CN113717858A

CN113717858A - Gold whip algae containing AIF1 cell factor antibody and preparation method and application thereof

Info

Publication number: CN113717858A
Application number: CN202110911254.9A
Authority: CN
Inventors: 吴信忠; 蔡小辉
Original assignee: Individual
Current assignee: Individual
Priority date: 2021-08-10
Filing date: 2021-08-10
Publication date: 2021-11-30

Abstract

The invention belongs to the technical field of biology, and relates to golden whip algae containing AIF1 cytokine antibody, and a preparation method and application thereof. The invention adopts a purified ostrea rivularis AIF1 cytokine antibody protein product to mark FITC fluorescent marker, takes pVEC transmembrane peptide as a carrier to introduce AIF1 cytokine antibody protein molecules into dinoflagellate, and carries out incubation of dinoflagellate with AIF1 cytokine antibody under the dark condition at room temperature, thereby obtaining the dinoflagellate species containing AIF1 cytokine antibody molecular substance components. Antibody molecular immunofluorescence labeling biology technology and laser confocal microscope detection are adopted to verify protein components and contents of oyster AIF1 cytokine antibodies in the chrysophyceae.

Description

Gold whip algae containing AIF1 cell factor antibody and preparation method and application thereof

Technical Field

The invention belongs to the technical field of biology, and relates to golden whip algae containing AIF1 cytokine antibody, and a preparation method and application thereof.

Background

China is a world aquaculture large country, the total output is continuously positioned at the first position of the world for many years, but as the aquaculture scale of China is continuously enlarged, the aquaculture water environment is worsened year by year, diseases are seriously outbreak, and according to the green book for disease and pest control issued by the Chinese science co-ordination, the average annual loss of the diseases of the aquaculture of China is over one hundred million yuan. Meanwhile, the long-term unscientific abuse of fishery drugs leads the drug resistance of pathogenic microorganisms to be continuously enhanced, the problem of overproof drug residue and the like to be increasingly prominent, which also becomes an important problem of the safety and health of diet products of people in China. The serious high incidence of the diseases and the abuse of chemical drugs and antibiotics seriously hinder the development of the aquaculture industry in China, and the reasonable and effective prevention and control of the aquatic animal diseases become the core problem of the sustainable and healthy development of the aquaculture industry in China.

Our previous studies of AIF1 against the gram-negative bacterial component LPS and Rickettsial (RLO) infection showed that: oyster AIF1(Ca-AIF1) polyclonal rabbit antiserum can obviously inhibit the expression of inflammation-related factor LITAF caused by the stimulation of rickettsia-like organism (RLO) and LPS (LPS + anti-Ca-AIF1 is reduced by 70.95%, 84.18%, 39.49% and 87.53% in 1.5-12 hours, respectively), and RLO + anti-Ca-AIF1 is reduced by 88.57%, 84.80%, 59.36% and 59.16% in 1.5-12 hours, respectively), so that the Ca-AIF1 polyclonal antiserum has the effect of effectively inhibiting the inflammatory response caused by RLO infection and gram-negative bacteria. For another example, the Ca-AIF1 antiserum can obviously inhibit RLO infection and cell apoptosis and cell necrosis caused by gram-negative bacteria and obviously increase the cell survival rate, and the number of the living cells of the RLO + anti-Ca-AIF1 experimental group and the number of the living cells of the LPS + anti-Ca-AIF1 experimental group are respectively increased by 51 percent and 49 percent; while the late apoptotic cell rate decreased by about 50% and 18%, respectively.

Disclosure of Invention

Aiming at the defects in the prior art, the invention provides the application of immune disease-resistant bait for domesticating and culturing golden whip algae and shellfish and fish and shrimp diseases by AIF1 cytokine antibody for anti-infection prevention and control.

A gold whip algae containing AIF1 cytokine antibody is provided.

