CN105039290B - A kind of xylanase mutant and its application - Google Patents

A kind of xylanase mutant and its application Download PDF

Info

Publication number
CN105039290B
CN105039290B CN201510579571.XA CN201510579571A CN105039290B CN 105039290 B CN105039290 B CN 105039290B CN 201510579571 A CN201510579571 A CN 201510579571A CN 105039290 B CN105039290 B CN 105039290B
Authority
CN
China
Prior art keywords
thr
xylanase
gly
ser
mutant
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201510579571.XA
Other languages
Chinese (zh)
Other versions
CN105039290A (en
Inventor
吴秀秀
邵弨
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Qingdao Vland Biotech Group Co Ltd
Original Assignee
Qingdao Vland Biotech Group Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Qingdao Vland Biotech Group Co Ltd filed Critical Qingdao Vland Biotech Group Co Ltd
Priority to CN201510579571.XA priority Critical patent/CN105039290B/en
Publication of CN105039290A publication Critical patent/CN105039290A/en
Application granted granted Critical
Publication of CN105039290B publication Critical patent/CN105039290B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
    • C12N9/14—Hydrolases (3)
    • C12N9/24—Hydrolases (3) acting on glycosyl compounds (3.2)
    • C12N9/2402—Hydrolases (3) acting on glycosyl compounds (3.2) hydrolysing O- and S- glycosyl compounds (3.2.1)
    • C12N9/2477—Hemicellulases not provided in a preceding group
    • C12N9/248—Xylanases
    • C12N9/2482—Endo-1,4-beta-xylanase (3.2.1.8)
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Y—ENZYMES
    • C12Y302/00—Hydrolases acting on glycosyl compounds, i.e. glycosylases (3.2)
    • C12Y302/01—Glycosidases, i.e. enzymes hydrolysing O- and S-glycosyl compounds (3.2.1)
    • C12Y302/01008—Endo-1,4-beta-xylanase (3.2.1.8)

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Genetics & Genomics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • General Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Biotechnology (AREA)
  • Biomedical Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

The object of the present invention is to provide a kind of fire resistant xylanase mutant.The Optimun pH of the xylanase mutant is 5.5, consistent with wild-type xylanase XynPF, but optimum temperature is 60 DEG C, and has stronger heat resistance than wild-type xylanase.Wherein, xylanase mutant XynD1 handled under the conditions of 65 DEG C can keep after 5 min 45% or more enzyme activity, handled under the conditions of 70 DEG C, 75 DEG C remain to keep respectively after 5 min 30% and 25% or so enzyme activity, xylanase mutant XynD2 handled under the conditions of 65 DEG C can keep after 5 min 75% or more enzyme activity, handled under the conditions of 70 DEG C, 75 DEG C remain to keep respectively after 5 min 35% and 30% or so enzyme activity.The xylanase mutant can be widely applied to field of fodder, have a extensive future.

