CN113699179B - Application of osa-miR-162a in preparation of green pesticide for repelling brown planthopper - Google Patents
Application of osa-miR-162a in preparation of green pesticide for repelling brown planthopper Download PDFInfo
- Publication number
- CN113699179B CN113699179B CN202110873455.4A CN202110873455A CN113699179B CN 113699179 B CN113699179 B CN 113699179B CN 202110873455 A CN202110873455 A CN 202110873455A CN 113699179 B CN113699179 B CN 113699179B
- Authority
- CN
- China
- Prior art keywords
- mir
- rice
- osa
- brown planthopper
- application
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8216—Methods for controlling, regulating or enhancing expression of transgenes in plant cells
- C12N15/8218—Antisense, co-suppression, viral induced gene silencing [VIGS], post-transcriptional induced gene silencing [PTGS]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8201—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation
- C12N15/8202—Methods for introducing genetic material into plant cells, e.g. DNA, RNA, stable or transient incorporation, tissue culture methods adapted for transformation by biological means, e.g. cell mediated or natural vector
- C12N15/8205—Agrobacterium mediated transformation
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8261—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield
- C12N15/8271—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance
- C12N15/8279—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance
- C12N15/8286—Phenotypically and genetically modified plants via recombinant DNA technology with agronomic (input) traits, e.g. crop yield for stress resistance, e.g. heavy metal resistance for biotic stress resistance, pathogen resistance, disease resistance for insect resistance
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Wood Science & Technology (AREA)
- Organic Chemistry (AREA)
- General Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Plant Pathology (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Cell Biology (AREA)
- Biochemistry (AREA)
- General Health & Medical Sciences (AREA)
- Virology (AREA)
- Insects & Arthropods (AREA)
- Pest Control & Pesticides (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Agricultural Chemicals And Associated Chemicals (AREA)
- Catching Or Destruction (AREA)
Abstract
The invention discloses application of osa-miR-162a in preparation of a brown planthopper repelling green pesticide. According to the application, osa-miR-162a is overexpressed in rice, and compared with a control group, the eating preference of brown planthopper is obviously reduced, the control group has obvious repellency and obvious insect resistance (brown planthopper), which shows that osa-miR-162a can obviously improve the insect resistance of rice, so that the osa-miR-162a can be applied to pest control of rice.
Description
The technical field is as follows:
the invention belongs to the technical field of biology, and particularly relates to application of osa-miR-162a in preparation of a brown planthopper repelling green pesticide.
Background art:
china is one of the most serious countries in the world where crop pests occur. Crop biological disasters occur frequently, are serious in harm and have huge loss (summer source, 2008). Rice is the most important grain crop in China and even the world, and the high yield of the rice is directly related to grain safety. Brown planthopper is the most important pest of rice, and historically, the brown planthopper is outbreaked and damaged many times. Pesticide control is a main defense means for improving the insect resistance of rice all the time, and not only causes great damage to the environment, but also continuously enhances the resistance of brown planthopper. In recent years, scientists have found that miRNA in plants can resist insect damage by regulating their growth and development, and have also found that some miRNA in plants can enter feeding insects and participate in regulating the growth and development of insects, and such miRNA is called trans-border miRNA (Zhu et al, 2017). The cross-border miRNA-mediated pest control has the advantages that the traditional miRNA cannot match, and the cross-species regulation and control of the cross-border miRNA-mediated pest control not only influences the growth and development of pests, but also influences the ontogeny of plants, namely plays a huge role in plant-pest natural interaction. In recent years, the function of cross-border mirnas in cross-species is gradually clear (Hussain et al, 2012; chi et al, 2016; Wang et al, 2018), however, the cross-border regulation and control research on plant-insects is mainly focused on silkworm, bees and other economic insects (Jia et al, 2015; Zhu et al, 2017), and the function of cross-border miRNA mediated plant-pest interaction is not clear.