A preparation method of dinoflagellate containing AIF1 cytokine antibody comprises the steps of adopting a purified ostrea rivularis AIF1 cytokine antibody protein product to mark an FITC fluorescent marker, introducing AIF1 cytokine antibody protein molecules into dinoflagellate by taking pVEC transmembrane peptide as a carrier, and incubating the dinoflagellate with AIF1 cytokine antibody under the dark condition at room temperature, so as to obtain the dinoflagellate containing AIF1 cytokine antibody.

The preparation of the AIF1 cytokine antibody comprises the following steps:

1) taking total RNA of crassostrea rivularis blood lymphocytes as a template, carrying out reverse transcription to obtain a chain cDNA, and cloning to obtain a coding frame nucleotide sequence of an AIF1 gene;

2) cloning the sequence fragment of the coding frame of the AIF1 gene into a pMD19-T vector, carrying out restriction enzyme digestion, and connecting the sequence fragment with a pET-32(a) prokaryotic expression vector subjected to the same enzyme digestion to obtain a recombinant expression plasmid pET-32(a) -AIF 1;

3) positive recombinant plasmid PET-32(a) -AIF1 is transformed into expression host bacterium E.coli Rossetta (DE3), isopropyl thiogalactoside (IPTG) is induced to express, and SDS-polyacrylamide gel electrophoresis (SDS-PAGE) is used for detection;

4) carrying out amplification culture on the positive expression bacterial liquid, and separating and purifying the recombinant protein by using a protein purification kit;

5) the purified AIF1 protein was injected into New Zealand white rabbits at multiple sites to prepare purified polyclonal antibodies.

Wherein, the step of introducing the AIF1 cytokine antibody protein molecule into the golden whiplash algae comprises the following steps:

1) AIF1 cytokine antibody purification and green fluorescence labeling

Purifying with Protein A Sepharose affinity chromatography column to obtain antiserum total IgG; labeling purified AIF1 polyclonal antibody with NHS-Fluorescein (Pierce, USA);

2) dinoflagellate culture and growth curve drawing

The golden whip algae adopts culture solution based on natural seawater for subculture, and sterile golden whip algae is subjected to subculture according to the ratio of 1: inoculating 10 proportion of the mixture into a fresh culture medium, and culturing under the following conditions: the temperature is 23 ℃, the illumination intensity is 3000lx, the light-dark period ratio is 12 h: 12 h; sampling algae under aseptic condition every 24h, measuring light absorption value at 660nm on an enzyme labeling instrument, drawing a golden whip algae growth curve, and executing 3 biological repetitions at each time point;

3) introduction of AIF1 cytokine antibody into Verbena sp

Collecting and centrifuging dinoflagellate in logarithmic growth phase, washing dinoflagellate with sterile PBS for 3 times, and adjusting concentration to 10 by counting under microscope using cell counting plate⁶cell/mL, centrifuging and removing supernatant; 100 μ l of AIF1 antibody at a final concentration of 100 μ g/ml was mixed with pVEC at a final concentration of 20 μ M and added to the algal pellet to give a concentration of 10⁶cell/mL; incubating in a dark room at room temperature, respectively incubating for 15min, sampling and placing on a glass slide at 30min, observing and photographing 50% glycerol sealing sheets under a confocal microscope, and setting 3 biological replicates for each experiment.

Preferably, the protein components and the content of oyster AIF1 cytokine antibody in the chrysophyceae are detected and verified by a laser confocal microscope.

In addition, the invention provides application of the golden whip algae containing the AIF1 cytokine antibody in preparing immune disease-resistant bait for preventing and treating fish and shrimp diseases.

The application is to prepare immune feed for resisting gram-negative bacteria and rickettsia-like organism (RLO) infection.

The invention also provides a bait comprising the dinoflagellate containing the AIF1 cytokine antibody of claim 1.