Description

A kind of xylanase mutant and its application
Technical field
The invention belongs to enzyme gene renovation technique fields, and in particular to a kind of xylanase mutant and its application.
Background technology
Xylan (xylan) is widely present in nature, is the important component of hemicellulose, it is content in nature It is only second to the second relatively rich glycan of cellulose, almost accounts for the one third that organic carbon content may be updated in the earth.It is planted in quilt Xylan accounts for the 15%~30% of dry matter weight in object, and the 7%~12% of dry matter weight is accounted in gymnosperm.But xylan has There is very strong anti-oxidant action, cannot be digested and absorb in the alimentary canal of animal, and the absorption of other nutrients can be influenced It utilizes, thus greatly limits the application rich in xylan feed (barley, wheat, rye etc.).Zytase (Xylanase) It refer to the general name for one group of enzyme that the single-minded degradation of hemicellulose xylan of energy is xylo-oligosaccharide and xylose.People grind zytase To study carefully and has just started early in the sixties, main research concentrates on the zytase of food, feed, papermaking, energy industry etc., The zytase of a large amount of different type different function has been separated to from the microorganism of separate sources.And isolate a variety of wood Xylanase gene, a variety of zytase products of industrialized production.
Because there are one 80~90 DEG C of short duration of hot stages during particle manufacture at present.Penicillium notatum source wood is poly- Carbohydrase thermal stability is poor, and aqueous solution keeps the temperature 5 minutes remaining enzymatic activitys at 65 DEG C and is less than 30%, makes the enzyme in pellet Application be restricted.Equipment investment is not only increased using the method after feed granulating in zytase liquid spray to feed, And distribution uniformity in the stability of enzyme preparation, feed can not all be ensured well.Therefore, zytase thermostabilization is improved Property has important practical significance to current feed with zytase.
Invention content
The object of the present invention is to provide a kind of heat resistant xylanase mutant and its applications.Applicant passes through to deriving from rope The zytase of shape mould (Penicillium funiculosum) carries out protein engineering transformation, obtains mutant protein, Its heat resistance is significantly improved, and is conducive to its extensive use in field of fodder.
One aspect of the present invention provides a kind of xylanase mutant, and amino acid sequence is SEQ ID NO:1 wood is poly- 115th amino acids of carbohydrase sport Glu by Asp.
The amino acid sequence of above-mentioned xylanase mutant is SEQ ID NO:3, a kind of coding nucleotide sequence is SEQ ID NO:4。
Another aspect of the present invention provides a kind of xylanase mutant, and amino acid sequence is SEQ ID NO:3 wood 102nd amino acids of glycan enzyme mutant sport Pro by Thr.
The amino acid sequence of above-mentioned xylanase mutant is SEQ ID NO:5, a kind of coding nucleotide sequence is SEQ ID NO:6。
The present invention also provides application of the above-mentioned xylanase mutant in feed.
The present invention provides xylanase mutant XynD1 and XynD2, and build and obtain recombinant expression zytase mutation The Pichia yeast engineering XynD1 of body and the fermentation level of Pichia yeast engineering XynD2,10L fermentation tank can respectively reach 7415U/ml and 7508U/ml.The Optimun pH of the xylanase mutant is 5.5, with wild-type xylanase XynPF is consistent, but optimum temperature is 60 DEG C, and has stronger heat resistance than wild-type xylanase.Wherein, xylan Enzyme mutant XynD1 handled under the conditions of 65 DEG C can keep after 5min 45% or more enzyme activity, handled under the conditions of 70 DEG C, 75 DEG C Remain to keep 30% and 25% or so enzyme activity after 5min respectively, xylanase mutant XynD2 is handled under the conditions of 65 DEG C The enzyme activity that 75% or more can be kept after 5min remains to keep 35% and 30% respectively after handling 5min under the conditions of 70 DEG C, 75 DEG C The enzyme activity of left and right.The xylanase mutant can be widely applied to field of fodder, have a extensive future.
Description of the drawings
Fig. 1 is that xylanase mutant XynD1 and XynD2 heat resistance compares figure.
Specific implementation mode：
The routine techniques and method that the present invention has used genetic engineering and molecular biology field uses, such as MOLECULAR CLONING:A LABORATORY MANUAL, 3nd Ed. (Sambrook, 2001) and CURRENT Recorded method in PROTOCOLS IN MOLECULAR BIOLOGY (Ausubel, 2003).These general bibliography Provide definition well known by persons skilled in the art and method.But those skilled in the art can be recorded in the present invention Technical solution on the basis of, using the other conventional methods in this field, experimental program and reagent, and be not limited to of the invention specific The restriction of embodiment.
