CN108118038A

CN108118038A - A kind of glucose oxidase mutant

Info

Publication number: CN108118038A
Application number: CN201611064900.8A
Authority: CN
Inventors: 吴秀秀; 邵弨
Original assignee: Qingdao Vland Biotech Group Co Ltd
Current assignee: Qingdao Vland Biotech Group Co Ltd
Priority date: 2016-11-28
Filing date: 2016-11-28
Publication date: 2018-06-05
Anticipated expiration: 2036-11-28
Also published as: CN108118038B

Abstract

The present invention relates to genetic modification technical fields, specifically provide a kind of glucose oxidase mutant.The heat resistance of the glucose oxidase single-point mutants is generally higher than wild type, and remnant enzyme activity improves 19.1 63.8% after 60 DEG C of 10 min of processing, and remnant enzyme activity improves 27.1 82.6% after 65 DEG C of 5 min of processing.So as to illustrate that above-mentioned simple point mutation causes the heat resistance of glucose oxidase to be increased dramatically, feed addictive is more suitable as than wild type, is conducive to extensive use of the glucose oxidase in feed, thus wide market.

Description

A kind of glucose oxidase mutant

Technical field

The invention belongs to genetic modification technical fields, and in particular to a kind of glucose oxidase mutant.

Background technology

Glucose oxidase is a kind of aerobic dehydrogenase, exclusively can generate gluconic acid and peroxide by oxidation of beta-D-Glucose Change hydrogen.Glucose oxidase usually forms an oxidation-reduction system, the oxidation of beta-D- in the presence of molecular oxygen with catalase Glucose generates D-Glucose acid lactone, while consumes oxygen generation hydrogen peroxide.Hydrogen peroxide is decomposed and generated by catalase Water and 1/2 oxygen, then water is combined again with glucolactone generates gluconic acid.Glucose oxidase is to β-D- glucopyranoses Showing strong specificity, the hydroxyl on glucose molecule C1 is most important to the catalytic activity of enzyme, and when hydroxyl is in β It is 160 times higher than at α.Glucose oxidase is to L- glucose and 2-O- methyl-D-glucoses completely without activity.

Deoxygenation and antioxidation due to glucose oxidase make it in food, medicine, feed etc. using very Extensively.In the food industry, glucose oxidase is preventing beer aging, is keeping product original as a kind of food preservative Flavor, the aspect that extends the shelf life have remarkable result, are alternatively arranged as flour improver and Bread improver improves food quality. In field of medicaments, hospital of China is generally using glucose oxidase electrode method, glucose oxidase-peroxidase coupling method etc. Detect blood, glucose in serum content.As a kind of new feed addictive, glucose oxidase can improve animal intestine Road environment adjusts diet digestion, promotes growth of animal.

Glucose oxidase is distributed widely in animal, plant and microbial body, it is industrial mainly using black-koji mould or Penicillium notatum is produced, but often occurs that enzyme activity is not high, stability is poor, foreign protein pollution and isolates and purifies cumbersome etc. ask Topic.Because there are one 80~90 DEG C of short duration of hot stages during particle manufacture at present.And the grape of Aspergillus niger origin Carbohydrate oxidase thermal stability is poor, and aqueous solution keeps the temperature 5 minutes remaining enzymatic activitys less than 40% at 65 DEG C, makes the enzyme in particle The application of feed is restricted.At present using after feed granulating by the method in glucose oxidase liquid spray to feed not only Increase equipment investment, and can not ensure the distribution uniformity of the stability and enzyme preparation of enzyme preparation in feed.Therefore, carry High glucose oxidation enzyme heat stability has important practical significance to current feed with glucose oxidase.

The content of the invention

The object of the present invention is to provide a kind of glucose oxidase mutant, heat resistance is significantly improved, is conducive to It is in the extensive use of field of fodder.