The invention adopts a purified ostrea rivularis AIF1 cytokine antibody protein product to mark FITC fluorescent mark, takes pVEC transmembrane peptide as a carrier to introduce AIF1 cytokine antibody protein molecules into dinoflagellate (for remark: the dinoflagellate is a main alga for breeding oyster larvae and fish and shrimp baits), and carries out the incubation of the dinoflagellate with AIF1 cytokine antibody under the dark condition at room temperature, thereby obtaining the dinoflagellate species containing AIF1 cytokine antibody molecular substance components. Antibody molecular immunofluorescence labeling biology technology and laser confocal microscope detection are adopted to verify protein components and contents of oyster AIF1 cytokine antibodies in the chrysophyceae. The invention has the following characteristics:

1. the oyster proinflammatory cytokine AIF1 protein is prepared and purified by adopting a gene cloning technology.

2. AIF1 antibody protein molecules (or preparations) against gram-negative bacteria and Rickettsial (RLO) disease were prepared and purified.

3. The research of introducing the AIF1 cytokine antibody molecule into dinoflagellate and the domestication and mixed culture of the dinoflagellate are carried out by adopting the purified antibody protein molecule (or product) of the AIF1 cytokine of the ostrea rivularis.

4. Detecting and verifying the protein components and the content of the ostrea rivularis AIF1 cytokine antibody in the chrysopharia body by adopting a molecular biology technology (comprising a molecular immunology technology, a protein separation and purification technology, an antibody molecular immunofluorescence labeling biology technology, a laser confocal microscope and the like).

The invention has the beneficial effects that:

the invention obtains the technology of introducing the AIF1 cell factor antibody protein molecule into the golden whip algae; domesticating cultured Verbena sp species containing oyster AIF1 cytokine antibody; the obtained gold whip algae containing crassostrea rivularis AIF1 cytokine antibody domesticated and cultured is used for preparing immune bait for resisting gram-negative bacteria and rickettsia-like organism (RLO) infection and the technology thereof.

Drawings

Figure 1AIF1 antibody titers were detected where 1A: ELISA method, 1B: western Blot.

Figure 2 confocal assay AIF1 cytokine introduction into dinoflagellates, where 2A: FITC-labeled AIF antibody; 2B: pVEC incubated FITC antibody for 15 min; 2C: pVEC incubated FITC antibody for 30 min.

FIG. 3 is a schematic diagram of the mechanism of the cell-penetrating peptide pVEC mediated entry of AIF1 antibody into Verbena virginiana.

Detailed Description

The method comprises the following implementation steps:

firstly, preparing and purifying oyster proinflammatory cytokine AIF1 protein and preparation of cytokine antibody thereof by adopting gene cloning technology

1. Taking total RNA of crassostrea rivularis blood lymphocytes as a template, carrying out reverse transcription to obtain a chain cDNA, and cloning to obtain a coding frame nucleotide sequence of the AIF1 gene.

2. The sequence fragment of the coding frame of the AIF1 gene was cloned into pMD19-T vector (Takara, Japan), digested with restriction enzymes, and ligated with pET-32(a) prokaryotic expression vector (Novagen, USA) digested with the same enzymes, to obtain recombinant expression plasmid pET-32(a) -AIF 1.

3. The positive recombinant plasmid PET-32(a) -AIF1 was transformed into expression host bacterium E.coli Rossetta (DE3) (all-purpose gold, China), isopropyl thiogalactoside (IPTG) (Sangon, Canada) for inducible expression, and detected by SDS-polyacrylamide gel electrophoresis (SDS-PAGE).

4. And (3) carrying out amplification culture on the positive expression bacterial liquid, and separating and purifying the recombinant protein by using a protein purification kit.

5. The purified AIF1 protein was injected into New Zealand white rabbits at multiple sites to prepare purified polyclonal antibodies.