In recent years, there have been many reports in the literature that miRNA cross-border regulation involves multiple borders and species (Zhou et al, 2017), and similarly, plant miRNAs can also affect insect gene expression cross-border, although the results of this study are relatively late and few. In 2015 Jia et al demonstrated via TA cloning, Sanger sequencing and microdroplet PCR that miRNAs from the genus mori could enter the haemolymph and various tissues of silkworms and excluded the possibility of experimental results from sequencing and banking contamination (Jia et al, 2015). Zhu et al in 2017 found that miR-162a in pollen influences the growth and development of bee by inhibiting the TOR gene expression of the bee, thereby promoting differentiation of adult levels (Zhu et al, 2017).
The pest control of crops and the continuous improvement of the resistance quality of crops are one of the key points of the development and attention of agriculture in the world, and the selection of effective and safe pest-resistant gene rice is inevitable in the modern agricultural development of China. Therefore, the mechanism of the plant insect resistance is described from the perspective of rice cross-border miRNA, which is helpful for finding a new rice insect resistance target.
The invention content is as follows:
the first purpose of the invention is to provide application of osa-miR-162a in preparation of green pesticides for repelling brown planthoppers.
Experiments show that the feeding preference of brown planthopper on osa-miR-162a over-expression rice is obviously reduced, and the brown planthopper has obvious repellency. Meanwhile, after the brown planthopper eats for 5 days, compared with ZH11 rice, the osa-miR-162a overexpression rice has the advantages of obvious healthy growth state and obvious insect resistance, and shows that osa-miR-162a can obviously improve the insect resistance of the rice.
Therefore, the second purpose of the invention is to provide the application of osa-miR-162a in repelling brown planthopper.
Preferably, osa-miR-162a is over-expressed in rice, so that brown planthopper can be repelled by the rice.
Preferably, a precursor gene of osa-miR-162a is cloned from rice, and then the precursor gene is transferred into an expression vector, and transgenic rice with osa-miR-162a overexpression is obtained through agrobacterium infection, so that brown planthopper is repelled by the rice.
The third purpose of the invention is to provide the application of osa-miR-162a in improving the insect resistance of rice.
Preferably, osa-miR-162a is over-expressed in rice, so that the insect resistance of rice is increased.
Preferably, the insect resistance refers to the resistance to brown planthopper.
Preferably, a precursor gene of osa-miR-162a is cloned from rice, and then the precursor gene is transferred into an expression vector, and transgenic rice with osa-miR-162a overexpression is obtained through agrobacterium infection, so that the insect resistance of the rice is increased.
According to the application, osa-miR-162a is overexpressed in rice, and compared with a control group, the eating preference of brown planthopper is obviously reduced, the control group has obvious repellency and obvious insect resistance (brown planthopper), which shows that osa-miR-162a can obviously improve the insect resistance of rice, so that the osa-miR-162a can be applied to pest control of rice.
Description of the drawings:
FIG. 1 is a graph showing the change in expression of osa-miR-162a in rice overexpressing osa-miR-162a, and ctr represents a wild-type control; 2-26 represents osa-miR-162a overexpression transgenic plants;
FIG. 2 is a statistical plot of feeding selectivity of brown planthopper on osa-miR-162a overexpressing rice;
FIG. 3 is a statistical chart of the growth of osa-miR-162a overexpressing rice before and after feeding by brown planthopper, wherein ZH11 represents wild-type rice ZH11, IR56 represents rice insect-resistant variety IR56, and 162a-OE represents osa-miR-162a overexpressing transgenic rice ZH 11.
The specific implementation mode is as follows:
the following examples are further illustrative of the present invention and are not intended to be limiting thereof.
Example 1:
1. the precursor gene sequence of osa-miR-162a is cloned from the rice genome. When designing primers, AvrII and SacI restriction enzyme sites are respectively added at both ends of the forward primer and the reverse primer of osa-miR-162a for PCR amplification.