In order to realize foregoing invention purpose, the present invention provides following technical scheme：

The present invention provides a kind of glucose oxidase mutant, have (I), (II) or（Ⅲ）In shown amino acid sequence Any one：

(I) with the amino acid sequence SEQ ID NO of glucose oxidase:1 has the sequence of at least 95% homology；

(II) there is at least one immune epitope of the glucose oxidase described in (I), and the glucose oxidase The amino acid sequence that is obtained through modifying, substituting, lacking or adding one or several amino acid of amino acid sequence；

（Ⅲ）By such as SEQ ID NO:When nucleotide sequence or its complementary series shown in 2 or the degeneracy because genetic code with such as SEQ ID NO:The amino acid sequence of the different sequential coding of the nucleotide sequence of nucleotide sequence or its complementary series shown in 2 Row；

In some embodiments of the invention, it is described to be substituted by 1 amino acid of substitution.

In other embodiments of the present invention, the substitution includes amino acid sequence for SEQ ID NO:1 glucose The 386th of oxidizing ferment, 387,401,406,408,418,455,466,470,476,478,479,492,493,501,531, Any one in 532,546,578 amino acids is substituted.

The present invention other embodiments in, it is described substitution include the 386th amino acids from T become A or E or F or P。

In other embodiments of the present invention, the substitution includes the 387th amino acids and becomes E or P from T.

In other embodiments of the present invention, the substitution includes the 401st amino acids and becomes F from V.

In other embodiments of the present invention, the substitution includes the 406th amino acids and becomes P from A.

In other embodiments of the present invention, the substitution includes the 408th amino acids and becomes A from S.

In other embodiments of the present invention, the substitution includes the 418th amino acids and becomes L from A.

In other embodiments of the present invention, the substitution includes the 455th amino acids and becomes D from E.

In other embodiments of the present invention, the substitution includes the 466th amino acids and becomes K from Q.

In other embodiments of the present invention, the substitution includes the 470th amino acids and becomes E or F or K from N.

In other embodiments of the present invention, the substitution includes the 476th amino acids and becomes P from A.

In other embodiments of the present invention, the substitution includes the 478th amino acids and becomes K from Q.

In other embodiments of the present invention, the substitution includes the 479th amino acids and becomes D from T.

In other embodiments of the present invention, the substitution includes the 492nd amino acids and becomes P from A.

In other embodiments of the present invention, the substitution includes the 493rd amino acids and becomes P from Y.

The present invention other embodiments in, it is described substitution include the 501st amino acids from T become E or K or L or R, or Y.

In other embodiments of the present invention, the substitution includes the 531st amino acids and becomes F or P from N.

In other embodiments of the present invention, the substitution includes the 532nd amino acids and becomes R from A.

In other embodiments of the present invention, the substitution includes the 546th amino acids and becomes A from G.

The present invention other embodiments in, it is described substitution include the 578th amino acids from S become F or K or R or Y。

In some embodiments of the invention, the missing is missing 1 or 2 amino acid.

In other embodiments of the present invention, the missing includes the 580th amino acids missing.

In other embodiments of the present invention, the missing includes the 579th and the 580th amino acids lack simultaneously.

The present invention also provides application of the above-mentioned glucose oxidase mutant in feed.

The present invention also provides the recombinant expression carriers with above-mentioned DNA molecular.

The present invention also provides a kind of host cells, include above-mentioned recombinant expression carrier.

In some embodiments of the invention, host cell is Pichia pastoris.

The heat resistance of glucose oxidase mutant provided by the invention is generally higher than wild type, after 60 DEG C handle 10 min Remnant enzyme activity improves 19.1-63.8%, and remnant enzyme activity improves 27.1-82.6% after 65 DEG C of 5 min of processing.It is above-mentioned so as to illustrate Mutation causes the heat resistance of glucose oxidase to be increased dramatically, and is more suitable as feed addictive than wild type, is conducive to Extensive use of the glucose oxidase in feed, thus wide market.

Specific embodiment：

The routine techniques and method that the present invention has used genetic engineering and biology field uses, such as MOLECULAR CLONING:A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT PROTOCOLS IN Recorded method in MOLECULAR BIOLOGY (Ausubel, 2003).These general bibliography provide ability The known definition of field technique personnel and method.But those skilled in the art can be in the technical solution recorded in the present invention On the basis of, using the other conventional methods in this field, experimental program and reagent, and it is not limited to the limit of the specific embodiment of the invention It is fixed.