The specific operation steps are as follows:

1. crassostrea rivularis blood lymphocyte RNA extraction and cDNA one-strand amplification

Extracting total RNA of Concha Ostreae blood lymphocyte, and using

One-Step gDNA Removal and cDNA Synthesis SuperMix (all-type gold, China) were reverse transcribed into cDNA single strand.

2. Obtaining full-length sequence of crassostrea rivularis AIF1 coding frame nucleotide

Specific primers were designed based on the AIF1(HM749971.1) gene sequences in NCBI databases (AIF 1F: CGCGGATCCATGTCGGTGGACTTCAAAG, AIF 1R: CCGCTGGAGTGGCAGATCGGAGAGGGATTTC,cleavage site moiety Is otherwise provided withBamHI and XhoI), using Hi-Fi enzyme(s) ((II)

HS DNA Polymerase, TaKaRa, japan) clone AIF1 full-length coding sequence. The reaction conditions are as follows: pre-denaturation at 94 ℃ for 5min, 35 cycles (denaturation at 94 ℃ for 30s, annealing at 55 ℃ for 30s, extension at 72 ℃ for 30s), extension at 72 ℃ for 10 sAnd (5) min. PCR amplification was performed with the PMD-19T vector, E.coli DH 5. alpha. (Takara, Japan) was transformed, and several clones were selected for PCR identification and further sequencing identification.

3. Construction of PET-32(a) -AIF1 expression vector

The positive clones identified in step 2 were amplified to extract plasmids, which were digested with BamHI and XhoI restriction enzymes (Takara, Japan) and ligated to the corresponding sites of the pET-32a vector digested with the same restriction enzymes, and transformed into E.coli DH5 α (Tiangen, China). Positive clones were PCR-screened and sequenced to obtain the expression vector pET-32(a) -AIF1 with correct coding frame.

4. Expression of recombinant proteins

Amplifying and culturing the positive clone identified in the step 3 to extract a recombinant plasmid pET-32(a) -AIF1, transforming the recombinant plasmid into expression host bacterium E.coli Rosseta (DE3) competence, and screening positive clones by using colony PCR. The positive bacteria are enlarged and cultured to OD according to the ratio of 1:100₆₀₀When the concentration is 0.4-0.5, adding IPTG with the final concentration of 1mmol/L, continuing to culture for 4 hours, and centrifuging to collect host bacteria. The bacteria were sonicated (300W, 20min, 2s sonication, 3s intervals) and the supernatant and pellet were centrifuged and subjected to SDS-PAGE.

5. Purification and quantification of recombinant proteins

And (3) carrying out amplification culture on the positive expression bacteria, carrying out ultrasonic treatment according to the step 4, separating and purifying an expression product by using a Ni-NTA affinity chromatography column (full-scale gold, China), and carrying out electrophoretic identification by adopting 12% SDS-PAGE.

The purified protein was quantified using a Bradford protein quantification kit (Tiangen Biochemical technology Co., Ltd., China).

6. preparation of pET32a-AIF1 polyclonal Rabbit antiserum

After protein quantification, a proper amount of protein is taken, 2 healthy New Zealand white rabbits (male rabbits) weighing about 2kg are selected for polyclonal antibody preparation, purified pET32a-AIF1 is used as an antigen, an adjuvant with the same volume is added into the antigen for full emulsification, and then the rabbits are immunized by adopting multi-point back subcutaneous injection for four times.

(1) Before immunization, 3-5ml of normal serum was collected from the ear vein as a negative control in the detection of antibodies.

(2) Shearing off rabbit hair on the back of the rabbit with scissors, and performing subcutaneous multipoint injection on the back after alcohol disinfection.