Experiment material and reagent：
Bacterial strain and carrier：Bacillus coli DH 5 alpha, Pichia pastoris GS115, carrier pPIC9K, Amp, G418 are purchased from Invitrogen companies.
Enzyme and kit：From Takara companies, restriction enzyme is public purchased from Fermentas for PCR enzymes and ligase purchase Department, plasmid extraction kit and glue purification QIAquick Gel Extraction Kit are purchased from Omega companies, the purchase of GeneMorph II Random Mutagenesis Kits From Beijing bio tech ltd Bo Maisi.
Culture medium prescription：
Escherichia coli culture medium (LB culture mediums)：0.5% yeast extract, 1% peptone, 1%NaCl, pH7.0)；
LB-AMP culture mediums：LB culture mediums add 100 μ g/mL ampicillins；
Yeast culture medium (YPD culture mediums)：1% yeast extract, 2% peptone, 2% glucose；
Yeast screening assay culture medium (MD culture mediums)：2% glucose, 2% agarose, 1.34%YNB (no amino yeast nitrogens Source), 4 × 10-5Biotin；
BMGY culture mediums：2% peptone, 1% yeast extract, 100mM kaliumphosphate buffers (pH6.0), 1.34%YNB (no amino yeast nitrogen), 4 × 10-5Biotin, 1% glycerine；
BMMY culture mediums：2% peptone, 1% yeast extract, 100mM kaliumphosphate buffers (pH6.0), 1.34%YNB (no amino yeast nitrogen), 4 × 10-5Biotin, 0.5% methanol.
The present invention is described in detail with reference to embodiment.
The amplification of 1 xylanase gene of embodiment
XynPF-F1：GCTGTTACATCCAACGAGACCGG
XynPF-R1：TTAAGAGACGGTAATAGTAGAAG
, as template, above-mentioned primer XynPF-F1 is utilized using penicillium funiculosum (Penicillium funiculosum) genome PCR amplification is carried out with XynPF-R1, glue recycles PCR product, connects pEASY-T carriers, in conversion to escherichia coli DH5a, picking Correct transformant is sequenced.Sequencing result shows that the nucleotides sequence of zytase is classified as SEQ ID NO in transformant：2, Its amino acid sequence encoded is SEQ ID NO：1, which is named as XynPF by applicant.
The amplification and synthesis of 2 xylanase mutant gene of embodiment
In order to improve the heat resistance of zytase XynPF, mass mutation has been carried out to the enzyme by directed evolution technologies Screening, design PCR primer XynPF-F2, XynPF-R2 are as follows：
XynPF-F2：GGCGAATTC(underscore is that restriction enzyme EcoRI knows to GCTGTTACATCCAACGAGACCGG Other site)
XynPF-R2：ATAGCGGCCGC(underscore is restriction enzyme Not I to TTAAGAGACGGTAATAGTAGAAG Recognition site)
With XynPF genes (SEQ ID NO：2) it is template, utilizes above-mentioned primer GeneMorph II random mutations PCR Kit (Stratagene) carries out PCR amplification, and glue recycles PCR product, same as warp after EcoRI, Not I progress digestion processing PET21a carriers connection after digestion in conversion to e. coli bl21 (DE3), is coated on LB+Amp tablets, and 37 DEG C are inverted training It supports, after sub- appearance to be transformed, is chosen one by one with toothpick to 96 orifice plates, the LB+ that 150ul contains 0.1mM IPTG is added in each hole Amp culture mediums, 37 DEG C of 220rpm cultures 6h or so, supernatant is abandoned in centrifugation, and thalline is resuspended with buffer solution, multigelation broken wall, is obtained Bacillus coli cells lysate containing zytase.
30ul lysates are taken out respectively to two pieces of 96 new orifice plates；By one of 5min is handled in 75 DEG C；Then by two 30ul substrates are all added in 96 orifice plate of block, and after 37 DEG C are reacted 30min, DNS methods measure the reduced sugar generated, calculate different mutons Enzyme activity after high-temperature process is horizontal.The experimental results showed that some mutation do not influence the heat resistance of zytase, some mutation Even its heat resistance or enzyme activity is made to become worse；In addition also some mutation, although tolerance of the zytase to temperature can be improved Property, but significant change has occurred in its zymologic property after mutation, and these are undesirable.Finally, applicant obtains to show It writes the heat resistance for improving zytase XynPF, and does not interfere with the mutational site and site of its enzyme activity and original zymologic property Combination：Two point mutation of D115E simple point mutations and T102P, D115E.
The xylanase mutant of the simple point mutation containing D115E is named as XynD1, amino acid sequence is SEQ ID NO： 3, coding nucleotide sequence is SEQ ID NO：4；Xylanase mutant containing two point mutation of T102P, D115E is named as XynD2, amino acid sequence are SEQ ID NO：5, coding nucleotide sequence is SEQ ID NO：6.The above nucleotide sequence by Shanghai JaRa biotech firm synthesizes.