A in the present invention, R, D, C, Q, E, H, I, G, N, L, K, M, F, P, S, T, W, Y, V are alanine Ala respectively, arginine Arg, aspartic acid Asp, cysteine Cys, glutamine Gln, glutamic acid Glu, histidine, isoleucine Ile, sweet ammonia Sour Gly, asparagine Asn, leucine Leu, lysine Lys, methionine Met, phenylalanine Phe, proline Pro, silk ammonia Sour Ser, threonine Thr, tryptophan Trp, tyrosine Tyr, the abbreviation of valine Val.

Experiment material used in the specific embodiment of the invention and reagent are as follows：

Bacterial strain and carrier：Bacillus coli DH 5 alpha, Pichia pastoris GS115, carrier pPIC9K, Amp, G418 are public purchased from Invitrogen Department.

Enzyme and kit：PCR enzymes and ligase purchase are from Takara companies, and restriction enzyme is purchased from Fermentas public affairs Department, plasmid extraction kit and glue purification QIAquick Gel Extraction Kit are purchased from Omega companies, the purchase of GeneMorph II Random Mutagenesis Kits From Beijing Bo Maisi bio tech ltd.

Culture medium prescription：

Escherichia coli culture medium（LB culture mediums）：0.5% yeast extract, 1% peptone, 1% NaCl, pH7.0)；

LB-AMP culture mediums：LB culture mediums add 100 μ g/mL ampicillins；

Yeast culture medium（YPD culture mediums）：1% yeast extract, 2% peptone, 2% glucose；

Yeast screening assay culture medium（MD culture mediums）：2% glucose, 2% agarose, 1.34% YNB, 4 × 10^-5Biotin；

BMGY culture mediums：2% peptone, 1% yeast extract, 100 mM kaliumphosphate buffers (pH6.0), 1.34% YNB, 4 × 10^-5Biotin, 1% glycerine；

BMMY culture mediums：2% peptone, 1% yeast extract, 100 mM kaliumphosphate buffers (pH6.0), 1.34% YNB, 4 × 10^-5Biotin, 0.5% methanol.

The present invention is described in detail with reference to embodiment.

The acquisition of the heat-resisting mutant of 1 glucose oxidase of embodiment

The amplification of 1.1 glucose oxidase genes

With aspergillus niger（Aspergillus niger）Genome carries out PCR amplification for template, and PCR primer GOD-F1, GOD-R1 is such as Under：

GOD-F1：GGTATTGAGGCATCTTTGTTGAC

GOD-R1：TTATTGCATAGAAGCGTAATC

Glue recycles PCR product, connects pEASY-T carriers, converts into bacillus coli DH 5 alpha, the correct transformant of picking is surveyed Sequence.Sequencing result shows that the nucleotides sequence of the genetic fragment expanded is classified as SEQ ID NO：2, the amino acid sequence of coding It is classified as SEQ ID NO：1.It is compared and found by NCBI BLAST, SEQ ID NO：1 is glycoxidative with the grape from aspergillus niger Enzyme sequence similitude is up to 100%, so that it is determined that being glucose oxidase gene by the gene that PCR is obtained, is named as GOD.

The amplification and synthesis of glucose oxidase mutant gene

In order to improve the heat resistance of above-mentioned glucose oxidase GOD, applicant has carried out greatly the enzyme by directed evolution technologies The screening of mutation is measured, design PCR primer GOD-F2, GOD-R2 is as follows：

GOD-F2：GGCGAATTCGGTATTGAGGCATCTTTGTTGAC（Underscore is restriction enzyme EcoRI recognition sites）

GOD-R2：ATAGCGGCCGCTTATTGCATAGAAGCGTAATC（Underscore is restriction enzyme Not I recognition sites）