(3) Primary immunization: taking about 500 mu g of antigen, adding equal volume of complete Freund's adjuvant, fully emulsifying and injecting, selecting 8-10 points on the back, and injecting about 0.1ml of antigen per point;

(4) and (3) second immunization: after the interval of 14 days, the antigen amount is 500 mug, and the same volume of incomplete Freund's adjuvant is added for full emulsification and injection, and the method is the same as the above;

(5) third and fourth immunizations: after the interval of 14 days, the same method is carried out, after the fourth immunization, 1ml of blood is collected from the ear vein, serum is separated, the antibody titer of the immune serum is detected by a two-phase agar diffusion method, and the blood can be discharged only when the titer reaches more than 1: 16;

(6) separating serum: and 7d after the fourth immunization, collecting blood from carotid artery and separating serum after the antibody titer meets the requirement. Subpackaging and storing at-80 deg.C.

7. AIF1 cytokine polyclonal antibody titer assay

7.1ELISA (enzyme-linked immunosorbent assay) method for detection

The method for measuring the specific antibody titer of AIF1 in the immune rabbit serum by using an indirect ELISA method comprises the following specific steps:

(1) antigen coating: diluting the antigen to 1-10 mu g/ml by using a coating buffer solution, adding the diluted antigen into an ELISA plate according to 100 mu l/hole, covering a membrane, and standing at 4 ℃ overnight.

(2) Washing: taking out the enzyme label plate the next day, pouring out the liquid in the hole, and placing the plate on paper for drying; TTBS was added at 300. mu.l/well, left at room temperature for 3min, shaken dry, and washed 3 times in total.

(3) And (3) sealing: add blocking solution 200. mu.l/well to the ELISA plate, cover the membrane, and block at 37 ℃ for 1 h.

(4) And (3) storage: pouring off the sealing liquid without beating, putting the sealed enzyme label plate into a self-sealing bag, and storing at-20 ℃ for later use. (note: making antigen marks on the ELISA plate; holding the ELISA plate with gloves.)

(5) Primary antibody incubation: diluting primary antibody with blocking solution, setting blank control (blocking solution) and negative control (non-immune blood supernatant) at a dilution gradient of 1:1000, 1:3000,1:9000,1:27000,1:81000 and 1:243000, and mixing the two solutions in the gradient dilution process; after dilution, 100. mu.l of primary anti-dilution solution is added into the ELISA plate, and incubation is carried out for 1h at 37 ℃.

(6) After incubation, the primary antibody was removed, and TTBS was added thereto at 300. mu.l/well, and the mixture was allowed to stand at room temperature for 3min and washed 3 times in total.

(7) And (3) secondary antibody incubation: the secondary antibody (1: 1000) was diluted with blocking solution, and after washing, 100. mu.l/well of the secondary antibody dilution was added and incubated at 37 ℃ for 1 h.

(8) After the incubation, the cells were washed with TTBS at a concentration of 300. mu.l/well for 3min each time, and then rinsed dry for 4 times.

(9) Washing, placing the enzyme label plate in a dark room, adding 150 mu l/hole TMB, adding 50 mu l/hole 2M H after gradient blue appears₂SO4, terminating the reaction. (Note: it is convenient to observe the color change, a piece of white paper can be arranged under the enzyme label plate, the sequence of adding TMB and adding H should be added₂SO4, in consistent order. )

(10) And (4) placing the ELISA plate in an ELISA reader to detect the absorbance of 450 nm.

(11) And (5) storing data, photographing the ELISA plate and data printing paper, and recording.

7.2Western Blot (immunoblot) method of detection

The antibody titer was determined by diluting AIF1 polyclonal rabbit antiserum at a certain ratio, according to the method of Sambrook et al (Sambrook J, Russell D W. molecular Cloning: A Laboratory Manual,3rd ed. New York: Cold Spring Harbor Laboratory Press,2001), as follows:

(1) SDS-PAGE electrophoresis: starting 90V electrophoresis, and adjusting the voltage to 150V after running under the concentrated gel until the electrophoresis is finished. (Note: Point Predyeing Marker)

