CN113718016A - Oligonucleotide probe developed by utilizing elytrigia elongata specific sequence - Google Patents
Oligonucleotide probe developed by utilizing elytrigia elongata specific sequence Download PDFInfo
- Publication number
- CN113718016A CN113718016A CN202110999089.7A CN202110999089A CN113718016A CN 113718016 A CN113718016 A CN 113718016A CN 202110999089 A CN202110999089 A CN 202110999089A CN 113718016 A CN113718016 A CN 113718016A
- Authority
- CN
- China
- Prior art keywords
- sequence
- oligo
- probe
- pth1
- oligonucleotide probe
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6806—Preparing nucleic acids for analysis, e.g. for polymerase chain reaction [PCR] assay
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6813—Hybridisation assays
- C12Q1/6841—In situ hybridisation
-
- G—PHYSICS
- G16—INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR SPECIFIC APPLICATION FIELDS
- G16B—BIOINFORMATICS, i.e. INFORMATION AND COMMUNICATION TECHNOLOGY [ICT] SPECIALLY ADAPTED FOR GENETIC OR PROTEIN-RELATED DATA PROCESSING IN COMPUTATIONAL MOLECULAR BIOLOGY
- G16B30/00—ICT specially adapted for sequence analysis involving nucleotides or amino acids
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biotechnology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Theoretical Computer Science (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Computational Biology (AREA)
- Spectroscopy & Molecular Physics (AREA)
- Medical Informatics (AREA)
- Evolutionary Biology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention relates to an oligonucleotide probe developed by using a long spike elytrigia repens specific sequence, which is mainly used for obtaining a highly repetitive sequence in the long spike elytrigia repens by means of genome sequencing, is designed into an oligonucleotide probe Oligo-pTh1, can be combined with other probes in an experiment for use, can enrich a chromosome FISH karyotype chart and is used for identifying structural variation of chromosomes in distant hybridization germplasm. The wheat distant hybrid material is often used as an intermediate germplasm in wheat breeding, the Oligo-pTh1 probe can assist in identifying the structural variation of chromosomes in a wheat background, the identification accuracy of exogenous chromosomes can be obviously improved, and high-quality new wheat germplasm can be conveniently cultured.
Description
Technical Field
The invention relates to an oligonucleotide probe developed by using a long spike elytrigia repens specific sequence, belonging to the field of cell biology.
Technical Field
Wheat is one of three major food crops, and provides more than 20% of the world population with required energy and protein. However, with the annual increase of the total population of the world, the arable area is reduced, the global climate change is added, the wheat planting area is reduced year by year, and the parent utilization in breeding is single, so that a breakthrough variety is lacked. In the face of the current situation of wheat breeding, enriching and expanding the genetic basis of wheat is very important for the wheat genetic breeding work. Practice proves that the wheat kindred wild species carry a plurality of excellent agronomic traits, and the excellent genes are introduced into common wheat, so that the genetic basis of the wheat can be widened, and the method is one of the common approaches in the research of wheat genetic breeding.
The elytrigia elongata is a closely-related wild species of wheat, has the characteristic of high resistance to gibberellic disease, is an excellent gene resource for genetic improvement of wheat, and is widely applied to genetic and breeding work of wheat. Usually, the desired chromosome fragment is introduced into a cultivar by chromosome engineering. Therefore, how to accurately identify the elytrigia elongata chromosome is the basis for obtaining excellent germplasm. At present, the most common method for identifying the chromosome identity of elytrigia elongata is FISH molecular karyotype. In recent years, with the continuous progress of in situ hybridization technology, oligonucleotide probes have been widely used in the identification of foreign chromosomes. Compared with a plasmid probe, the oligonucleotide probe has the advantages of shorter hybridization time, high identification efficiency, good experimental result repeatability, low cost and the like. At present, oligonucleotide probes Oligo-pSc119.2, Oligo-pAs1 and the like are widely applied to wheat, have rich signals and can be used for FISH karyotype analysis. However, the probes are not from sequences specific to the elytrigia elongata, and the karyotype of the chromosome to be analyzed is relatively limited. Therefore, in order to enrich the FISH karyotype of the elytrigia elongata chromosome, the invention discloses an oligonucleotide probe developed by utilizing the specific sequence of the elytrigia elongata.