Using GOD genes as template, with above-mentioned primer GeneMorph II random mutation PCR kits（Stratagene）It carries out PCR amplification, glue recycling PCR product, EcoRI, Not I connect after carrying out digestion processing with the pET21a carriers after similary digestion It connects, converts into e. coli bl21 (DE3), be coated on LB+Amp tablets, 37 DEG C are inverted culture, after sub- appearance to be transformed, are used Toothpick is chosen one by one to 96 orifice plates, adds in the LB+Amp culture mediums that 150 ul contain 0.1mM IPTG in each hole, 37 DEG C 220 Rpm cultivates 6 h or so, and supernatant is abandoned in centrifugation, and thalline is resuspended with buffer solution, multigelation broken wall, and acquisition contains glucose oxidase Bacillus coli cells lysate.

10 μ L lysates are taken out respectively to two pieces of 96 new orifice plates, one of after 70 DEG C handle 5min, two piece of 96 hole Plate all adds in 40 μ L substrates, and after 30 DEG C are reacted 30 min, DNS methods measure the reduced sugar of generation, calculate the enzyme solution of high-temperature process Compared to the opposite enzyme activity of untreated enzyme solution.The experimental results showed that some mutation do not have the heat resistance of glucose oxidase GOD It influences, some mutation even make its heat resistance or enzyme activity become worse；In addition also some mutation, although grape glycosyloxy can be improved Change tolerance of the enzyme to temperature, but significant change has occurred in its zymologic property after mutation, and these are undesirable.Finally, Applicant screens the heat resistance that can significantly improve glucose oxidase GOD and its enzyme activity and original zymology The mutational site of matter：T386A/E/F/P, T387E/P, V401F, A406P, S408A, A418L, E455D, Q466K, N470E/F/ K, A476P, Q478K, T479D, A492P, Y493P, T501E/K/L/R/Y, N531F/P, A532R, G546A, S578F/K/R/ Y and Q580 missings, M579 and Q580 are lacked simultaneously.

PCR amplification is carried out respectively to above-mentioned mutant with primer GOD-F2, GOD-R2, and primer both ends introduce EcoRI, Not I site.PCR reaction conditions are：94 DEG C of denaturation 5min；Then 94 DEG C of denaturation 30s, 56 DEG C of renaturation 30s, 72 DEG C of extension 1min, 30 After a cycling, 72 DEG C of heat preservation 10min.Agarose gel electrophoresis is the results show that the mutant gene that amplification obtains is size The segment of 1800bp or so.

It expands to obtain the genetic fragment of wild type glucose oxidase GOD by above-mentioned same PCR method.

The structure of pichia pastoris engineered strain

The glucose oxidase mutant gene that above-mentioned clone is obtained passes through EcoRI and NotI sites and Expression vector pPIC9K It is connected, construction of expression vector.

Expression vector is linearized with Sal I, expression vector linearized fragment is converted by electroporation finishes red ferment Female GS115, screening obtains Pichia pastoris recombinant bacterial strain respectively on MD tablets, then respectively in the Geneticin containing various concentration The transformant of multicopy is screened on YPD tablets.

The obtained switching of the transformant containing above-mentioned mutant will be screened in BMGY culture mediums, 30 DEG C, 250 rpm vibration trainings Support 1 d；It is transferred to again in BMMY culture mediums, 30 DEG C, 250 rpm shaken cultivations；The methanol of addition 0.5% daily, 4 d of induced expression； Centrifugation removal thalline, obtains the fermented supernatant fluid of the mutant containing glucose oxidase；Carried out SDS-PAGE electrophoresis detections point Analysis.The results show that the molecular size range of glucose oxidase mutant is about 64 kDa in fermented supernatant fluid, with theoretical molecular weight Size is identical.

It builds to obtain the Pichia yeast engineering of recombination expression wild type glucose oxidase by above-mentioned same method. The horizontal fermentation of shaking flask, 30 DEG C, 250 rpm shaken cultivations；The methanol of addition 0.5% daily, 4 d of induced expression；Degerming is gone in centrifugation Body obtains the fermented supernatant fluid of the GOD of glucose oxidase containing wild type.