(2) Film shearing: and (3) cutting the PVDF membrane with the same size as the glue, marking the hole order and the Marker position, activating for 1-2min by using methanol, then putting the PVDF membrane into a membrane transfer Buffer, and putting two pieces of filter paper and a transfer clamp into the Buffer together. (Note: Buffer box closed to avoid methanol volatilization)

(3) Film transfer: after the electrophoresis is finished, the gel is carefully taken down, the agarose gel and the concentrated gel are cut off, then the gel is placed in a Buffer, a transfer clamp is opened (the black surface faces downwards), a piece of wet filter paper is placed firstly, the gel is placed on the filter paper, then the membrane is covered on the gel, then another piece of filter paper is covered, and finally the transfer clamp is covered and placed in the Buffer for clamping. The transfer tank is installed, and electrophoresis is carried out in ice-water bath for 2 hours under a constant current of 180 mA.

(4) And (3) sealing: pouring a part of prepared confining liquid into the plastic box, taking out the PVDF membrane after electrophoresis, activating with methanol for 1-2min, drying, placing the membrane into the plastic box, and sealing the plastic box on a shaking table at 37 ℃ for 1 h.

(5) And (3) incubation: taking 1ml of the sealing solution by using a 1.5ml centrifuge tube, adding corresponding primary antibody and secondary antibody (generally 1 mu l of each primary antibody and secondary antibody, specifically according to the antibody titer), fully and uniformly mixing, placing the membrane in a plastic bag, adding the antibody diluent, sealing, and placing on a shaking bed for incubation at 37 ℃ for 1 h. (Note: PVDF membrane is in a wet state as always as possible)

(6) Washing: after incubation, the membranes were put into a plastic box and an appropriate amount of TTBS solution (submerged membrane) was added and washed on a shaker for 3 times, 10min each.

(7) Gel imaging system exposure: preparing color developing solution, wherein each film needs 200 mul of solution A and solution B (used in preparation), sucking water of the PVDF film, then uniformly adding the color developing solution on the PVDF film, putting the PVDF film into an imaging instrument, and setting exposure time to develop strips.

Second, the AIF1 cytokine antibody protein molecule is introduced into gold whip algae

Purification and green fluorescence labeling of AIF1 cytokine antibody

1.1AIF1 cytokine polyclonal antibody purification

The total IgG of the antiserum was purified by Protein A Sepharose affinity column (Solebao, China) according to the protocol. The specific method comprises the following steps: binding buffer (0.15M NaCl, 20mM Na) was used₂HPO₄pH 7.0), loading onto a chromatographic column, sequentially washing with about 10 column volumes of Binding buffer (pH 7.0) to remove impurities, desorbing with elution buffer (100mmol/L glycine, pH3.0) and collecting protein, which is 1.0mol/L T immediatelyris-HCl (pH 8.0) neutralization and storage at-20 ℃.

1.2 fluorescent labeling of purified AIF1 cytokine polyclonal antibody

The purified AIF1 polyclonal antibody was labeled with NHS-Fluorescein (Pierce, USA) as follows: 1ml of purified AIF1 polyclonal antibody with a concentration of 7.88mg/ml was transferred to a 1.5ml sterile centrifuge tube, and 37. mu.l of NHS-Fluorescein fluorescent solution with a concentration of 10mg/ml was added and reacted at 4 ℃ for 24 hours. After the reaction, the reaction product was put into a dialysis bag (Viskease, USA) and dialyzed in 1L PBS (4 degrees), unbound fluorescein was removed, the dialysate was changed for 3 times, and the coupling product was taken out after dialysis was completed (the dialysate outside the dialysis solution was a transparent colorless solution). After dilution by 5 times, absorbance values of A280 and A493 are respectively measured to detect the concentration of the labeled protein and the fluorescence labeling rate.

2. Dinoflagellate culture and growth curve drawing

The Verbena virens used in the experiment is given by Guangxi Zhuang autonomous region Marine research institute, and adopts optimized culture solution (60mg/L NaNO, 4mg/L KH2PO4, 0.5 mg/LFeC) based on natural seawater₆H₅O₇1.0g/L NaI-ICO, 150. mu.g/L vitamin B₁200ng/L vitamin B₁₂) Subculturing, and carrying out subculturing on sterile golden whiplash according to the weight ratio of 1: inoculating 10 proportion of the mixture into a fresh culture medium, and culturing under the following conditions: the temperature is 23 ℃, the illumination intensity is 3000lx, the light-dark period ratio is 12 h: and (4) 12 h. And (3) sampling algae under the aseptic condition every 24h, measuring the light absorption value at 660nm on an enzyme labeling instrument, drawing a chrysophyceae growth curve, and performing 3 biological repetitions at each time point.

Introduction of AIF1 cytokine antibody into Verbena sp

4. Collecting and centrifuging Hemicentrotus Auricularia in logarithmic growth phase (400 Xg, 10min), washing Hemicentrotus Auricularia 3 times with sterile PBS, and adjusting the concentration to 10 by counting under microscope using cell counting plate⁶cell/mL, and centrifuging to remove the supernatant. 100 μ l of AIF1 antibody at a final concentration of 100 μ g/ml was mixed with pVEC at a final concentration of 20 μ M and added to the algal pellet to give a concentration of 10⁶cell/mL. Incubating in dark room at room temperature, respectively incubating for 15min and 30min, sampling, placing on glass slide, sealing with 50% glycerol, observing and photographing under confocal microscope, and setting each experiment3 biological replicates.

Specific examples of implementation:

1.AIF1 cytokine polyclonal antibody purification

The AIF1 polyclonal antibody was purified using Protein A Sepharose affinity column. The specific method comprises the following steps: protein A Sepharose was loaded onto a column using Binding buffer (0.15M NaCl, 20mM Na)₂HPO₄pH 7.0), the prepared rabbit anti-AIF 1 polyclonal antibody serum was adjusted to pH 7.0, loaded onto a Protein A Sepharose affinity chromatography column, washed with 10 column volumes of Binding buffer (pH 7.0), and finally eluted with 100mmol/L glycine (pH3.0) and collected in a 1.5ml centrifuge tube, and the collected Protein was immediately neutralized with 1.0mol/L Tris-HCl (pH 8.0) and stored at-20 ℃.

2. Purified AIF1 cytokine antibody titer assay

The prepared rabbit anti-AIF 1 polyclonal antibody titer is higher than 1:243000 and is detected by ELISA and Western methods (figure 1).

3.AIF1 cytokine polyclonal antibody fluorescent label

1ml of purified AIF1 polyclonal antibody with the concentration of 7.88mg/ml is transferred to a 1.5ml sterile centrifuge tube, 37. mu.l of NHS-Fluorescein fluorescent solution with the concentration of 10mg/ml is added, and the reaction is carried out for 24h at 4 ℃. After the reaction, the reaction product was put into a dialysis bag (Viskease, USA) and dialyzed in 1L PBS (4 degrees), unbound fluorescein was removed, the dialysate was changed for 3 times, and the coupling product was taken out after dialysis was completed (the dialysate outside the dialysis solution was a transparent colorless solution). After 5-fold dilution, A280-1.066 and A493-0.715 were determined, where 493nm is the specific absorption peak of FITC and the molar extinction coefficient of FITC is 70000M^-1cm^-1The molar concentration of FITC in the product was calculated to be 5.11X 10^-5M; furthermore, FITC also absorbs at 280nm, and the absorbance is 30% at 493nm, so that the absorbance of the AIF1 antibody is (1.066-0.715 × 0.3) × 5 ═ 4.26, and the molar extinction coefficient of the antibody is 210000M^-1cm^-1And calculating to obtain the product with the antibody molar concentration of 2.03 multiplied by 10^-5M, the mass concentration of the antibody is 3.04mg/ml, the FITC labeling rate is FITC: antibody 2.52: 1.

4. introduction of fluorescent-labeled AIF1 cytokine polyclonal antibody into gold whip algae

The dinoflagellates in logarithmic growth phase were collected and centrifuged (400g, 10min), washed 3 times with sterile PBS, and adjusted to a concentration of 10 using a cell counting plate⁶cell/ml. Transferring 100. mu.L of algae solution to a 1.5mL sterile centrifuge tube, centrifuging at 400g for 10min, removing supernatant, and collecting precipitate. 100 μ L PBS was taken into a 1.5mL centrifuge tube, and FITC-labeled AIF1 antibody and pVEC cell-penetrating peptide were added to give final concentrations of 100 μ g/mL and 20 μ M, respectively. The mixture is added to the algal precipitate to suspend the algae. Incubating in a dark room at room temperature, sampling and placing on a glass slide after incubating for 15min and 30min respectively, and observing and photographing a 50% glycerol seal under a confocal microscope. As can be seen from fig.2, when the fluorescently labeled AIF1 antibody was incubated with dinoflagellate for 15min, only individual dinoflagellate (autofluorescence) contained green fluorescence (FITC-labeled AIF1 antibody) (fig.2a). When the incubation time reaches 30min, a large amount of green fluorescence (FIG.2B) in the Verbena virginiana can be seen. It was shown that the polyclonal antibody to AIF1 was successfully introduced into Verbena sp. FIG. 3 is a schematic diagram of the mechanism of the cell-penetrating peptide pVEC mediated AIF1 antibody entering gold whip algae.

Finally, it should also be noted that the above list is only a few specific embodiment frameworks of the present invention. It is obvious that the present invention is not limited to the above embodiments, and all modifications directly derivable or suggested to a person skilled in the art from the present disclosure should be considered as within the scope of protection of the present invention.

Sequence listing

<110> Wu faith

<120> Verbena virens containing AIF1 cytokine antibody, preparation method and application thereof

<160> 2

<170> SIPOSequenceListing 1.0

<210> 1

<211> 28

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 1

cgcggatcca tgtcggtgga cttcaaag 28

<210> 2

<211> 31

<212> DNA

<213> Artificial Sequence (Artificial Sequence)

<400> 2

ccgctggagt ggcagatcgg agagggattt c 31

Claims

1.A gold whip algae containing AIF1 cytokine antibody is provided.

2. The method for preparing the golden dinoflagellate containing AIF1 cytokine antibody as claimed in claim 1, wherein the purified Ostrea rivularis AIF1 cytokine antibody protein product is labeled with FITC fluorescent label, pVEC transmembrane peptide is used as a carrier to introduce AIF1 cytokine antibody protein molecule into the golden dinoflagellate, and the golden dinoflagellate containing AIF1 cytokine antibody is obtained by incubating the golden dinoflagellate with AIF1 cytokine antibody under dark condition at room temperature.

3. The method of claim 2, wherein: the preparation of the AIF1 cytokine antibody comprises the following steps:

4. The method of claim 2, wherein: the introduction of the AIF1 cytokine antibody protein molecule into golden whiplash comprises the following steps:

1) AIF1 cytokine antibody purification and green fluorescence labeling

2) dinoflagellate culture and growth curve drawing

3) introduction of AIF1 cytokine antibody into Verbena sp

5. The production method according to any one of claims 2 to 4, wherein: detecting and verifying the protein components and the content of oyster AIF1 cytokine antibody in the chrysopharia body by using a laser confocal microscope.

6. Use of the golden whip algae of claim 1 containing AIF1 cytokine antibody for the preparation of immune anti-disease bait for the anti-infection control of diseases in fish and shrimp.

7. Use according to claim 6, for the preparation of an immunological bait against gram-negative bacteria and rickettsia-like organism (RLO) infections.

8. A bait which is characterized in that: a Verticillium sp comprising the AIF1 cytokine antibody of claim 1.