The precursor gene sequence is as follows:
5‘-CCTAGGCACTCCCTTCCTCATTGCACACACGAGAAACACAGATTCACACCCACGAGTGTTCGTTCGTGCCCGATCTTGCAGGTGGCTCTGTGTTCCGTTCTTGTTTTGTTCCGGTTTCTTGCGCTAATCCATCATGTTCGCAGGTGGGGGTGGGGGGTTGGTGGTGATGCCTGGGCGCAGTGGTTTATCGATCCCTTCCCTGCCTTGTGGCGCTGATCCAGGAGCGGCGAATTTCTTTGAGAGGGTGTTCTTTTTTTTTCTTCCTTTTGGTCCTTGTTGCAGCCAACGACAACGCGGGAATCGATCGATAAACCTCTGCATCCAGTTCTCGCCTTTTTGTGTTCAAGGGCTTGAGGCAGTAGTACTGGCTATTGCTTCTTGCTTCTTGGCTGCTCATGGGGTGTAAACATGTTTACTACTTGTTTAGGCTTGATATATATGTTTATGTAGGATATGTCTCTTTTTAATGACATGACTATGGTGATAGAAGAGCTC-3', as shown in SEQ ID NO. 1.
Amplification primers for the precursor sequence of osa-miR-162a are as follows:
and (3) carrying out PCR amplification by taking the rice genome as a template and the amplification primer of the precursor sequence of osa-miR-162a as a primer to obtain a PCR product.
The sequence of osa-miR-162a is as follows: UCGAUAAACCUCUGCAUCCAG are provided.
2. The rice binary vector pCAMBIA13002 is connected into the rice binary vector through the restriction enzyme cutting sites of Avr II and Sac I.
(1) Enzyme digestion carrier (pCAMBIA13002)
The reaction mixture is mixed evenly and then centrifuged slightly, and the mixture is cut in water bath at 37 ℃ for 2 to 4 hours.
(2) Enzyme digestion of PCR product
The reaction mixture is mixed evenly and then centrifuged slightly, and the mixture is cut in water bath at 37 ℃ for 2 to 4 hours.
(3) Connection of vector and PCR fragment, transformation and screening identification of recombinant plasmid
The PCR product after enzyme digestion and pCAMBIA13002 vector are connected in vitro by using T4 DNA ligase, and the reaction system is as follows:
the reaction was mixed well and centrifuged gently and ligated for 2h at 16 ℃. Then the ligation product is transformed into an expression bacterium escherichia coli DH5a, whether the fragment is inserted into the vector is identified through PCR, sequencing verification is carried out, and the correctly identified bacterium liquid is prepared into glycerol bacterium to be stored in a refrigerator at minus 80 ℃. Meanwhile, the recombinant plasmid was extracted and stored in a refrigerator at-20 ℃.
3. Osa-miR-162a-OE transgenic rice constructed by agrobacterium infection callus method
(1) Plasmid transformation
Adding 1 mu L of plasmid into 50 mu L of EHA105 agrobacterium-infected cells, fully and uniformly mixing, absorbing into an electric rotating cup for electric rotation, adding 1mL of LB liquid culture medium after electric rotation, absorbing into a 1.5mL Ep tube after full and uniform mixing, carrying out shaking culture at 30 ℃ and 180rpm of a shaking table for 30min, absorbing 50 mu L of activated agrobacterium liquid, inoculating on an LB solid culture medium, and carrying out dark culture at 30 ℃ for 48 h.
(2) Induction of
Selecting rice ZH11 with normal bud and no mildew, sterilizing with 75% alcohol for 1min, washing with sterilized water for 1 min/time, sterilizing with sodium hypochlorite for 20min, washing with sterilized water for 3 times, 1 min/time, inoculating the sterilized rice to induction culture medium, and culturing at 26 deg.C under illumination for 20 days.
(3) Infection with Agrobacterium
Selecting agrobacterium to be in an infection solution, preparing agrobacterium resuspension with OD600 ═ 0.2, selecting callus to be in a triangular flask, adding the agrobacterium resuspension, infecting for 10-15min, then abandoning the bacterial liquid, inoculating the callus to a co-culture medium, and co-culturing for 48-72h at 20 ℃.
(4) Callus screening
Inoculating the above callus in screening culture medium, dark culturing at 26 deg.C for 20-30 days, picking positive callus to the screening culture medium, picking monoclonal callus during the callus picking process, and dark culturing at 26 deg.C for 7-10 days.
(5) Differentiation and rooting
Inoculating the positive callus to a differentiation culture medium, culturing at 25-27 deg.C under illumination for 15-20 days, inoculating to a rooting culture medium after 2-5cm bud is differentiated, and culturing at 30 deg.C under illumination for 7-10 days.
4. PCR detection of positive seedlings
Extracting total RNA of rice seedlings, utilizing a reverse transcription Kit Mir-XTM mirNafirt-Strand Synthesis Kit to connect the tail end of a mature sequence of miRNA with a polyA structure to increase the length, and performing subsequent quantitative PCR detection by reverse transcription through oligo (dT) containing a universal primer into a first Strand template for quantitative PCR. Amplification primers for osa-miR-162a are as follows:
thereby screening transgenic plants with osa-miR-162a overexpression.
Example 2
(1) We performed fluorescence quantitative PCR detection on osa-miR-162a in 26 transgenic seedlings (figure 1), and as shown in the figure, found that most transgenic plants generate good over-expression effect, wherein the expression levels of #5, #10, #15 and #24 can be increased by more than 10 times, and #15 is selected for subsequent experiments, namely, ZH11-miR-162a over-expression.
(2) Three test rice lines were set: ZH11-miR-162a overexpression, ZH11 and IR56 (resistant rice). In the test, each rice line is arranged in a pot with the size of 20cm multiplied by 15cm at equal intervals, 10 rice plants are planted in each line, and the process is repeated for 3 times. When the rice seedlings enter a four-leaf non-tillering stage, inoculating 1-5-year-old nymphs of about 150 brown planthoppers on rice plants, recording the number of the brown planthoppers staying on the stems and leaves of the rice plants every day, and counting the selection conditions of the brown planthoppers on ZH11 and ZH11-miR-162a overexpression rice. In addition, rice plant growth was observed daily until one of the rice lines completely died. The experimental result shows that the feeding preference of brown planthopper to osa-miR-162a overexpression rice is obviously reduced 3 days before feeding, and the brown planthopper has obvious repellency (figure 2). As ZH11 rice lines withered or died, brown planthopper selectivity gradually recovered. Meanwhile, after the brown planthopper eats for 5 days, compared with ZH11 rice, the osa-miR-162a overexpression rice has the advantages of obvious healthy growth state and obvious insect resistance (figure 3), and shows that osa-miR-162a can obviously improve the insect resistance of the rice.
The above embodiments are preferred embodiments of the present invention, but the present invention is not limited to the above embodiments, and any other changes, modifications, substitutions, combinations, and simplifications which do not depart from the spirit and principle of the present invention are intended to be included within the scope of the present invention.
Sequence listing
<110> institute for plant protection of academy of agricultural sciences of Guangdong province
Application of <120> osa-miR-162a in preparation of green pesticide for repelling brown planthopper
<160> 1
<170> SIPOSequenceListing 1.0
<210> 1
<211> 495
<212> DNA
<213> Rice (Oryza sativa)
<400> 1
cctaggcact cccttcctca ttgcacacac gagaaacaca gattcacacc cacgagtgtt 60
cgttcgtgcc cgatcttgca ggtggctctg tgttccgttc ttgttttgtt ccggtttctt 120
gcgctaatcc atcatgttcg caggtggggg tggggggttg gtggtgatgc ctgggcgcag 180
tggtttatcg atcccttccc tgccttgtgg cgctgatcca ggagcggcga atttctttga 240
gagggtgttc tttttttttc ttccttttgg tccttgttgc agccaacgac aacgcgggaa 300
tcgatcgata aacctctgca tccagttctc gcctttttgt gttcaagggc ttgaggcagt 360
agtactggct attgcttctt gcttcttggc tgctcatggg gtgtaaacat gtttactact 420
tgtttaggct tgatatatat gtttatgtag gatatgtctc tttttaatga catgactatg 480
gtgatagaag agctc 495
Claims (1)
- The application of osa-miR-162a in improving brown planthopper resistance of rice is characterized in that a precursor gene of osa-miR-162a is cloned from rice, then the precursor gene is transferred into an expression vector, transgenic rice with osa-miR-162a overexpression is obtained through agrobacterium infection, so that brown planthopper resistance of rice is increased, and the nucleotide sequence of the precursor gene of osa-miR-162a is shown in SEQ ID No. 1.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110873455.4A CN113699179B (en) | 2021-07-30 | 2021-07-30 | Application of osa-miR-162a in preparation of green pesticide for repelling brown planthopper |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110873455.4A CN113699179B (en) | 2021-07-30 | 2021-07-30 | Application of osa-miR-162a in preparation of green pesticide for repelling brown planthopper |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113699179A CN113699179A (en) | 2021-11-26 |