（1）The definition of glucose oxidase enzyme-activity unit

It is per minute β-D-Glucose of 1 μm of ol to be oxidized to maltonic acid and hydrogen peroxide under the conditions of pH6.0,30 DEG C Required enzyme amount is defined as 1 enzyme activity unit（IU）.

（2）Enzyme activity determination method

Crude enzyme liquid is directly diluted to about 10U/mL with buffer solution.The test tube of 4 150*15 is taken, adds in 2ml buffer solutions, 0.3ml Glucose, 0.4ml phenol, 0.1ml 4- amino antipyrine, 0.1ml horseradish peroxidases, 30 DEG C of preheating 5min.Xiang Qi In a pipe add in 0.1ml distilled water, as blank return to zero.Water-bath is placed on to be conveniently operated by spectrophotometer, to sample cell Middle addition 0.1ml sample solutions, start timing, after vortex mixing immediately at 500nm wavelength with 1cm cuvette colorimetrics at this time. Absorbance is A0 when reading 0.5 min, then after reacting 1min, reads absorbance A1, draw Δ A500=A1-A0.

Enzyme activity calculation formula：

Enzyme activity X1 in sample（U/mL or U/g）It is calculated according to equation below：

X1=ΔA500×f×B ×1000/（887×t×A×d）=33.82×ΔA500×f

In formula：

F--------------------- enzyme solution extension rates

B-------------------- reaction solution volumes（3 ml）

1000---------------- extinction coefficient unit conversion factors

887----------------- extinction coefficients (Lmol-1cm-1）

The t--------------------- reaction time（min）, i.e., the time difference 1min between reading A1 and A0.

A-------------------- adds in sample volume（0.1 ml）

The thickness of d-------------------- cuvettes（cm）

（3）Enzyme activity determination result

The enzyme activity determination of fermented supernatant fluid, the results show are carried out according to the method described above：Recombinantly express wild type glucose oxidase Pichia pastoris fermented supernatant fluid enzyme activity for 105 U/ml, and recombinantly express the Pichia pastoris hair of glucose oxidase mutant The enzyme activity of ferment supernatant is about 111-165U/mL.

Fermentation verification

Carry out the fermentation for the Pichia yeast engineering that above-mentioned structure obtains respectively on 10 liters of fermentation tanks, ferment the culture medium used It is formulated and is：1.1 g/L of calcium sulfate, 5.5 g/L of potassium dihydrogen phosphate, 55 g/L of ammonium dihydrogen phosphate, 20.3 g/L of potassium sulfate, magnesium sulfate 16.4 g/L, 1.65 g/L of potassium hydroxide, antifoaming agent 0.05%.

Zymotechnique：PH value 5.0,30 DEG C of temperature, 300 rpm of stir speed (S.S.), ventilation quantity 1.0-1.5（v/v）, dissolved oxygen control More than 20%.

Entire fermentation process is divided into three phases：First stage be thalline cultivation stage, in 7% ratio access seed, 30 DEG C 24-26 h are cultivated, to have mended glucose as mark；Second stage is the hungry stage, after glucose has been mended, is not flowed plus any Carbon source terminates, by a definite date about 30-60 min when dissolved oxygen rose to for 80% stage indicated above；Phase III is induced expression rank Section, stream plus methanol induction, and dissolved oxygen is kept more than 20%, incubation time is between 150-180 h.After fermentation, ferment Liquid obtains crude enzyme liquid after being handled by flame filter press.

Enzyme activity assay is carried out to crude enzyme liquid using in the embodiment 1 1.3 glucose oxidase enzyme activity determination methods, as a result It has been shown that, the fermentation enzyme activity that the Pichia pastoris of recombination expression wild type glucose oxidase is final is 3050 U/ml, and is recombinantly expressed The fermentation enzyme activity that the Pichia pastoris of glucose oxidase mutant is final reaches 3155-3561 U/ml.