PCR amplification carried out to above-mentioned two mutant with primer XynPF-F2, XynPF-R2, primer both ends introduce EcoRI, Not I sites.PCR reaction conditions are：94 DEG C of denaturation 5min；Then 94 DEG C of denaturation 30s, 56 DEG C of renaturation 30s, 72 DEG C extend 1min, after 30 recycle, 72 DEG C of heat preservation 10min.Agarose gel electrophoresis is the results show that the genetic fragment of XynD1 and XynD2 is big Small is 570bp.
It expands to obtain the genetic fragment of wild-type xylanase XynPF by above-mentioned same PCR method.
The structure of 3 pichia pastoris engineered strain of embodiment
Xylanase mutant gene XynD1 and the XynD2 segment that above-mentioned clone is obtained, by EcoRI and Not I Point is connected with Expression vector pPIC9K, construction of expression vector pPIC9K-XynD1 and pPIC9K-XynD2.
Mutant expression plasmid is linearized with Sal I, expression plasmid linearized fragment is converted by electroporation Pichia pastoris GS115, on MD tablets respectively screening obtain Pichia pastoris recombinant bacterial strain GS115/pPIC9K-XynD1 and Then GS115/pPIC9K-XynD2 screens the transformant of multicopy on the YPD tablets of the Geneticin containing various concentration respectively.
The positive transformant of recombinant expression xylanase mutant XynD1 and XynD2 that screening obtains are respectively designated as Pichia pastoris XynD1 (Pichia pastoris XynD1) and Pichia pastoris XynD2
(Pichia pastoris XynD2), then transfers in BMGY culture mediums respectively, 30 DEG C, 250rpm oscillation trainings Support 1d；It is transferred to again in BMMY culture mediums, 30 DEG C, 250rpm shaken cultivations；The methanol of addition 0.5% daily, induced expression 4d；From The heart removes thalline, respectively obtains the fermented supernatant fluid of XynD1 containing xylanase mutant and XynD2；Carried out SDS-PAGE Electrophoresis detection is analyzed, and as a result shows that the molecular size range of xylanase mutant in above-mentioned fermented supernatant fluid is about 20kDa.
Wild-type xylanase gene XynPF is cloned into Pichia pastoris by above-mentioned same digestion connection method In GS115 host, structure obtains the Pichia yeast engineering of recombinant expression wild-type xylanase XynPF, is named as complete red ferment Female XynPF (Pichia pastoris XynPF).Shaking flask level fermentation Pichia pastoris XynPF, 30 DEG C, 250rpm shaken cultivations； The methanol of addition 0.5% daily, induced expression 4d；Centrifugation removal thalline, obtains in the fermentation of the XynPF containing wild-type xylanase Clear liquid.
(1) definition of xylanase activity unit
It is per minute that 1 μm of ol is discharged from the xylan solution of a concentration of 5mg/ml under conditions of 37 DEG C, pH value are 5.5 The required enzyme amount of reduced sugar is an enzyme activity unit U.
(2) enzyme activity determination method
The xylan substrate (preparation of pH5.5 acetic acid-sodium acetate buffer solutions) for taking 2ml a concentration of 1%, is added to colorimetric cylinder In, 37 DEG C of balance 10min add the acid that 2ml is suitably diluted through pH5.5 acetic acid-sodium acetate buffer solutions and balanced through 37 DEG C Property zytase enzyme solution, mixing is in 37 DEG C of accurate insulation reaction 30min.After reaction, be added 5ml DNS reagents, mixing with Terminate reaction.Then boiling water bath boils 5min, is cooled to room temperature with tap water, and distilled water is added to be settled to 25ml, after mixing, with mark Quasi- blank sample is blank control, and light absorption value A is measured at 540nmE。
Enzyme activity calculation formula：
XD=[(AE- AB)×K+C0]×N×1000/(M×t)
In formula：XDFor the vigor of zytase in dilution enzyme solution, U/ml；AEFor the absorbance of enzyme reaction solution；ABFor enzyme blank The absorbance of liquid；K is the slope of standard curve；C0For the intercept of standard curve；M is the molal weight of xylose, 150.2g/mol； T is enzyme digestion reaction time, min；N is enzyme solution extension rate；1000 be transforming factor, 1mmol=1000 μm of ol.
(3) enzyme activity determination result
Detect above-mentioned Pichia pastoris XynPF, Pichia pastoris XynD1 and Pichia pastoris XynD2 hairs respectively according to the method described above Xylanase activity in ferment supernatant.As a result it shows：The enzyme activity of Pichia pastoris XynPF fermented supernatant fluids is 255U/ml, and is finished red The enzyme activity of yeast XynD1 and Pichia pastoris XynD2 fermented supernatant fluids is respectively 264U/mL and 271U/mL.
The fermentation verification of embodiment 4