Disclosure of Invention
The invention aims to overcome the defects of the prior art and provides an oligonucleotide probe developed by using a long spike elytrigia repens specific sequence.
The purpose of the invention is realized as follows: an oligonucleotide probe developed by utilizing a specific sequence of elytrigia elongata is characterized by comprising the following steps:
(1) extracting the DNA of the elytrigia elongata to obtain a DNA sample, and completing the preparation of the whole library by the DNA sample, wherein the steps of completing the preparation of the whole library comprise enzyme digestion, sequencing joint addition, purification and PCR amplification; sequencing the constructed library by an Illumina sequencer, and performing quality control analysis on the obtained original sequence to obtain a high-quality sequence;
(2) randomly selecting the obtained high-quality sequence by using a Seqtk program, wherein the selected sequence is 0.25 times of the sequencing depth;
(3) integrating the selected sequence by utilizing a prepressing of FASTQ Pair ordered-End reads program under a repeatExplorer utility tool in a repeatExplorer website, wherein the specific parameters are Read sampling No, Quality cut: 10, Percent above cut: 95, Trim reads: Yes, Start position:1, End position:101 and Rename reads: Yes;
(4) analyzing the integrated data by utilizing a RepeatExplorer2 clustering program under a RepeatExplorer2 tool in a RepeatExplorer website;
(5) downloading the analyzed data, opening a tarean report in a file, and selecting a sequence listed in the positive assets (high confidence) in the report:
AGCCTAGTTCAAATAATTTTACACTAGAGTTGAACTAGCTCTAT, synthesizing the sequence, and carrying out TAMRA modification at the 5' end of the sequence to obtain Oligo-pTh1 probe.
Further comprising the step (6): and (3) verifying the synthesized Oligo-pTh1 probe by using a fluorescence in situ hybridization technology, observing the signal position of the Oligo-pTh1 probe in the Chinese spring elytrigia elongata additional line, and drawing a chromosome FISH karyotype chart according to a fluorescence signal.
The method for identifying the chromosome of the wheat kindred wild species is mainly FISH, namely, a repeat sequence is made into a probe, and the position condition of the repeat sequence appearing on different chromosomes is drawn into a FISH karyotype to identify the chromosome identity. However, the probe sequences commonly used at present are not derived from elytrigia elongata, and the chromosome karyotype analysis is relatively limited. Therefore, aiming at the existing technical defects, the invention provides an oligonucleotide probe developed by utilizing the long spike elytrigia repens specific sequence, and the probe can be used for enriching the FISH karyotype chart of the chromosome and is favorable for accurately identifying the chromosome with structural variation in distant hybridization germplasm.
The method is advanced and scientific, and by the oligonucleotide probe developed by using the specific sequence of the elytrigia elongata, the sequencing technology is used for obtaining the genomic sequence information of the elytrigia elongata and carrying out quality control analysis to obtain the high-quality elytrigia elongata genomic sequence; randomly selecting the obtained high-quality sequence by using a Seqtk program, wherein the selected sequence is 0.25 times of the sequencing depth; integrating the selected sequence by using a Preprocessing of FASTQ ordered-end reads program under a repeatExplorer utility tool in a repeatExplorer website; analyzing the integrated sequence by utilizing a RepeatExplorer2 clustering program under a RepeatExplorer2 tool in a RepeatExplorer website; downloading the analyzed data, opening a tarean report in a file, and selecting a sequence listed in the positive assets (high confidence) in the report: AGCCTAGTTCAAATAATTTTACACTAGAGTTGAACTAGCTCTAT, submitting the sequence to a company for synthesis, and carrying out TAMRA modification at the 5' end of the sequence to obtain an Oligo-pTh1 probe; the probe is used for verification in a Chinese spring-elytrigia elongata additional line, the position of a fluorescence signal is observed, and a chromosome FISH karyotype chart is drawn.