Glucose oxidase zymologic property measures

1st, most suitable action pH

It is respectively 2.0,2.5,3.0,3.5,4.0,4.5,5.0,5.5,6.0,6.5,7.0,7.5,8.0 phosphoric acid hydrogen using pH value Disodium-citrate buffer solution, fermentation crude enzyme liquid described in embodiment 1 1.4 carries out glucose oxidase work under the conditions of 30 DEG C Power measures, and using highest enzyme activity as 100%, calculates with respect to enzyme activity, the results show wild type glucose oxidase GOD and mutant Optimun pH is all 6.0, and the horizontal difference of opposite enzyme activity under condition of different pH is little.

2nd, thermal stability analysis

By above-mentioned crude enzyme liquid with after the acetic acid-sodium acetate buffer solution dilution of pH 6.0,10min, 65 DEG C of processing are handled at 60 DEG C After 5min, enzyme activity is measured respectively, using the enzyme activity of untreated samples as 100%, calculates remnant enzyme activity.The results are shown in table below.

It can be seen that from the data in table compared with wild type, the heat resistance of 35 mutant provided by the invention has It significantly improves, remnant enzyme activity improves 19.1-63.8% after 60 DEG C of 10 min of processing, and remnant enzyme activity improves after 65 DEG C of 5 min of processing 27.1-82.6%.So as to illustrate that above-mentioned mutation causes the heat resistance of glucose oxidase to be increased dramatically, than wild type more Feed addictive is suitable as, is conducive to extensive use of the glucose oxidase in feed, wide market.

The above is only the preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications also should It is considered as protection scope of the present invention.

SEQUENCE LISTING

<110>Qingdao Weilan Biology Group Co., Ltd.

<120>A kind of glucose oxidase mutant

<130>

<160> 2

<170> PatentIn version 3.5

<210> 1

<211> 581

<212> PRT

<213> 1

<400> 1

Gly Ile Glu Ala Ser Leu Leu Thr Asp Pro Lys Asp Val Ser Gly Arg

1 5 10 15

Thr Val Asp Tyr Ile Ile Ala Gly Gly Gly Leu Thr Gly Leu Thr Thr

20 25 30

Ala Ala Arg Leu Thr Glu Asn Pro Asn Ile Ser Val Leu Val Ile Glu

35 40 45

Ser Gly Ser Tyr Glu Ser Asp Arg Gly Pro Ile Ile Glu Asp Leu Asn

50 55 60

Ala Tyr Gly Asp Ile Phe Gly Ser Ser Val Asp His Ala Tyr Glu Thr

65 70 75 80

Val Glu Leu Ala Thr Asn Asn Gln Thr Ala Leu Ile Arg Ser Gly Asn

85 90 95

Gly Leu Gly Gly Ser Thr Leu Val Asn Gly Gly Thr Trp Thr Arg Pro

100 105 110

His Lys Ala Gln Val Asp Ser Trp Glu Thr Val Phe Gly Asn Glu Gly

115 120 125

Trp Asn Trp Asp Asn Val Ala Ala Tyr Ser Leu Gln Ala Glu Arg Ala

130 135 140

Arg Ala Pro Asn Ala Lys Gln Ile Ala Ala Gly His Tyr Phe Asn Ala

145 150 155 160

Ser Cys His Gly Val Asn Gly Thr Val His Ala Gly Pro Arg Asp Thr

165 170 175

Gly Asp Asp Tyr Ser Pro Ile Val Lys Ala Leu Met Ser Ala Val Glu

180 185 190

Asp Arg Gly Val Pro Thr Lys Lys Asp Phe Gly Cys Gly Asp Pro His

195 200 205

Gly Val Ser Met Phe Pro Asn Thr Leu His Glu Asp Gln Val Arg Ser

210 215 220

Asp Ala Ala Arg Glu Trp Leu Leu Pro Asn Tyr Gln Arg Pro Asn Leu

225 230 235 240

Gln Val Leu Thr Gly Gln Tyr Val Gly Lys Val Leu Leu Ser Gln Asn

245 250 255

Gly Thr Thr Pro Arg Ala Val Gly Val Glu Phe Gly Thr His Lys Gly

260 265 270

Asn Thr His Asn Val Tyr Ala Lys His Glu Val Leu Leu Ala Ala Gly

275 280 285

Ser Ala Val Ser Pro Thr Ile Leu Glu Tyr Ser Gly Ile Gly Met Lys

290 295 300

Ser Ile Leu Glu Pro Leu Gly Ile Asp Thr Val Val Asp Leu Pro Val

305 310 315 320

Gly Leu Asn Leu Gln Asp Gln Thr Thr Ala Thr Val Arg Ser Arg Ile

325 330 335

Thr Ser Ala Gly Ala Gly Gln Gly Gln Ala Ala Trp Phe Ala Thr Phe

340 345 350

Asn Glu Thr Phe Gly Asp Tyr Ser Glu Lys Ala His Glu Leu Leu Asn

355 360 365

Thr Lys Leu Glu Gln Trp Ala Glu Glu Ala Val Ala Arg Gly Gly Phe

370 375 380

His Asn Thr Thr Ala Leu Leu Ile Gln Tyr Glu Asn Tyr Arg Asp Trp

385 390 395 400

Ile Val Asn His Asn Val Ala Tyr Ser Glu Leu Phe Leu Asp Thr Ala

405 410 415

Gly Val Ala Ser Phe Asp Val Trp Asp Leu Leu Pro Phe Thr Arg Gly

420 425 430

Tyr Val His Ile Leu Asp Lys Asp Pro Tyr Leu His His Phe Ala Tyr

435 440 445

Asp Pro Gln Tyr Phe Leu Asn Glu Leu Asp Leu Leu Gly Gln Ala Ala

450 455 460

Ala Thr Gln Leu Ala Arg Asn Ile Ser Asn Ser Gly Ala Met Gln Thr

465 470 475 480

Tyr Phe Ala Gly Glu Thr Ile Pro Gly Asp Asn Leu Ala Tyr Asp Ala

485 490 495

Asp Leu Ser Ala Trp Thr Glu Tyr Ile Pro Tyr His Phe Arg Pro Asn

500 505 510

Tyr His Gly Val Gly Thr Cys Ser Met Met Pro Lys Glu Met Gly Gly

515 520 525

Val Val Asp Asn Ala Ala Arg Val Tyr Gly Val Gln Gly Leu Arg Val

530 535 540

Ile Asp Gly Ser Ile Pro Pro Thr Gln Met Ser Ser His Val Met Thr

545 550 555 560

Val Phe Tyr Ala Met Ala Leu Lys Ile Ser Asp Ala Ile Leu Glu Asp

565 570 575

Tyr Ala Ser Met Gln

580

<210> 2

<211> 1746

<212> DNA

<213> 2

<400> 2

ggtattgagg catctttgtt gacagaccct aaggatgttt ctggaagaac cgttgactac 60

attattgctg gtggtggttt gaccggattg accactgccg caagattgac tgaaaatcca 120

aacatctctg ttttggtcat cgagtctggt tcttacgaat ctgacagagg acctattatc 180

gaagacttga acgcttacgg tgatattttc ggatcttctg ttgatcatgc ctacgagaca 240

gttgagttgg ctactaacaa tcagactgct ttgattaggt ctggaaatgg tttgggtgga 300

tctactttgg ttaatggagg tacttggact agaccacata aggctcaggt tgattcttgg 360

gaaactgttt ttggtaacga aggttggaac tgggataacg ttgcagctta ctctttgcaa 420

gcagaaagag ctagggctcc aaacgctaag caaattgctg ctggtcatta ctttaacgct 480

tcttgtcacg gtgttaacgg aactgtccac gccggaccta gagacactgg agatgattac 540