Carry out the hair of Pichia pastoris XynPF, Pichia pastoris XynD1 and Pichia pastoris XynD2 respectively on 10 liters of fermentation tanks Ferment, the culture medium prescription used that ferments are：Calcium sulfate 1.1g/L, potassium dihydrogen phosphate 5.5g/L, ammonium dihydrogen phosphate 55g/L, sulfuric acid Potassium 20.3g/L, magnesium sulfate 16.4g/L, potassium hydroxide 1.65g/L, antifoaming agent 0.05%.
Fermentation manufacturing technique：PH value 5.0,30 DEG C of temperature, stir speed (S.S.) 300rpm, ventilation quantity 1.0~1.5 (v/v), dissolved oxygen Control is 20% or more.
Entire fermentation process is divided into three phases：First stage be thalline cultivation stage, by 7% ratio access seed, 30 DEG C culture 24~26h, with mended glucose be mark；Second stage is the hungry stage, after glucose has been mended, does not flow plus appoints What carbon source, terminates, by a definite date about 30~60min when dissolved oxygen rose to for 80% stage indicated above；Phase III is induced expression Stage, stream plus methanol induction, and keep dissolved oxygen 20% or more, incubation time is between 150~180h.After fermentation, Zymotic fluid obtains crude enzyme liquid after being handled by flame filter press.
Above-mentioned crude enzyme liquid is detected using Measuring Methods of Xylanse Activity described in embodiment 3, the results show that recombination The fermentation enzyme activity that the Pichia pastoris XynPF of expression wild-type xylanase is final is 7330U/ml, and recombinantly expresses zytase The fermentation enzyme activity that the Pichia pastoris XynD1 and Pichia pastoris XynD2 of mutant are final is respectively 7415U/ml and 7508U/ml.
The zymologic property of 5 zytase of embodiment measures
1, most suitable action pH analysis
It is respectively 2.0,2.5,3.0,4.0,4.5,5.0,5.5,6.0,7.0,8.0 disodium hydrogen phosphate-lemon using pH value The crude enzyme liquid that the fermentation of embodiment 4 obtains is diluted measurement by lemon acid buffer, and xylan substrate is also respectively with corresponding pH value Buffer carries out Xylanase activity measurement at 37 DEG C, calculates enzyme activity, with highest enzyme activity for 100%, calculates opposite enzyme It is living, the results show that the Optimun pH of xylanase mutant XynD1 and XynD2 provided by the invention is 5.5, with open country Raw type zytase XynPF is consistent.
2, optimal reactive temperature is analyzed
Respectively at 30 DEG C, 35 DEG C, 40 DEG C, 45 DEG C, 50 DEG C, 55 DEG C, 60 DEG C, 65 DEG C, 70 DEG C, 75 DEG C, under the conditions of pH5.5, The crude enzyme liquid obtained to the fermentation of embodiment 4 carries out xylanase activity measurement, with highest enzyme activity for 100%, calculates opposite enzyme activity, The results show that the optimum temperature of wild-type xylanase XynPF is 50 DEG C；And xylanase mutant provided by the invention The optimum temperature of XynD1 and XynD2 is 60 DEG C.
3, Analysis of Heat Tolerance
The crude enzyme liquid that the fermentation of embodiment 4 obtains is diluted to about 20U/ with the acetic acid-sodium acetate buffer solution of pH5.5 respectively Ml after handling 5min respectively under the conditions of 65 DEG C, 70 DEG C and 75 DEG C, measures it and remains enzyme activity, be with the enzyme activity of untreated samples 100%, calculate enzyme activity residual rate.
The results are shown in Figure 1, after wild-type xylanase XynPF handles 5min under the conditions of 65 DEG C, is only capable of holding 28% The enzyme activity of left and right, after handling 5min under the conditions of 70 DEG C, 75 DEG C, enzyme activity residual rate is less than 10%；And xylanase mutant XynD1 handled under the conditions of 65 DEG C can keep after 5min 45% or more enzyme activity, handled under the conditions of 70 DEG C, 75 DEG C after 5min still It can be protected after 30% and 25% or so enzyme activity, xylanase mutant XynD2 can be kept to handle 5min under the conditions of 65 DEG C respectively The enzyme activity for holding 75% or more, under the conditions of 70 DEG C, 75 DEG C handle 5min after remain to keep respectively 35% and 30% or so enzyme activity. The above results show that compared with wild type, the heat resistance of xylanase mutant provided by the invention is significantly improved.
In conclusion the optimum temperature of xylanase mutant XynD1 and XynD2 provided by the invention is 60 DEG C, And there is stronger heat resistance than wild-type xylanase, therefore be more suitable for being widely used in field of feed processing, it has a extensive future.
The above is only a preferred embodiment of the present invention, it is noted that for the ordinary skill people of the art For member, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also answered It is considered as protection scope of the present invention.
SEQUENCE LISTING
<110>Qingdao Weilan Biology Group Co., Ltd.
<120>A kind of xylanase mutant and its application
<130>
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 189
<212> PRT
<213> 1
<400> 1
Ala Val Thr Ser Asn Glu Thr Gly Tyr His Asp Gly Tyr Phe Tyr Ser
1 5 10 15
Phe Trp Thr Asp Ala Pro Gly Thr Val Ser Met Glu Leu Gly Pro Gly
20 25 30
Gly Asn Tyr Ser Thr Ser Trp Arg Asn Thr Gly Asp Phe Thr Ser Gly
35 40 45
Lys Gly Trp Asn Pro Ala Asn Ala Gln Thr Val Thr Tyr Ser Gly Glu
50 55 60
Phe Asn Pro Ser Gly Asn Ala Tyr Leu Ala Val Tyr Gly Trp Thr Thr
65 70 75 80
Asp Pro Leu Val Glu Tyr Tyr Ile Leu Glu Ser Tyr Gly Thr Tyr Asn
85 90 95
Pro Ser Ser Gly Leu Thr Ser Leu Gly Gln Val Thr Ser Asp Gly Gly
100 105 110
Thr Tyr Asp Ile Tyr Ser Thr Gln Arg Val Asn Gln Pro Ser Ile Glu
115 120 125
Gly Thr Ser Thr Phe Asn Gln Tyr Trp Ser Val Arg Thr Glu Lys Arg
130 135 140
Val Gly Gly Thr Val Thr Thr Ala Asn His Phe Ala Ala Trp Lys Ala
145 150 155 160
Leu Gly Leu Glu Met Gly Thr Tyr Asn Tyr Met Ile Val Ser Thr Glu
165 170 175
Gly Tyr Glu Ser Ser Gly Ser Ser Thr Ile Thr Val Ser
180 185
<210> 2
<211> 570
<212> DNA
<213> 2
<400> 2
gctgttacat ccaacgagac cgggtaccac gacgggtact tctactcgtt ctggaccgac 60
gcgcccggaa cggtctccat ggagctgggc cctggcggaa actacagcac ctcttggcgt 120
aatactggag acttcacctc tggtaaagga tggaatccag ctaacgctca aaccgtcacc 180
tattctggag agttcaaccc atctggaaat gcctacttgg ctgtctacgg atggactaca 240
gaccctttgg ttgagtatta catcttggag tcttatggta catacaaccc ttcttctgga 300
ttgacatctt tgggacaggt cacatctgat ggaggaactt acgacatcta ctctacacag 360
agagttaatc agccatctat cgaaggaacc tctacattta accagtattg gtctgtcaga 420
accgagaaga gagtcggagg tacagtcact actgctaacc atttcgcagc atggaaggct 480
ttgggtttgg agatgggaac ctacaactac atgatcgttt ctaccgaggg ttacgagtct 540
tctggatctt ctactattac cgtctcttaa 570
<210> 3
<211> 189
<212> PRT
<213> 3
<400> 3
Ala Val Thr Ser Asn Glu Thr Gly Tyr His Asp Gly Tyr Phe Tyr Ser
1 5 10 15
Phe Trp Thr Asp Ala Pro Gly Thr Val Ser Met Glu Leu Gly Pro Gly
20 25 30
Gly Asn Tyr Ser Thr Ser Trp Arg Asn Thr Gly Asp Phe Thr Ser Gly
35 40 45
Lys Gly Trp Asn Pro Ala Asn Ala Gln Thr Val Thr Tyr Ser Gly Glu
50 55 60
Phe Asn Pro Ser Gly Asn Ala Tyr Leu Ala Val Tyr Gly Trp Thr Thr
65 70 75 80
Asp Pro Leu Val Glu Tyr Tyr Ile Leu Glu Ser Tyr Gly Thr Tyr Asn
85 90 95
Pro Ser Ser Gly Leu Thr Ser Leu Gly Gln Val Thr Ser Asp Gly Gly
100 105 110
Thr Tyr Glu Ile Tyr Ser Thr Gln Arg Val Asn Gln Pro Ser Ile Glu
115 120 125
Gly Thr Ser Thr Phe Asn Gln Tyr Trp Ser Val Arg Thr Glu Lys Arg
130 135 140
Val Gly Gly Thr Val Thr Thr Ala Asn His Phe Ala Ala Trp Lys Ala
145 150 155 160
Leu Gly Leu Glu Met Gly Thr Tyr Asn Tyr Met Ile Val Ser Thr Glu
165 170 175
Gly Tyr Glu Ser Ser Gly Ser Ser Thr Ile Thr Val Ser
180 185
<210> 4
<211> 570
<212> DNA
<213> 4
<400> 4
gctgttacat ccaacgagac cgggtaccac gacgggtact tctactcgtt ctggaccgac 60
gcgcccggaa cggtctccat ggagctgggc cctggcggaa actacagcac ctcttggcgt 120
aatactggag acttcacctc tggtaaagga tggaatccag ctaacgctca aaccgtcacc 180
tattctggag agttcaaccc atctggaaat gcctacttgg ctgtctacgg atggactaca 240
gaccctttgg ttgagtatta catcttggag tcttatggta catacaaccc ttcttctgga 300
ttgacatctt tgggacaggt cacatctgat ggaggaactt acgagatcta ctctacacag 360
agagttaatc agccatctat cgaaggaacc tctacattta accagtattg gtctgtcaga 420
accgagaaga gagtcggagg tacagtcact actgctaacc atttcgcagc atggaaggct 480
ttgggtttgg agatgggaac ctacaactac atgatcgttt ctaccgaggg ttacgagtct 540
tctggatctt ctactattac cgtctcttaa 570
<210> 5
<211> 189
<212> PRT
<213> 5
<400> 5
Ala Val Thr Ser Asn Glu Thr Gly Tyr His Asp Gly Tyr Phe Tyr Ser
1 5 10 15
Phe Trp Thr Asp Ala Pro Gly Thr Val Ser Met Glu Leu Gly Pro Gly
20 25 30
Gly Asn Tyr Ser Thr Ser Trp Arg Asn Thr Gly Asp Phe Thr Ser Gly
35 40 45
Lys Gly Trp Asn Pro Ala Asn Ala Gln Thr Val Thr Tyr Ser Gly Glu
50 55 60
Phe Asn Pro Ser Gly Asn Ala Tyr Leu Ala Val Tyr Gly Trp Thr Thr
65 70 75 80
Asp Pro Leu Val Glu Tyr Tyr Ile Leu Glu Ser Tyr Gly Thr Tyr Asn
85 90 95
Pro Ser Ser Gly Leu Pro Ser Leu Gly Gln Val Thr Ser Asp Gly Gly
100 105 110
Thr Tyr Glu Ile Tyr Ser Thr Gln Arg Val Asn Gln Pro Ser Ile Glu
115 120 125
Gly Thr Ser Thr Phe Asn Gln Tyr Trp Ser Val Arg Thr Glu Lys Arg
130 135 140
Val Gly Gly Thr Val Thr Thr Ala Asn His Phe Ala Ala Trp Lys Ala
145 150 155 160
Leu Gly Leu Glu Met Gly Thr Tyr Asn Tyr Met Ile Val Ser Thr Glu
165 170 175
Gly Tyr Glu Ser Ser Gly Ser Ser Thr Ile Thr Val Ser
180 185
<210> 6
<211> 570
<212> DNA
<213> 6
<400> 6
gctgttacat ccaacgagac cgggtaccac gacgggtact tctactcgtt ctggaccgac 60
gcgcccggaa cggtctccat ggagctgggc cctggcggaa actacagcac ctcttggcgt 120
aatactggag acttcacctc tggtaaagga tggaatccag ctaacgctca aaccgtcacc 180
tattctggag agttcaaccc atctggaaat gcctacttgg ctgtctacgg atggactaca 240
gaccctttgg ttgagtatta catcttggag tcttatggta catacaaccc ttcttctgga 300
ttgccatctt tgggacaggt cacatctgat ggaggaactt acgagatcta ctctacacag 360
agagttaatc agccatctat cgaaggaacc tctacattta accagtattg gtctgtcaga 420
accgagaaga gagtcggagg tacagtcact actgctaacc atttcgcagc atggaaggct 480
ttgggtttgg agatgggaac ctacaactac atgatcgttt ctaccgaggg ttacgagtct 540
tctggatctt ctactattac cgtctcttaa 570

Claims (7)

1. a kind of xylanase mutant, which is characterized in that the xylanase mutant is that amino acid sequence is SEQ ID NO:115th amino acids of 1 zytase sport Glu by Asp.
2. a kind of gene, which is characterized in that gene code xylanase mutant described in claim 1.
3. a kind of xylanase mutant, which is characterized in that the xylanase mutant is that wood described in claim 1 is poly- 102nd amino acids of carbohydrase mutant sport Pro by Thr.
4. a kind of gene, which is characterized in that the xylanase mutant described in the gene code claim 3.
5. a kind of recombinant plasmid, which is characterized in that the recombinant plasmid is used in host cell inner expression claim 1 or 3 The xylanase mutant.
6. a kind of recombinant host cell, which is characterized in that the recombinant host cell is the weight carried described in claim 5 The host cell of group plasmid.
7. recombinant host cell as claimed in claim 6, which is characterized in that the host cell is Pichia pastoris.
CN201510579571.XA 2015-09-11 2015-09-11 A kind of xylanase mutant and its application Active CN105039290B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201510579571.XA CN105039290B (en) 2015-09-11 2015-09-11 A kind of xylanase mutant and its application

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201510579571.XA CN105039290B (en) 2015-09-11 2015-09-11 A kind of xylanase mutant and its application