The invention has the beneficial effects that: the obtained Oligo-pTh1 probe sequence is from elytrigia elongata, is different from the current commonly used probes, has stable hybridization signals and rich positions, can enrich the chromosome FISH karyotype chart when being combined with other probes, not only can accurately identify the chromosome identity, but also can provide an identification mode for the evolutionary relationship among species.
In conclusion, the invention discloses an oligonucleotide probe developed by utilizing a long spike elytrigia repens specific sequence, which is mainly used for obtaining a highly repetitive sequence in the long spike elytrigia repens by means of genome sequencing and is designed into an oligonucleotide probe Oligo-pTh1, and the oligonucleotide probe can be combined with other probes in an experiment to be used, so that a chromosome FISH karyotype diagram can be enriched and is used for identifying the structural variation of chromosomes in distant hybridization germplasm.
The wheat distant hybrid material is often used as an intermediate germplasm in wheat breeding, the Oligo-pTh1 probe can assist in identifying the structural variation of chromosomes in a wheat background, the identification accuracy of exogenous chromosomes can be obviously improved, and high-quality new wheat germplasm can be conveniently cultured.
Drawings
FIG. 1 shows the result of fluorescence in situ hybridization of an addition line of Chinese spring-thinopyrum elongatum;
in the figure:
a to G: adding DA1E-DA7E to Chinese spring-elytrigia elongata;
A1-G1: chromosomes following the DAPI chromosome;
A2-G2: fluorescence signal of Oligo-probe Oligo-pTh 1;
A3-G3: fluorescence signal of Oligo-probe Oligo-pTh 2;
A4-G4: fluorescence signals of the combination of Oligo-probes Oligo-pTh1 and Oligo-pTh 2.
Detailed Description
The invention is further illustrated by the following examples.
Example 1
In order to verify the feasibility of the oligonucleotide probe Oligo-pTh1 and determine the fluorescence signal intensity, the combination of Oligo-pTh1 and Oligo-pTh2 is used for carrying out a fluorescence in situ hybridization experiment on the Chinese spring thinopyrum elongatum additional line, and the specific operation is as follows:
(1) sending the sequences of Oligo-pTh1 and Oligo-pTh2 to companies for synthesis, and performing TAMRA and FAM modification at the 5' end of the sequences respectively;
(2) diluting the synthesized probe according to the concentration requirement, preparing a hybridization solution according to the system in the table 1, placing the prepared hybridization solution in a metal bath at 103 ℃ for denaturation for 13min, immediately placing the hybridization solution in alcohol precooled at-20 ℃ after the denaturation is finished, and placing the hybridization solution in a refrigerator at-20 ℃;
(3) putting the prepared chromosome sheet of the Chinese spring-elytrigia elongata additional line in 70% alcohol solution of 0.15mol/L NaOH for denaturation for 5 min; dehydrating in 70%, 90% and 100% ethanol for 5min each time after tabletting and denaturation, and blow-drying;
(4) adding 40 μ L hybridization solution to each denatured slide, covering with a cover slip, and placing in a 37 deg.C incubator for more than 6h (or hybridizing overnight);
(5) eluting hybridized slices in 1 × PBS for 3 times at room temperature for 5min each time, and drying after elution;
(6) mu.L of DAPI (VECTOR, H-1200) was added to the blow-dried plate, covered with a cover slip and counterstained for 10min, observed under a Nikon (Ni-U) fluorescence microscope, and photographed with a Nikon DS-Qi1 Mc.
(7) Photographs taken were processed with Photoshop and synthesized with NIS-Elements D4.30.00 for analysis of the signal of Oligo-pTh1 probe on chromosome. As is clear from FIG. 1, the Oligo-pTh1 probe has a distinct fluorescence signal on a chromosome, and combined with the fluorescence signals of other probes, the FISH karyotype of each chromosome can be mapped, and structural variations of the chromosome can also be identified.
The above experimental results show that the oligonucleotide probe Oligo-pTh1 can generate fluorescent signals on chromosomes of distant hybridization germplasm, and can be used for drawing a FISH karyotype chart of the chromosomes and analyzing the variation of the chromosome structure.
TABLE 1 fluorescent in situ hybridization solution System
The sequences used
Sequence listing
<110> Yangzhou university
<120> oligonucleotide probe developed by utilizing long spike elytrigia repens specific sequence
<160> 2
<170> SIPOSequenceListing 1.0
<210> 1
<211> 44
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
agcctagttc aaataatttt acactagagt tgaactagct ctat 44
<210> 2
<211> 53
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
caggactgca gctaagcccc cgagtgagag ggttgctcat cactcggtag gat 53
Claims (2)
1. An oligonucleotide probe developed by utilizing a long spike elytrigia repens specific sequence is characterized by comprising the following steps during preparation:
(1) extracting the DNA of the elytrigia elongata to obtain a DNA sample, and completing the preparation of the whole library by the DNA sample, wherein the steps of completing the preparation of the whole library comprise enzyme digestion, sequencing joint addition, purification and PCR amplification; sequencing the constructed library by an Illumina sequencer, and performing quality control analysis on the obtained original sequence to obtain a high-quality sequence;
(2) randomly selecting the obtained high-quality sequence by using a Seqtk program, wherein the selected sequence is 0.25 times of the sequencing depth;
(3) integrating the selected sequence by utilizing a prepressing of FASTQ Pair ordered-End reads program under a repeatExplorer utility tool in a repeatExplorer website, wherein the specific parameters are Read sampling No, Quality cut: 10, Percent above cut: 95, Trim reads: Yes, Start position:1, End position:101 and Rename reads: Yes;
(4) analyzing the integrated data by utilizing a RepeatExplorer2 clustering program under a RepeatExplorer2 tool in a RepeatExplorer website;
(5) downloading the analyzed data, opening a tarean report in a file, and selecting a sequence listed in the positive assets (high confidence) in the report: AGCCTAGTTCAAATAATTTTACACTAGAGTTGAACTAGCTCTAT, synthesizing the sequence, and carrying out TAMRA modification at the 5' end of the sequence to obtain Oligo-pTh1 probe.
2. The oligonucleotide probe developed by using the specific sequence of elytrigia elongata according to claim 1, further comprising the step (6):
and (3) verifying the synthesized Oligo-pTh1 probe by using a fluorescence in situ hybridization technology, observing the signal position of the Oligo-pTh1 probe in the Chinese spring elytrigia elongata additional line, and drawing a chromosome FISH karyotype chart according to a fluorescence signal.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110999089.7A CN113718016A (en) | 2021-08-28 | 2021-08-28 | Oligonucleotide probe developed by utilizing elytrigia elongata specific sequence |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110999089.7A CN113718016A (en) | 2021-08-28 | 2021-08-28 | Oligonucleotide probe developed by utilizing elytrigia elongata specific sequence |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN113718016A true CN113718016A (en) | 2021-11-30 |
Family
ID=78678746
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110999089.7A Pending CN113718016A (en) | 2021-08-28 | 2021-08-28 | Oligonucleotide probe developed by utilizing elytrigia elongata specific sequence |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113718016A (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566876A (en) * | 2016-10-13 | 2017-04-19 | 四川农业大学 | Oligonucleotide probe and acquisition method thereof |
| CN106987590A (en) * | 2017-05-25 | 2017-07-28 | 河南省农业科学院 | One cultivates peanut oligonucleotide probe and its design method and application method |
| CN110747287A (en) * | 2019-09-29 | 2020-02-04 | 南京农业大学 | Haynaldia villosa chromosome specific oligonucleotide probe and application thereof |
-
2021
- 2021-08-28 CN CN202110999089.7A patent/CN113718016A/en active Pending
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN106566876A (en) * | 2016-10-13 | 2017-04-19 | 四川农业大学 | Oligonucleotide probe and acquisition method thereof |
| CN106987590A (en) * | 2017-05-25 | 2017-07-28 | 河南省农业科学院 | One cultivates peanut oligonucleotide probe and its design method and application method |
| CN110747287A (en) * | 2019-09-29 | 2020-02-04 | 南京农业大学 | Haynaldia villosa chromosome specific oligonucleotide probe and application thereof |
Non-Patent Citations (1)
| Title |
|---|
| 郎涛: "小麦及其近缘物种串联重复序列的全基因组发掘与染色体区段鉴定", 中国博士学位论文全文数据库 农业科技辑, no. 1 * |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN106947827B (en) | Bighead carp gender specific molecular marker, screening method and application thereof | |
| CN106987590B (en) | Peanut oligonucleotide probe and design method and use method thereof | |
| CN107619857B (en) | Method for detecting CNV (CNV) marker of beef cattle KLF8 gene and application of CNV marker | |
| CN108004331B (en) | Molecular marker for identifying Beijing duck and application thereof | |
| CN107760789B (en) | Genotyping detection kit for parent-child identification and individual identification of yaks | |
| CN112458200B (en) | InDel molecular marker closely linked with cucumber fruit spine base size gene and application thereof | |
| WO2023001211A1 (en) | Gene chip, molecular probe combination and kit for analyzing traits of sheep wool, and use | |
| CN109337997B (en) | Camellia polymorphism chloroplast genome microsatellite molecular marker primer and method for screening and discriminating kindred species | |
| CN106434646B (en) | 4 pairs of EST-SSR primers and preparation method and its application in cherry platymiscium fingerprint map construction | |
| CN111926098B (en) | InDel molecular marker closely linked with epistatic gene Y of eggplant fruit color and application | |
| CN114891894A (en) | SSR molecular marker primer group for identifying Guangxi \/28064;, Zhongdao leopard gill and acantho salmoides protospecies and application thereof | |
| KR100753676B1 (en) | TRIM-Br1 and TRIM-Br2 DNA marker system using the same and classification method using the same | |
| CN113151567B (en) | SSR molecular marker and method for identifying Lepista sordida N006# strain | |
| CN109706231B (en) | High-throughput SNP (single nucleotide polymorphism) typing method for molecular breeding of litopenaeus vannamei | |
| CN112852989A (en) | SNP locus combination related to soybean agronomic traits, liquid phase gene chip and application | |
| CN112094921A (en) | Molecular marker for identifying silky fowl and bamboo silky fowl and application thereof | |
| CN111808983A (en) | Rubber tree variety standard DNA fingerprint spectrum library and construction method and special primer thereof | |
| CN113718016A (en) | Oligonucleotide probe developed by utilizing elytrigia elongata specific sequence | |
| CN113278711B (en) | Gene chip, molecular probe combination, kit and application for sheep germplasm resource identification and pedigree reconstruction | |
| CN115927731A (en) | SNP (Single nucleotide polymorphism) site combination for constructing litchi SNP fingerprint, application and identification method | |
| CN113151501A (en) | Method for auxiliary detection of growth traits of cattle WBP1L gene CNV marker and application thereof | |
| CN103605913A (en) | Method applied to identification of pacific oyster family | |
| CN113652495A (en) | Kiwi sex molecular marker primers based on fluorescence capillary electrophoresis and application thereof | |
| CN110305974B (en) | PCR analysis primer for distinguishing common mouse inbred lines based on detection of five SNP loci and analysis method thereof | |
| CN113481303A (en) | Method for auxiliary detection of growth traits of cattle ACTR3 gene CNV marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination |