incubation at 60 ℃ for 1 h, which indicates that the ALDH is more sensitive to high temperature.

The optimum pH of the ALDH was investigated, the recombinant ALDH was subjected to a wide range of buffers under different pH conditions (p H3.0.3.0, 4.0, 5.0, 6.0, 7.0, 8.0, 9.0, 10.0 and 11.0), and the enzyme activities at each pH were measured, and the optimum pH of the recombinant ALDH was 5.0 as shown in FIG. 10.

The recombinant ALDH was incubated at the above-mentioned different pH values for 2 hours, and then the enzyme activity was measured, and as shown in FIG. 11, the recombinant ALDH was stable at pH 5-6.

Example 7: use of acetaldehyde dehydrogenase

The crude enzyme solution of example 4 was used to react with the substrate acetaldehyde:

control reaction system (3 mL): 1 mol.L ^-1 Tris-HCl 300 μL , 20 mmol·L ^-1 β-NAD 300μL，100 mmol·L ^-1 200 mu L of acetaldehyde, 3 mol.L ^-1 KCl 100μL，1mmol·L ^-1 Mercaptoethanol 30. Mu.L, 100. Mu.L of the supernatant of WB600 disruption solution containing pP43NMK, and then ultrapure water was added to 3 mL;

experimental group reaction system (3 mL): 1 mol.L ^-1 Tris-HCl 300 μL， 20 mmol·L ^-1 β-NAD 300μL，100 mmol·L ^-1 200 mu L of acetaldehyde, 3 mol.L ^-1 KCl 100 μL，1mmol·L ^-1 Mercaptoethanol 30. Mu.L, ALDH crude enzyme solution 100. Mu.L, and ultrapure water was added to 3. 3 mL.

The reaction liquid of the control group and the experimental group is added into a headspace bottle of 20 mL, covered and sealed, and the mixture is taken out to detect the content of acetaldehyde by a gas chromatography after being placed in a water bath kettle at 37 ℃ for reaction of 2 h.

Qualitative in terms of retention time, as shown in fig. 6, the acetaldehyde peak (B) in the experimental group was significantly reduced compared to the control group (a); the ALDH crude enzyme solution is capable of catalyzing the degradation of acetaldehyde, and the acetaldehyde degradation rate is 44.9% after the acetaldehyde dehydrogenase acts on 2h by combining an acetaldehyde standard curve (figure 5).

While the invention has been described with reference to the preferred embodiments, it is not limited thereto, and various changes and modifications can be made therein by those skilled in the art without departing from the spirit and scope of the invention as defined in the appended claims.

SEQUENCE LISTING

<110> university of Jiangnan

<120> recombinant Bacillus subtilis expressing acetaldehyde dehydrogenase and application thereof

<130> BAA210244A

<160> 2

<170> PatentIn version 3.3

<210> 1

<211> 1500

<212> DNA

<213> artificial sequence

<400> 1

atgtttaaga aagctttgcc attagttact caacttacta ccccaagagg tatcacttac 60

aaccaaccat tgggtttgtt catcaataac gaatacgttc ttccacaagc caacaaaacc 120

tttgaagtta tttctccatc tactgaagaa aaaatcactg atgtttatga aggtttagct 180

gaagatgtta ataccgcagt tgacgctgcc aaagcagctt atgacaatgg atgggctctt 240

ggtccaccag aagaaagagc aagagttttg ttcaacttgg ctgatttagt cgaagagaat 300

gcagaaactt tagctcaaat tgaaacttgg gacaatggta aatcattgca aaatgctaga 360

ggcgatatcg ccttaactgc tgcttacttt agatcatgtg gtggttgggc tgataaaatc 420

actggaagcc aaatcaacac cggaagttct catttcaatt acactcaaag agtcccaatg 480

gtctgtggtc aaatcatacc ttggaatttt ccaatgttaa tggcctcttg gaagcttgga 540

ccagttcttg ctactggttg tactactgtc ttgaaacctg ctgaatctac tccattgtct 600

gccttgtacc tttcccaatt gttggttgaa gccggtatgc caaagggtgt tgtcaacatt 660

gttccaggtt ttggtgccac tactggtgct gctattgcca gccacccaaa gattgacaag 720

gttgctttca ctggttctac tgctactggt aaggttatta tgaaattggc tgctgaatcc 780

aacttgaaga aggttacttt ggaattgggt ggtaaatccc caaacattgt tttcaacgat 840

gccgacttgg ataagactat tgataacttg gttgtttcta tcttctacaa ctctggtgaa 900

gtctgttgtg ctggttcccg tctcttggtt caatctggtg tttacgacga agttgttgct 960

agattcaaga aggctgccga atcccttaaa gttggtgatc catttgaaga agacactttc 1020

atgggttccc aagctaacgc taaccaattg gataagatct tgaaatacat tgaagttggt 1080

aaggaacaag gtgccactgt tgttactggt ggtgctaagg ctagtgacaa gggttacttt 1140

atcaaaccaa ccatttttgc tgatgttaac aaggatatga gtattgtcaa ggaagaaatc 1200

tttggtcctg ttgtcacctt gatcaagttc gacactgttg aagaagctat tgctttggct 1260

aacgactctg attacggttt ggctgctggt attcactcca ctgacgtcaa caagtgtatt 1320

gatgtttcta acagactcaa ggctggtact gtttgggtca acacttacaa cgacttccat 1380

ccaatggttc cattcggtgg tttcagtgct tccggtattg gtagagaaat gggtgaagaa 1440

gtcttgaagg aatacaccca agtcagagct gtcagaatga aacttaaccc acttccataa 1500

<210> 2

<211> 499

<212> PRT

<213> artificial sequence

<400> 2

Met Phe Lys Lys Ala Leu Pro Leu Val Thr Gln Leu Thr Thr Pro Arg

1 5 10 15

Gly Ile Thr Tyr Asn Gln Pro Leu Gly Leu Phe Ile Asn Asn Glu Tyr

20 25 30

Val Leu Pro Gln Ala Asn Lys Thr Phe Glu Val Ile Ser Pro Ser Thr

35 40 45

Glu Glu Lys Ile Thr Asp Val Tyr Glu Gly Leu Ala Glu Asp Val Asn

50 55 60

Thr Ala Val Asp Ala Ala Lys Ala Ala Tyr Asp Asn Gly Trp Ala Leu

65 70 75 80

Gly Pro Pro Glu Glu Arg Ala Arg Val Leu Phe Asn Leu Ala Asp Leu

85 90 95

Val Glu Glu Asn Ala Glu Thr Leu Ala Gln Ile Glu Thr Trp Asp Asn

100 105 110

Gly Lys Ser Leu Gln Asn Ala Arg Gly Asp Ile Ala Leu Thr Ala Ala

115 120 125

Tyr Phe Arg Ser Cys Gly Gly Trp Ala Asp Lys Ile Thr Gly Ser Gln

130 135 140

Ile Asn Thr Gly Ser Ser His Phe Asn Tyr Thr Gln Arg Val Pro Met

145 150 155 160

Val Cys Gly Gln Ile Ile Pro Trp Asn Phe Pro Met Leu Met Ala Ser

165 170 175

Trp Lys Leu Gly Pro Val Leu Ala Thr Gly Cys Thr Thr Val Leu Lys

180 185 190

Pro Ala Glu Ser Thr Pro Leu Ser Ala Leu Tyr Leu Ser Gln Leu Leu

195 200 205

Val Glu Ala Gly Met Pro Lys Gly Val Val Asn Ile Val Pro Gly Phe

210 215 220

Gly Ala Thr Thr Gly Ala Ala Ile Ala Ser His Pro Lys Ile Asp Lys

225 230 235 240

Val Ala Phe Thr Gly Ser Thr Ala Thr Gly Lys Val Ile Met Lys Leu

245 250 255

Ala Ala Glu Ser Asn Leu Lys Lys Val Thr Leu Glu Leu Gly Gly Lys

260 265 270

Ser Pro Asn Ile Val Phe Asn Asp Ala Asp Leu Asp Lys Thr Ile Asp

275 280 285

Asn Leu Val Val Ser Ile Phe Tyr Asn Ser Gly Glu Val Cys Cys Ala

290 295 300

Gly Ser Arg Leu Leu Val Gln Ser Gly Val Tyr Asp Glu Val Val Ala

305 310 315 320

Arg Phe Lys Lys Ala Ala Glu Ser Leu Lys Val Gly Asp Pro Phe Glu

325 330 335

Glu Asp Thr Phe Met Gly Ser Gln Ala Asn Ala Asn Gln Leu Asp Lys

340 345 350

Ile Leu Lys Tyr Ile Glu Val Gly Lys Glu Gln Gly Ala Thr Val Val

355 360 365

Thr Gly Gly Ala Lys Ala Ser Asp Lys Gly Tyr Phe Ile Lys Pro Thr

370 375 380

Ile Phe Ala Asp Val Asn Lys Asp Met Ser Ile Val Lys Glu Glu Ile

385 390 395 400

Phe Gly Pro Val Val Thr Leu Ile Lys Phe Asp Thr Val Glu Glu Ala

405 410 415

Ile Ala Leu Ala Asn Asp Ser Asp Tyr Gly Leu Ala Ala Gly Ile His

420 425 430

Ser Thr Asp Val Asn Lys Cys Ile Asp Val Ser Asn Arg Leu Lys Ala

435 440 445

Gly Thr Val Trp Val Asn Thr Tyr Asn Asp Phe His Pro Met Val Pro

450 455 460

Phe Gly Gly Phe Ser Ala Ser Gly Ile Gly Arg Glu Met Gly Glu Glu

465 470 475 480

Val Leu Lys Glu Tyr Thr Gln Val Arg Ala Val Arg Met Lys Leu Asn

485 490 495

Pro Leu Pro

Claims

1. The recombinant bacillus subtilis is characterized by comprising an acetaldehyde dehydrogenase encoding gene, wherein the sequence of the gene is shown as SEQ ID NO. 1; the recombinant bacillus subtilis is prepared from bacillus subtilisB. subtilis) WB600 is the expression host.

2. The recombinant bacillus subtilis according to claim 1, wherein the recombinant bacillus subtilis uses pP43-NMK as an expression vector.

3. A method for constructing the recombinant bacillus subtilis according to claim 1 or 2The method is characterized in that the gene encoding acetaldehyde dehydrogenase is cloned by PCR, and the gene obtained by cloning is connected with an expression vector to obtain a recombinant expression vector; then the recombinant expression vector is transformed into bacillus subtilisB. subtilis) And (3) constructing recombinant bacillus subtilis in WB600 cells.

4. A method for degrading acetaldehyde, which is characterized in that acetaldehyde dehydrogenase prepared by fermenting recombinant bacillus subtilis according to claim 1 or 2 is added into an environment containing acetaldehyde for degradation.

5. The method of claim 4, wherein the reaction conditions are: and reacting for 3-10 min at the temperature of 35-39 ℃.

6. A method for improving the enzyme activity of acetaldehyde dehydrogenase is characterized by adopting bacillus subtilisB. subtilis) WB600 is the expression host, and pP43-NMK is adopted as the expression vector; the acetaldehyde dehydrogenase derived from candida tropicalis LBBE-W1 is expressed, and the sequence of the coding gene of the acetaldehyde dehydrogenase is shown as SEQ ID NO. 1.

7. Use of the recombinant bacillus subtilis according to claim 1 or 2 for the preparation of an acetaldehyde degrading product.