Publications (2)

Publication Number Publication Date
CN105039290A CN105039290A (en) 2015-11-11
CN105039290B true CN105039290B (en) 2018-10-09

Family

ID=54446263

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201510579571.XA Active CN105039290B (en) 2015-09-11 2015-09-11 A kind of xylanase mutant and its application

Country Status (1)

Country Link
CN (1) CN105039290B (en)

Families Citing this family (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN110042092B (en) * 2019-03-07 2020-08-18 青岛红樱桃生物技术有限公司 Xylanase mutant with improved stability and coding gene and application thereof
CN112094834B (en) * 2019-06-18 2023-02-03 青岛蔚蓝生物集团有限公司 Xylanase mutants with improved specific activity

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102260659A (en) * 2010-05-31 2011-11-30 中国科学院成都生物研究所 1,4-beta-D-xylanase mutant
CN103627686A (en) * 2013-11-14 2014-03-12 青岛蔚蓝生物集团有限公司 Xylanase mutant and application thereof
CN104560920A (en) * 2015-01-26 2015-04-29 青岛蔚蓝生物集团有限公司 Acidic xylanase mutant and application thereof

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101554208B (en) * 2009-05-21 2012-07-04 广州市威司特生物科技有限公司 Compounding method of high temperature resistant xylanase in animal feed

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102260659A (en) * 2010-05-31 2011-11-30 中国科学院成都生物研究所 1,4-beta-D-xylanase mutant
CN103627686A (en) * 2013-11-14 2014-03-12 青岛蔚蓝生物集团有限公司 Xylanase mutant and application thereof
CN104560920A (en) * 2015-01-26 2015-04-29 青岛蔚蓝生物集团有限公司 Acidic xylanase mutant and application thereof

Also Published As

Publication number Publication date
CN105039290A (en) 2015-11-11

Similar Documents

Publication Publication Date Title
CN105039289B (en) Xylanase mutant and its application
US10815470B2 (en) Arginine deiminase mutant methods of using the same
CN104560920B (en) A kind of acidic xylan enzyme mutant and its application
CN105087525B (en) Xylanase mutant
CN108559739A (en) The mannase PMan5A mutant and its gene and application that heat resistance improves
CN108251391A (en) Novel grape carbohydrate oxidase mutant
CN108251389A (en) The glucose oxidase mutant that a kind of heat resistance improves
CN112899258B (en) Heat-resistant beta-mannase mutant ManAK-10 and coding gene and application thereof
CN108118037A (en) The glucose oxidase mutant that a kind of heat resistance improves
CN105039290B (en) A kind of xylanase mutant and its application
CN108118038A (en) A kind of glucose oxidase mutant
CN104911163B (en) A kind of fire resistant xylanase mutant and its application
CN105087524B (en) A kind of acidic xylan enzyme mutant
CN108251390A (en) A kind of glucose oxidase mutant
CN104450650B (en) A kind of alkalescent xylanase mutant and application thereof
CN107988177A (en) Glucose oxidase mutant
CN109207446A (en) glucose oxidase mutant
CN109423483A (en) Glucose oxidase mutant
CN104404012B (en) A kind of novel phytase
CN109295041A (en) With active polypeptide of serrapeptase and preparation method thereof
CN118272349A (en) Xylanase mutant and application thereof

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20221122

Address after: 273400 west side of Yan Bin Road, Feixian County Economic Development Zone, Linyi, Shandong

Patentee after: SHANDONG KDN BIOTECH Co.,Ltd.

Patentee after: QINGDAO VLAND BIOTECH GROUP Co.,Ltd.

Address before: 266061 Shandong 12A07 Shandong High Speed Building, 29 Miaoling Road, Laoshan District, Qingdao City, Shandong Province

Patentee before: QINGDAO VLAND BIOTECH GROUP Co.,Ltd.

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20230323

Address after: No. 596-1, jiushui East Road, Laoshan District, Qingdao City, Shandong Province 266100

Patentee after: QINGDAO VLAND BIOTECH GROUP Co.,Ltd.

Address before: 273400 west side of Yan Bin Road, Feixian County Economic Development Zone, Linyi, Shandong

Patentee before: SHANDONG KDN BIOTECH Co.,Ltd.

Patentee before: QINGDAO VLAND BIOTECH GROUP Co.,Ltd.