tctccaattg tcaaggcatt gatgtctgct gttgaagata gaggagtccc aaccaagaag 600

gatttcggtt gtggtgatcc acatggtgtt tctatgttcc caaatacatt gcacgaagat 660

caagttaggt ctgacgctgc tagagaatgg ttgttgccaa attatcaaag accaaacttg 720

caggtcttga ctggtcagta cgtcggtaag gttttgttgt ctcaaaacgg tactactcca 780

agagctgtcg gtgtcgagtt cggtactcat aagggtaata ctcacaacgt ttacgctaag 840

catgaagttt tgttggctgc tggttctgct gtttctccaa ccatcttgga gtattctgga 900

attggtatga agtctatttt ggaaccattg ggtattgata ctgtcgttga tttgccagtt 960

ggtttgaact tgcaggatca gactacagcc actgtcagat ccagaattac ttctgctggt 1020

gctggtcaag gtcaggctgc atggtttgct acttttaacg aaacttttgg tgattactct 1080

gaaaaggctc atgaattgtt gaacactaag ttggaacaat gggctgaaga agctgttgct 1140

agaggtggtt ttcataatac tactgctttg ttgattcaat acgaaaacta cagagactgg 1200

attgttaacc ataacgttgc ctattctgag ttgtttttgg acaccgctgg tgttgcttct 1260

tttgatgttt gggatttgtt gccatttaca agaggttacg ttcacatttt ggataaagat 1320

ccatacttgc atcactttgc atacgatcca caatactttt tgaacgaatt ggacttgttg 1380

ggtcaagctg ctgctactca attggctaga aacatttcta actctggtgc aatgcaaact 1440

tactttgccg gtgaaactat cccaggagat aacttggctt acgatgctga tttgtctgct 1500

tggactgaat acattccata ccatttcaga ccaaactacc acggtgtcgg tacttgttct 1560

atgatgccaa aggaaatggg aggtgttgtc gataacgctg caagagtcta cggagttcaa 1620

ggtttgagag ttattgatgg ttctattcca ccaactcaaa tgtcttctca tgttatgact 1680

gttttttacg ctatggcttt gaagatttct gatgctatct tggaagatta cgcttctatg 1740

caataa 1746

Claims

1. a kind of glucose oxidase mutant, have (I), (II) or（Ⅲ）Any of shown amino acid sequence：

(II) there is at least one immune epitope of glucose oxidase described in (I), and the amino of the glucose oxidase The amino acid sequence that acid sequence is obtained through modifying, substituting, lacking or adding one or several amino acid；

（Ⅲ）By such as SEQ ID NO:When nucleotide sequence or its complementary series shown in 2 or the degeneracy because genetic code with such as SEQ ID NO:The amino acid sequence of the different sequential coding of the nucleotide sequence of nucleotide sequence or its complementary series shown in 2 Row.

2. glucose oxidase mutant as described in claim 1, which is characterized in that described is substituted by 1 amino of substitution Acid.

3. glucose oxidase mutant as claimed in claim 2, which is characterized in that the substitution includes amino acid sequence For SEQ ID NO:The 386th of 1 glucose oxidase, 387,401,406,408,418,455,466,470,476,478, Any one in 479,492,493,501,531,532,546,578 amino acids is substituted.

4. glucose oxidase mutant as claimed in claim 3, which is characterized in that the substitution includes T386A, T386E, T386F, T386P, T387E, T387P, V401F, A406P, S408A, A418L, E455D, Q466K, N470E, N470F, N470K, A476P, Q478K, T479D, A492P, Y493P, T501E, T501K, T501L, T501R, T501Y, Any one in N531F, N531P, A532R, G546A, S578F, S578K, S578R, S578Y.

5. glucose oxidase mutant as described in claim 1, which is characterized in that the missing is missing 1 or 2 Amino acid.

6. glucose oxidase mutant as claimed in claim 5, which is characterized in that the missing includes the 580th ammonia Base acid missing or the 579th and the 580th amino acids lack simultaneously.

7. encode the DNA molecular of claim 1-6 any one of them glucose oxidase mutant.

8. a kind of recombinant expression carrier, which is characterized in that the recombinant expression carrier carries the DNA described in claim 7 Molecule.

9. a kind of host cell, which is characterized in that the recombination expression that the host cell includes described in claim 8 carries Body.

10. application of the claim 1-6 any one of them glucose oxidase mutant in feed preparation.