| CN113699179B true CN113699179B (en) | 2022-04-05 |
Family
ID=78651126
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110873455.4A Active CN113699179B (en) | 2021-07-30 | 2021-07-30 | Application of osa-miR-162a in preparation of green pesticide for repelling brown planthopper |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113699179B (en) |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2113172A1 (en) * | 2008-04-28 | 2009-11-04 | Bayer CropScience AG | Method for improved utilisation of the production potential of transgene plants |
| CN105820222B (en) * | 2016-05-03 | 2019-05-07 | 广东省农业科学院植物保护研究所 | Brown planthopper resistant gene in rice and its application |
| CN110468128B (en) * | 2018-05-10 | 2023-03-14 | 中国科学院分子植物科学卓越创新中心 | Rice mutant miR393am with high brown planthopper resistance and salt tolerance and application thereof |
| GB201903521D0 (en) * | 2019-03-14 | 2019-05-01 | Tropic Biosciences Uk Ltd | No title |
-
2021
- 2021-07-30 CN CN202110873455.4A patent/CN113699179B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113699179A (en) | 2021-11-26 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN113337520B (en) | Upland cotton GhA0749 and GhD0744 transcription factors and application thereof in flowering regulation | |
| CN104946649B (en) | A kind of Rice Anther specific expression promoter OsAnth1 | |
| CN115011613A (en) | Arabidopsis thaliana sclerotinia sclerotiorum disease-resistant candidate related gene AtSWEET15 and application thereof | |
| CN110004154B (en) | Application of tea tree CsJAZ1 gene | |
| CN112080507B (en) | Key gene GbMYB4 for regulating and controlling ginkgo flavonoid synthesis, protein expressed by gene GbMYB4, vector and application of gene GbMYB4 | |
| CN106480084B (en) | Application of OsLAC13 and miR397a/b in cultivation of high-setting-rate or high-yield rice | |
| CN110564740B (en) | A gene AtPIP2 for improving disease resistance of plants; 7 and uses thereof | |
| CN102851297B (en) | Myzuspersicae hunchback gene cDNA and application thereof | |
| CN110042109B (en) | Gene related to tomato leaf senescence and application thereof | |
| CN113699179B (en) | Application of osa-miR-162a in preparation of green pesticide for repelling brown planthopper | |
| WO2016184397A1 (en) | Application of insecticidal protein | |
| CN115927370B (en) | Sea sword bean CrHsf2 gene and application thereof | |
| CN107573411B (en) | Application of wheat TaZIM1-7A protein in regulation and control of crop heading period | |
| WO2019091390A1 (en) | Nucleotide sequence and application thereof in enhancing pest-resistant ability of plant | |
| CN113024645B (en) | Application of wheat transcription factor WRKY70 gene in regulation and control of plant growth and development | |
| CN107586324B (en) | TabZIP15 albumen and its encoding gene and application | |
| CN112195178B (en) | Tomato late blight-resistant long-chain non-coding RNA-lncRNA40787, cloning method and application method thereof | |
| CN114921473A (en) | Gene for negatively regulating synthesis of cassava endogenous salicylic acid and application thereof | |
| CN115433264A (en) | Rice disease-resistant gene LBRW1, recombinant vector, recombinant engineering bacterium and application | |
| CN103451190B (en) | Gene coding sequence for regulating and controlling organ development of cauliflowers and application of gene coding sequence | |
| CN107418937B (en) | Function of P45071D8 influencing rice plant type and salt stress tolerance and application thereof | |
| CN104611335A (en) | Specific peanut promoter AhRSP and application thereof | |
| CN104805093A (en) | Application of paddy rice gene OsLOL3 in delaying plant leaf senescence and improving plant drought resistance | |
| CN107602679B (en) | TabHLH44 albumen and its encoding gene and application | |
| CN114230649B (en) | Tn1 protein related to rice tillering force, related biological material and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |