CN113699123A

CN113699123A - Preparation and application of targeted hypersensitive broad-spectrum oncolytic virus

Info

Publication number: CN113699123A
Application number: CN202111259942.8A
Authority: CN
Inventors: 钟莉娉
Original assignee: Dandan Biotechnology Shanghai Co ltd
Current assignee: Dandan Biotechnology Shanghai Co ltd
Priority date: 2021-10-28
Filing date: 2021-10-28
Publication date: 2021-11-26
Anticipated expiration: 2041-10-28
Also published as: CN113699123B

Abstract

The invention discloses preparation and application of a targeted hypersensitivity broad-spectrum oncolytic virus, wherein the targeted hypersensitivity broad-spectrum oncolytic virus is a recombinant virus comprising recombinant Newcastle disease virus, hypersensitivity gene alpha-1, 3 GT, heparanase gene HPSE for dissolving extracellular matrix and FAP scFv gene (NDV-GT-HPSE-FAP scFv for short) plasmid of targeted tumor-related fibroblast, and the recombinant virus is obtained by rescuing BSR cells through cotransfection of the recombinant Newcastle disease virus NDV-GHF plasmid and auxiliary plasmid. The recombinant newcastle disease virus NDV-GHF plasmid is a recombinant newcastle disease virus NDV-GHF plasmid obtained by recombining NDV with alpha-1, 3 GT, HPSE and FAP scFv genes; the sequence of the HPSE gene is shown as SEQ ID NO. 1; the sequence of the FAP scFv gene is shown as SEQ ID NO. 2; the sequence of the alpha-1, 3 GT gene is shown in SEQ ID NO 3. The invention also discloses a preparation method of the recombinant virus and application of the recombinant virus in melting tumor physical barriers.

Description

Preparation and application of targeted hypersensitive broad-spectrum oncolytic virus

Technical Field

The invention belongs to the technical field of genetic engineering, and relates to a targeted hypersensitivity broad-spectrum oncolytic virus for melting a tumor physical barrier, and preparation and application thereof.

Background

Heparanase (HPSE) is the only endogenous glycosidase enzyme in mammalian cells that cleaves the heparin sulfate proteoglycan side chains (HS) of the extracellular matrix (i.e., cleaves heparan sulfate proteoglycans at specific sites). In recent years, it has been found that heparanase plays an important role in tumor immune surveillance, on the one hand, activating Natural Killer Cells (NKCs); on the other hand, by disrupting the physical barrier in the tumor tissue by cutting HS chains and subsequent degradation of the extracellular matrix (ECM), chemokines are allowed to enter the tumor stroma, attracting NK cells, T cells, Dendritic Cells (DCs) to aggregate to the tumor site, enhancing the anti-tumor immune response.

Fibroblast Activation Protein (FAP) is a surface antigen in stroma and is expressed by various malignant tumors. Tumor tissue requires the formation of new blood vessels and activated fibroblasts as a matrix to obtain nutrients necessary for the survival and growth of tumor cells. The FAP content in the tumor-related fibroblasts is rich, and the FAP can activate growth factors and the like in stroma to facilitate angiogenesis, so that the growth and metastasis of tumors are promoted. Plays a role in the anti-tumor immunotherapy taking tumor stroma as a target spot and obviously induces the apoptosis of tumor-related fibroblasts. FAP plays an important role in the generation, development and metastasis of tumors and is an ideal anti-tumor target molecule. The FAPSFv is recombined into NDV, so that the tumor cell is dissolved, the tumor growth extracellular matrix is damaged, the soil required by seed growth is damaged, and the growth and invasion of the tumor cell are interfered.

Oncolytic viruses (oncolytic viruses) are a class of viruses that specifically infect cancer cells and replicate in large numbers, eventually releasing them after lysis, and infecting more cancer cells. The Newcastle disease virus is a natural mononegavirale RNA nonpathogenic oncolytic virus, and has high replication efficiency (10000 times of that in normal cells) and certain oncolytic capacity in cancer cells. NDV enters the cell by binding to sialic acid residues, which are abundant NDV receptors on the surface of cancer cells. Because cancer cells lack the antiviral, apoptotic pathways and type i INF signaling pathways, NDV selectively replicates only in cancer cells without infecting normal cells, and thus can kill cancer cells extensively without damaging normal human tissues. In addition, the newcastle disease virus can release tumor specific antigens after tumor cells are cracked, and can stimulate immune cells to activate to a certain extent so as to induce tumor immune response.

The previous patent reports that NDV has weak lethality, not ideal anticancer effect, poor targeting property and unsatisfactory tissue specificity expression of gene drugs. One reason for the poor therapeutic effect of the existing solid tumor treatment is that the medicine can not enter the interior of the tumor.

Disclosure of Invention

In order to solve the defects of the prior art, the invention aims to provide a fused tumor physical barrier virus and application thereof (a targeted hypersensitivity broad-spectrum oncolytic virus for fusing a tumor physical barrier and preparation and application thereof).

The invention provides a recombinant virus containing a recombinant Newcastle disease virus NDV-GHF plasmid, which is obtained by rescuing BSR cells through cotransfection of the recombinant Newcastle disease virus NDV-GHF plasmid and a helper plasmid.

The recombinant virus containing the recombinant Newcastle disease virus NDV-GHF plasmid in the invention refers to a recombinant virus containing the recombinant Newcastle disease virus NDV, a hypersensitivity gene alpha-1, 3 GT, a heparanase gene HPSE for dissolving extracellular matrix and an FAP scFv gene (NDV-GT-HPSE-FAP scFv for short NDV-GHF) plasmid for targeting tumor-related fibroblasts.

The helper plasmids include N, P, L and the like.

The N specifically refers to a plasmid expressing NP protein of NDV.

The P specifically refers to a plasmid expressing the P protein of NDV.

The L specifically refers to a plasmid expressing the L protein of NDV.

The recombinant newcastle disease virus NDV-GHF plasmid is a recombinant newcastle disease virus NDV-GHF plasmid obtained by recombining NDV with alpha-1, 3 GT, HPSE and FAP scFv genes; the sequence of the HPSE gene is shown as SEQ ID NO. 1; the sequence of the FAP scFv gene is shown as SEQ ID NO. 2; the sequence of the alpha-1, 3 GT gene is shown in SEQ ID NO 3.

The sequence of the newcastle disease virus (wild-type newcastle disease virus) NDV is published as GenBank FJ 766530.1.

The sequence of the recombinant virus containing the recombinant newcastle disease virus NDV-GHF plasmid is the sequence of the alpha 1,3 GT, HPSE and FAP scFv genes inserted into the sequence of the wild newcastle disease virus NDV (GenBank FJ 766530.1).

The invention also provides application of the recombinant virus in tumor melting physical barriers.

The invention also provides application of the recombinant virus in preparation of vaccines for preventing and/or treating Newcastle disease virus.

Wherein the recombinant virus is used for inhibiting the growth, proliferation, migration and metastasis of tumors or promoting the apoptosis of the tumors.

The recombinant virus containing the recombinant Newcastle disease virus NDV-GHF plasmid can directly attack physical barriers, tumor-related fibroblasts and cancer cells, destroy extracellular matrixes, inhibit formation of new collagen, generate HPSE (high Performance plasma) to remove the existing physical barriers, release chemokines to attract immune cells to tumor parts, and enhance the anti-tumor effect.

The invention also provides a recombinant Newcastle disease virus NDV-GHF plasmid which is a recombinant Newcastle disease virus NDV-GHF plasmid obtained by recombining the NDV with alpha-1, 3 GT, HPSE and FAP scFv genes.

The vector of the recombinant Newcastle disease virus NDV-GHF plasmid is JS/0704/Pi, and the sites of alpha-1, 3 GT, HPSE and FAP scFv gene insertion are Age I and SanD I.

The sequence of the HPSE gene is shown as SEQ ID NO. 1; the sequence of the FAP scFv gene is shown as SEQ ID NO. 2; the sequence of the alpha-1, 3 GT gene is shown in SEQ ID NO 3.

The sequence of the wild-type newcastle disease virus NDV is as published in GenBank FJ 766530.1.

The invention also provides application of the recombinant Newcastle disease virus NDV-GHF plasmid in construction of a recombinant virus containing the recombinant Newcastle disease virus NDV-GHF plasmid.

The invention also provides a preparation method for preparing the recombinant virus, which comprises the following steps:

step one, constructing the recombinant Newcastle disease virus NDV-GHF plasmid;

step two, extracting the recombinant Newcastle disease virus NDV-GHF plasmid containing the correctly sequenced DNA;

recovering BSR cells, changing liquid, carrying out passage and plating;

step four, infecting BSR cells by using vaccinia virus, and then transfecting the BSR cells by using the recombinant NDV-GHF plasmid extracted in the step two;

step five, inoculating the transfected cell supernatant into a chick embryo to save viruses;

and step six, collecting virus from the chick embryo in the step five, detecting the hemagglutination titer, and confirming to obtain the recombinant virus.

In the first step, the recombination of the plasmid comprises the following steps:

(1) linearized hypersensitivity NDV vector: using Age I and SanD I double enzyme digestion type super-sensitivity NDV framework carrier TVT/071204 to recover the carrier large segment;

(2) amplifying a target gene fragment; the sequence of the target gene is a fusion gene of alpha-1, 3 GT, HPSE and FAP scFv, and is synthesized by Shanghai.

The primer sequences in the amplification are shown as follows:

PF：

CCCAAGGTCCAACTCTGTTTAAACTTAGAAAAAATACGGGTAGAAGTGCCACCGACCCCCGGGTCCGCCCG

PR：AGGATTGCCGCTTGGGTTTAAACTCATTTGATTTCCACTTTGGTCC

the PCR system for amplifying the target gene fragment is shown in the following table 3; the amplification conditions are shown in Table 4 below.

(3) And (2) carrying out homologous recombination on the vector fragment recovered in the step (1) and the target gene in the step (2), transforming a ligation product into a TransStbl3 competent cell, extracting a plasmid, and carrying out double enzyme digestion identification through PCR and Age I and SanD I to obtain a positive recombinant NDV plasmid, namely the recombinant Newcastle disease virus NDV-GHF plasmid.

The second step specifically comprises the following steps:

(1) collecting 250mL of overnight cultured bacterial liquid, centrifuging for 2-5min at 12000 Xg, discarding the supernatant, and collecting the thallus; the bacterial liquid comprises: LB culture medium 250mL + containing sequencing correct recombinant alpha-1, 3 GT, HPSE and FAP scFv gene NDV plasmid bacterial liquid 500 uL;

(2) adding 10mL of Buffer P1 into the centrifuge tube with the bacterial sediment; RNase A is added into the Buffer P1, and vortex oscillation is carried out to mix evenly;

(3) adding 10mL of Buffer P2 into the bacterial suspension obtained in the step (2), reversing the upper part and the lower part, uniformly mixing for 6-10 times, and standing at room temperature for 5-10 min;

(4) adding 10mL of Buffer P4 into the bacterial suspension obtained in the step (3), immediately reversing the mixture from top to bottom for 6-10 times to completely neutralize the Buffer P2 and 11000 Xg, centrifuging the mixture for 15min, and carefully sucking the supernatant into a new 50mL centrifuge tube;

(5) adding 2.0-2.5mL of endotoxin scavenger into the supernatant obtained in the step (4), reversing and mixing uniformly, inserting into crushed ice and standing for 5-10min until the solution becomes clear and transparent from turbidity, and mixing uniformly for 5 times in the middle;

(6) standing at room temperature for 10-15min, and after the temperature is recovered to room temperature, continuously reversing the solution and uniformly mixing;

(7) centrifuging at 12000 Xg for 10-15min at room temperature, and separating phases at temperature higher than 25 deg.C; transferring the upper aqueous phase containing DNA to a new tube, and discarding the oily layer;

(8) adding 12mL of isopropanol into the upper water phase, fully reversing and uniformly mixing, transferring into an adsorption column for multiple times, centrifuging for 1-3min at 12000 Xg, and pouring off waste liquid in a collecting pipe below the adsorption column until all mixed solution passes through the adsorption column;

(9) adding 10mL of rinsing solution PW (12000 Xg) added with absolute ethyl alcohol, centrifuging for 1-3min, and discarding the waste liquid; putting the adsorption column back into the collecting pipe again, adding 15mL of rinsing liquid PW, and repeatedly rinsing once;

(10) placing the adsorption column back into an empty collection tube, centrifuging at 12000 Xg for 3-5min, opening the cover, and air drying at room temperature for 3-5 min;

(11) taking out the adsorption column, placing into a clean centrifuge tube, adding 1-1.5mL Buffer TB into the middle part of the adsorption membrane, standing at room temperature for 3-5min, 12000 Xg, centrifuging for 3-5min, and eluting plasmid;

(12) after the concentration is measured, the mixture is stored at-20 ℃ for later use.

The third step specifically comprises the following steps:

recovery of BSR cells:

(1) DMEM medium containing 10% FBS was preheated at 37 ℃;

(2) taking out the frozen BSR cells from a refrigerator at the temperature of minus 80 ℃ and quickly thawing the cells in a water bath kettle at the temperature of 37 ℃;

(3) adding the molten BSR cells into a preheated DMEM medium, centrifuging at 1000rpm for 3 min;

(4) discarding supernatant, resuspending with 2mL of preheated 10% FBS DMEM medium, adding 50-100 μ L of 100mg/mL G-418 solution, mixing, adding into culture dish containing 10mL 10% FBS DMEM medium, and adding 5% CO at 37 deg.C₂Culturing and observing in an incubator;

(5) carrying out liquid changing treatment after 12 h;

BSR cell exchange solution:

(1) the cell state is observed after BSR cells are recovered for 12-15 h;

(2) the cell culture supernatant was aspirated off, 5ml of PBS was added and shaken;

(3) discarding the supernatant, adding 5mL of PBS for repeated washing, and discarding the supernatant;

(4) 10mL of 10% FBS DMEM medium at 37 ℃ with 5% CO was added to the dish₂Continuously culturing in an incubator;

passage of BSR cells:

(1) the BSR cells grow to about 90 percent and are subjected to passage;

(2) sucking cell culture supernatant, adding 5ml PBS for washing once, and discarding the supernatant;

(3) each dish was charged with 1mL of 0.25% trypsin-EDTA digestive enzyme, 5% CO at 37 ℃₂Digesting in an incubator for 2-3 minutes;

(4) adding 4mL of 10% FBS DMEM medium into each dish to stop digestion, centrifuging at 1000rpm for 3 min;

(5) discarding the supernatant, adding 5mL of PBS for resuspension, centrifuging at 1000rpm for 3 min;

(6) discarding the supernatant, resuspending with 2mL of 10% FBS DMEM medium, adding 50 μ L of 100mg/mL G-418 solution, and mixing well;

(7) the above cell suspension was added to a culture dish containing 10-12mL of 10% FBS-containing DMEM medium at 37 ℃ with 5% CO₂Culturing in an incubator;

BSR cell plating:

(1) sucking the cell culture supernatant cultured in the incubator, adding 5ml PBS for cleaning once, and discarding the supernatant;

(2) 1mL of pancreatin was added to each dish at 37 ℃ with 5% CO₂Digesting in an incubator for 2-3 minutes;

(3) adding 4mL of 10% FBS DMEM medium into each dish to stop digestion, centrifuging at 1000rpm for 3 min;

(4) discarding the supernatant, adding 5mL of PBS for resuspension, centrifuging at 1000rpm for 3 min;

(5) discarding the supernatant, adding 5mL of PBS for resuspension, and sucking 10 mu L of cell suspension for counting;

(6) according to the counting, 2mL of 10% FBS DMEM medium and 1X 10 cells per well⁵Diluting each cell;

(7) the diluted cell suspension was uniformly spread in a six-well plate with 5% CO at 37 ℃₂And culturing and observing in an incubator.

The fourth step specifically comprises the following steps:

(1) when BSR cells in the six-hole plate grow to 80 percent, carrying out transfection;

(2) diluting vaccinia virus with non-anti-bloodless DMEM at a ratio of 1:90-120, preparing at a dosage of 200 μ L per well, and storing at4 deg.C for later use;

(3) the culture supernatant was aspirated and washed 2 times with serum-free DMEM;

(4) adding 200 μ L diluted vaccinia virus into each well, infecting at 37 deg.C in 5% CO2 incubator for 40-80min, shaking once every 20 min;

(5) preparing a transfection A, B liquid; wherein the solution A is 375 mu L of Opti-MEM +30 mu L of transfection reagent (the transfection reagent required by the invention is a product of Vazyme company, and the product number is T202-01); the solution B is 375 mu L of Opti-MEM + 8-14 mu g of plasmid; wherein the plasmid comprises the recombinant newcastle disease virus NDV-GHF plasmid and a helper plasmid, and the ratio of the recombinant plasmid to the helper plasmid N, P, L is 4:2:2: 1;

(6) adding the solution B into the solution A, uniformly mixing, and standing at room temperature for 5-10 min;

(7) taking vaccinia virus suspension, adding 2mL of anti-free and bloodless DMEM and 270 μ L of mixed A, B liquid (the concrete is determined according to the total amount of mixed A, B liquid) into each well;

(8) after mixing, 5% CO at 37 ℃₂Culturing in an incubator for 6-8 h;

(9) sucking the supernatant after 6-8h, adding 2mL of DMEM containing 5% FBS and 10 mu L of 10mg/mL cytarabine into each hole, mixing uniformly, and continuing culturing in a 5% CO2 incubator at 37 ℃;

(10) sucking supernatant after 24h, adding 2mL of non-antibiotic and non-bloody DMEM, 10 mu L of 10mg/mL cytarabine and 0.5-2 uL of 1mg/mL TPCK into each hole, uniformly mixing, and then adding 5% CO at 37 DEG C₂Continuously culturing in an incubator;

(11) collecting cells and supernatant after 24-48h, placing into a 15mL centrifuge tube, sealing with a sealing film, and storing at-20 ℃.

The fifth step specifically comprises the following steps:

(1) rapidly melting the transfection supernatant stored at-20 ℃ in cold water;

(2) temporarily storing the melted supernatant at4 ℃;

(3) irradiating chick embryos of 9-11 days old with a flashlight to draw a wiring line;

(4) firstly, wiping and disinfecting with an iodine tincture cotton ball, and then wiping and deiodinating with a 75% alcohol cotton ball;

(5) gently knocking out a small hole with the diameter of about 1mm at the position where the line is drawn by using an awl;

(6) sucking 300-400 mu L of transfection supernatant by using a 1mL syringe, and connecting the transfection supernatant into the chick embryo from the small hole;

(7) sealing the small hole with wax block, marking, and incubating in incubator with 37 deg.C and 50% humidity;

(8) after incubation for 24h, the inoculated chick embryos are irradiated by a flashlight, dead embryos are taken out and discarded, and other chick embryos are continuously incubated.

The sixth step specifically comprises the following steps:

(1) after the chicken embryos inoculated with the transfection supernatants are incubated for 5 days, the chicken embryos are taken out and placed in a refrigerator at the temperature of 4 ℃;

(2) taking out the chick embryo from a refrigerator at4 ℃ after 4h, and wiping and disinfecting the chick embryo by using an alcohol cotton ball;

(3) knocking along the chick embryo air chamber by using sterilized tweezers, and taking down the eggshell above the air chamber;

(4) aspirating 50 μ L of allantoic fluid into a hemagglutination plate containing 50 μ L of PBS per well using a 100 μ L pipette;

(5) mixing allantoic fluid in the first hole with PBS, sucking 50 μ L into the second hole, and sequentially diluting to the 6 th hole by multiple times;

(6) adding 50 μ L of 1% chicken red blood cell suspension into each well, mixing, and standing at room temperature for 15 min;

(7) and (3) observing the hemagglutination condition of each hole after 15min, if the hemagglutination phenomenon of the chicken red blood cells occurs, determining that the hemagglutination test is positive, successfully rescuing the virus, and completely collecting all allantoic fluid in a 15mL centrifuge tube for preservation at-20 ℃.

The preparation method also comprises RT-PCR verification, recombinant virus amplification and recombinant virus TCID₅₀And (4) measuring and the like.

The invention also provides an intravenous injection preparation which comprises the recombinant virus.

The invention also provides application of the intravenous injection preparation in preparation of vaccines for preventing and/or treating newcastle disease virus.

The beneficial effects of the invention include: the invention discloses a recombinant virus containing a recombinant Newcastle disease virus NDV-GHF plasmid, which has broad spectrum and targeting property, and the recombinant virus can effectively resist tumors and destroy the physical barrier of the tumors in vivo, can directly dissolve extracellular matrix while destroying fibroblast of skeletal cells in a tumor microenvironment, is favorable for medicine to enter the interior of the tumors and kill cancer cells; meanwhile, the chemotactic factor can enter a tumor interstitial space to attract immune cells (such as NK cells, T cells and Dendritic Cells (DC)) to be gathered to a tumor part, so that the anti-tumor immune response is enhanced, and the problem of poor anti-cancer curative effect of the existing solid tumor is solved.

Drawings

FIG. 1 is a schematic diagram of the construction of the recombinant virus of the present invention, and the alpha-1, 3 GT, HPSE and FAP scFv genes are inserted between AgeI and SanD I enzyme cutting sites of P, M protein of NDV, wherein M, F, HN, NP, L and P in FIG. 1 all represent NDV protein.

FIG. 2 is a diagram showing the hemagglutination results of the recombinant viruses of the present invention: newcastle disease virus agglutinates with 1% of chicken red blood cells, and PBS does not contain NDV, so that all chicken red blood cells are deposited at the bottom of the hemagglutination plate, and when the hemagglutination plate is inclined at 45 degrees, unagglutinated red blood cells are in a linear shape. The recombinant virus and the NDV positive control virus are agglutinated, and PBS has no hemagglutination, so that the successful rescue of the recombinant virus is proved.

FIG. 3 is an immunofluorescence chart of target gene expression after HepG2 cells are infected by the recombinant virus, fluorescence of aGal and HPSE proteins can be seen in a recombinant virus group, and fluorescence of PBS (phosphate buffer solution) can not be seen in the recombinant virus group, so that the recombinant virus can be proved to be capable of infecting HepG2 cells and expressing target proteins.

FIG. 4 is a diagram showing the experimental verification of the in vitro killing of the recombinant virus of the present invention.

FIG. 5 is a graph showing the antitumor effect of the recombinant viruses of the present invention in vivo.

Note: the NDV-alpha 1,3 GT-HPSE-FAP scFv in the attached drawing is the recombinant virus of the invention.

Detailed Description

The present invention will be described in further detail with reference to the following specific examples and the accompanying drawings. The procedures, conditions, experimental methods and the like for carrying out the present invention are general knowledge and common general knowledge in the art except for the contents specifically mentioned below, and the present invention is not particularly limited.

Examples

Reagents required for the experiment:

1. the large upgraded particle kit is a product of Vazyme, and the product number is DC 202.

2. DMEM is a Solarbio product with a specification of 12100-.

3. G-418 is Solarbio, Inc. with the product number G8161.

4. Opti-MEM is available from Gibco under the designation 31985088.

5. The transfection reagent is a product of Vazyme, and the product number is T202-01.

6. Cytarabine is a product of Meclin, and has a product number of C805253-5 g.

7. TPCK is a product of Meilun Bio Inc., and has a product number of MB 3477.

8. Day 0 old chicken embryos were purchased from poultry science ltd.

9. The RNA extraction kit is a product of Beijing Quanzijin company, and the product number is AT 411-02.

10. The RT-PCR kit is a product of Beijing Quanzijin company, and the product number is AT 411-02.

The experimental method comprises the following steps:

(I) construction of the recombinant Newcastle disease virus NDV-GHF plasmid:

(1) linearized hypersensitivity NDV vector: performing double enzyme digestion on the hypersensitive NDV skeleton carrier TVT/071204 by Age I and SanD I (preservation at minus 80 ℃), and recovering large fragments;

(2) amplifying a target gene fragment, wherein the target gene is synthesized from Shanghai;

(3) connecting the two recovered fragments, transforming the connecting product into a TransStbl3 competent cell, extracting the plasmid, and obtaining a positive recombinant plasmid through PCR and Age I and SanD I double enzyme digestion identification, wherein the positive recombinant plasmid is named as a recombinant Newcastle disease virus NDV-GHF plasmid.

The primer sequences in the NDV-GHF plasmid of the recombinant Newcastle disease virus are shown in the following table 1:

TABLE 1

The reagents mainly used for the recombinant newcastle disease virus NDV-GHF plasmid are as follows:

TABLE 2

The PCR system for amplifying the target gene fragment is shown in the following Table 3:

TABLE 3

The amplification conditions are shown in table 4 below:

TABLE 4

(II) extracting the recombinant Newcastle disease virus NDV-GHF plasmid:

1. 250mL of overnight-cultured bacterial liquid (supplemented with the components of the bacterial liquid, namely 250mL of LB culture medium and 500 uL of bacterial liquid containing recombinant Newcastle disease virus NDV-GHF plasmid with correct sequencing, the source is glycerol bacteria reserved before sequencing), 12000 Xg is taken, centrifugation is carried out for 3min, supernatant is discarded, and thalli are collected.

2. 10mL of Buffer P1 (RNase A was added to Buffer P1) (Vazyme Co., Ltd., cat # DC 202) was added to the tube in which the cell pellet was retained, and the mixture was vortexed and homogenized.

3. To the bacterial suspension in step 2, 10mL of Buffer P2 (Vazyme, cat # DC 202) was added, mixed gently by inversion from top to bottom 10 times, and allowed to stand at room temperature for 10 min.

4. To the bacterial suspension in step 3 was added 10mL Buffer P4 (Vazyme Co., cat # DC 202), the solution was immediately gently inverted up and down 8 times to completely neutralize the Buffer P2, 11000 Xg, centrifuged for 15min, and the supernatant carefully pipetted into a new 50mL centrifuge tube.

5. 2.0mL of endotoxin scavenger (Vazyme Co., Ltd., cat # DC 202) was added to the supernatant obtained in step 4, mixed by inversion, inserted into crushed ice and left for 8 min until the solution became clear from turbidity, and mixed 5 times in the middle.

6. Standing at room temperature for 10min, after the temperature is returned to room temperature, the solution becomes turbid quickly, and the mixture is inverted and mixed.

7. At room temperature, 12000 Xg, and centrifuging for 15min to separate phases (the temperature needs to be higher than 25 ℃). The upper aqueous phase containing the DNA was transferred to a new tube and the oily layer was discarded.

8. Adding 12mL of isopropanol into the upper water phase, fully reversing and uniformly mixing, transferring into an adsorption column for multiple times, centrifuging for 3min at 12000 Xg, and pouring off waste liquid in a collecting pipe below the adsorption column until all mixed solution passes through the adsorption column.

9. 10mL of a rinsing solution PW (to which absolute ethanol was added) (Vazyme Co., Ltd., product No. DC 202) was added thereto at 12000 Xg, and the mixture was centrifuged for 3min, and the waste solution was discarded. And (4) replacing the adsorption column into the collection pipe, adding 15mL of rinsing liquid PW, and repeatedly rinsing once.

10. The column was returned to the empty collection tube, 12000 Xg, centrifuged for 5min, and the lid was opened and allowed to air dry for 5min at room temperature.

11. The adsorption column was taken out, placed in a clean centrifuge tube, 1.5mL Buffer TB (Vazyme, cat # DC 202) was added to the middle of the adsorption membrane, left at room temperature for 5min, 12000 Xg, centrifuged for 5min, and the plasmid was eluted.

12. After the concentration is measured, the mixture is stored at-20 ℃ for later use.

(III) BSR cell recovery:

1. DMEM medium containing 10% FBS (DMEM from Solarbio, cat. 12100-500 ml) was preheated at 37 ℃.

2. Frozen BSR cells (stored in the laboratory) were removed from the freezer at-80 ℃ and thawed quickly in a 37 ℃ water bath.

3. The thawed BSR cells were added to pre-warmed DMEM medium, centrifuged at 1000rpm for 3 min.

4. Discarding the supernatant, resuspending with 2mL of preheated 10% FBS DMEM medium, adding 100. mu.L of 100mg/mL G-418 solution, mixing, adding into a culture dish containing 10mL 10% FBS DMEM medium, and adding 5% CO at 37 deg.C₂And culturing and observing in an incubator.

5. And after 12h, carrying out liquid changing treatment.

(IV) BSR cell exchange solution:

1. and (5) recovering the BSR cells in the step (three) for 15h, and observing the cell state.

2. Cell culture supernatants were aspirated and gently shaken with 5ml PBS.

3. The supernatant was discarded, and 5mL of PBS was added to repeat the washing, and the supernatant was discarded.

4. 10mL of 10% FBS DMEM medium at 37 ℃ with 5% CO was added to the dish₂And continuing culturing in the incubator.

(V) passage of BSR cells:

1. and (5) carrying out passage when the BSR cells cultured in the incubator in the step (four) grow to about 90%.

2. The cell culture supernatant was aspirated, washed once with 5ml of PBS, and the supernatant was discarded.

3. Each dish was charged with 1mL of 0.25% trypsin-EDTA digestive enzyme (Solarbio, cat. No. T1320), 5% CO at 37 ℃₂The incubator digests for 2 minutes.

4. Digestion was stopped by adding 4mL of 10% FBS DMEM medium to each dish, and centrifugation was carried out at 1000rpm for 3 min.

5. The supernatant was discarded, 5mL of PBS was added for resuspension, 1000rpm, and centrifugation was performed for 3 min.

6. The supernatant was discarded, and the mixture was resuspended in 2mL of 10% FBS DMEM medium, and 50. mu.L of 100mg/mL G-418 solution was added thereto and mixed well.

7. The above cell suspension was added to a culture dish containing 12mL of 10% FBS DMEM medium at 37 ℃ with 5% CO₂Culturing in an incubator.

(VI) BSR cell plating:

1. and (5) sucking the cell culture supernatant obtained in the step (five), adding 5ml of PBS for washing once, and discarding the supernatant.

2. 1mL of pancreatin was added to each dish at 37 ℃ with 5% CO₂The incubator digests for 2 minutes.

3. Digestion was stopped by adding 4mL of 10% FBS DMEM medium to each dish, and centrifugation was carried out at 1000rpm for 3 min.

4. The supernatant was discarded, 5mL of PBS was added for resuspension, 1000rpm, and centrifugation was performed for 3 min.

5. The supernatant was discarded, 5mL of PBS was added for resuspension, and 10. mu.L of the cell suspension was aspirated for counting.

6. According to the counting, 2mL of 10% FBS DMEM medium and 1X 10 cells per well⁵The individual cells were diluted.

7. The diluted cell suspension was uniformly spread in a six-well plate with 5% CO at 37 ℃₂And culturing and observing in an incubator.

(seventhly) transfecting BSR cells with the recombinant NDV-GHF plasmid:

1. and (5) performing transfection when BSR cells in the six-well plate in the step (six) grow to about 80%.

2. Vaccinia virus (stored in the laboratory) was diluted with anti-anemic DMEM at a ratio of 1:100, prepared at 200. mu.L per well, and stored at4 ℃ until use.

3. The culture supernatant was aspirated and gently washed 2 times with serum-free DMEM.

4. mu.L of diluted vaccinia virus was added to each well, and infected at 37 ℃ for 60min in a 5% CO2 incubator, gently shaken every 20 min.

5. Transfection A, B solution was prepared. Solution A: 375. mu.L of Opti-MEM + 30. mu.L of transfection reagent. And B, liquid B: 375 μ L of Opti-MEM +14 μ g of plasmid, where the plasmid comprised a recombinant plasmid and a helper plasmid, the ratio of recombinant plasmid to helper plasmid N, P, L was 4:2:2:1 (source of complementing recombinant plasmid: the recombinant plasmid is extracted as mentioned above in the embodiments of the present invention; sources of helper plasmids: laboratory preservation).

6. And (4) slightly adding the solution B into the solution A, slightly and uniformly mixing, and standing at room temperature for 10 min.

7. The vaccinia virus suspension was aspirated, and 2mL of anti-anemic DMEM and 265. mu.L of mixed A, B solution were added to each well.

8. After gentle mixing, 5% CO at 37 ℃₂Culturing in an incubator for 6-8 h.

9. Sucking supernatant after 6-8h, adding 2mL DMEM containing 5% FBS and 10 μ L10 mg/mL cytarabine into each well, gently mixing, and then 5% CO at 37 DEG C₂And continuing culturing in the incubator.

10. After 24h, the supernatant was aspirated, and 2mL of non-antibody bloodless solution was added to each wellDMEM, 10. mu.L of 10mg/mL cytarabine, 1. mu.L of 1mg/mL TPCK, gently mixed and then subjected to 5% CO at 37 DEG C₂And continuing culturing in the incubator.

11. Collecting cells and supernatant after 48h, putting into a 15mL centrifuge tube, sealing with a sealing film, and storing at-20 ℃.

(eighth) transfection of the supernatant to inoculate chick embryos:

1. the transfection supernatant stored at-20 ℃ in step (seven) was rapidly thawed in cold water.

2. The thawed supernatant was stored temporarily at4 ℃.

3. The chick embryo of 10 days old is taken and irradiated by a flashlight, and the wiring is drawn.

4. The iodine tincture cotton ball is firstly used for wiping and disinfecting, and then 75 percent alcohol cotton ball is used for wiping and deiodination.

5. And lightly tapping a small hole (the size of the needle head) at the position where the line is drawn by using an awl.

6. mu.L of the transfection supernatant was aspirated using a 1mL syringe and transferred from the wells into the chick embryos.

7. The wells were sealed with wax blocks, labeled and incubated at 37 ℃ in a 50% humidity incubator.

8. After incubation for 24h, the inoculated chick embryos are irradiated by a flashlight, dead embryos are taken out and discarded, and other chick embryos are continuously incubated.

(nine) chick embryo detoxification and hemagglutination titer detection:

1. and (5) after the chick embryos inoculated with the transfection supernatants in the step (eight) are incubated for 5 days, taking out the chick embryos and placing the chick embryos in a refrigerator at4 ℃.

2. After 4h, the chick embryos are taken out of a refrigerator at4 ℃ and wiped and disinfected by alcohol cotton balls.

3. Lightly knocking along the chick embryo air chamber by using sterilized tweezers, and taking down the eggshell above the air chamber.

4. 50 μ L of allantoic fluid was pipetted into a hemagglutination plate (50 μ L of PBS per well in the hemagglutination plate) using a 100 μ L pipette gun.

5. The allantoic fluid in the first well was mixed with PBS, 50. mu.L of the mixture was aspirated into the second well, and the mixture was diluted in duplicate to the 6 th well.

6. Add 50. mu.L of 1% chicken red blood cell suspension to each well and mix well, and let stand at room temperature for 15 min.

7. And (3) observing the hemagglutination condition of each hole after 15min, if the hemagglutination phenomenon of the chicken red blood cells occurs, the hemagglutination test is positive, the virus is successfully rescued, all allantoic fluid is collected in a 15mL centrifuge tube and stored at the temperature of-20 ℃, and the specific test result is shown in figure 2.

FIG. 2 is a diagram showing the hemagglutination results of the recombinant viruses of the present invention, wherein the hemagglutination test results are: NDV can perform agglutination reaction with 1% of chicken red blood cells, and the PBS does not contain NDV, so that the chicken red blood cells are completely deposited at the bottom of the hemagglutination plate; when the blood coagulation plate is tilted at 45 degrees, unagglutinated erythrocytes will be in a linear shape. The recombinant virus and the NDV positive control virus are agglutinated, and PBS has no hemagglutination, so that the recombinant virus is proved to be successfully rescued.

(ten) RT-PCR validation:

1. an autoclaved 1.5mL EP tube was used, to which 200. mu.L of the allantoic fluid stored in the above step (nine), 350. mu.L of Buffer RLT (already containing. beta. -mercaptoethanol), 550. mu.L of 70% ethanol were added, and the mixture was pipetted and mixed.

2. The mixture was transferred to an RNeasy red spin column at 11000rpm for 30s and the filtrate was discarded until all the mixture was passed through the spin column.

3. 700 μ L of Buffer RW₁Adding into a centrifugal column, centrifuging at 11000rpm for 30s, and discarding the filtrate.

4. Add 500. mu.L of Buffer RPE to the spin column, 11000rpm, centrifuge for 30s, and discard the filtrate.

5. Repeat step 4 once.

6. 12000rpm, 2min idle.

7. The filtration column was transferred to a new sterile EP tube, to which 35. mu.L of RNase water was added, allowed to stand at room temperature for 2min, 11000rpm, and centrifuged for 2 min.

8. Adding the eluted liquid into the filter column again, standing at room temperature for 2min, 11000rpm, and centrifuging for 2 min.

9. RT-PCR system with 40 mu L of configuration

0.8 mu.L of upstream primer

0.8 mu L of downstream primer

18 μ L of RNA template (eluent from step 8)

2×one-step Reaction mix 20μL

Trans script-Ⅱone-step Enzyme mix 0.8μL

10. PCR was carried out under the following reaction conditions.

50℃ 22min

94℃ 3min

94℃ 30s (30cyc)

55℃ 30s (30cyc)

72℃ 2min 30s (30cyc)

72℃ 10min

11. The PCR product was stored at-20 ℃ and ready for sequencing validation.

(eleventh) amplification of recombinant viruses:

1. the allantoic fluid of the first generation of recombinant virus was diluted 1: 10-fold with PBS containing a double antibody and stored temporarily at4 ℃.

2. The chick embryo of 10 days old is taken and irradiated by a flashlight, and the wiring is drawn.

3. The iodine tincture cotton ball is firstly used for wiping and disinfecting, and then 75 percent alcohol cotton ball is used for wiping and deiodination.

4. And lightly tapping a small hole (the size of the needle head) at the position where the line is drawn by using an awl.

5. 100. mu.L of diluted allantoic fluid of the recombinant virus was aspirated by a 1mL syringe and introduced into the chick embryo from the aperture.

6. The wells were sealed with wax blocks, labeled and incubated at 37 ℃ in a 50% humidity incubator.

7. After incubation for 24h, the inoculated chick embryos are irradiated by a flashlight, dead embryos are taken out and discarded, and other chick embryos are continuously incubated.

8. After the chick embryos are incubated for 5 days, the chick embryos are taken out and placed in a refrigerator at4 ℃.

9. After 4h, the chick embryos are taken out of a refrigerator at4 ℃ and wiped and disinfected by alcohol cotton balls.

10. Lightly knocking along the chick embryo air chamber by using sterilized tweezers, and taking down the eggshell above the air chamber.

11. 50 μ L of allantoic fluid was pipetted into a hemagglutination plate using a 100 μ L pipette, and the hemagglutination titer was measured, and the remaining allantoic fluid was collected into a 50mL centrifuge tube and stored at-80 ℃.

12. The recombinant virus is continuously amplified for more than 5 generations according to the amplification method, and is stored at minus 80 ℃ for later use.

(twelve) recombinant Virus TCID₅₀And (3) determination:

1. BSR cells cultured to 3 generations are observed, and passage is carried out when the cells grow to about 80%.

2. The culture supernatant was aspirated, gently washed with PBS 2 times, and discarded.

3. Add 1mL of pancreatin to the dish at 37 ℃ 5% CO₂The incubator digests for 2 minutes.

6. The supernatant was discarded, 5mL of PBS was added for resuspension, and 10. mu.L of the cell suspension was aspirated for counting.

7. BSR cells were plated evenly into 96-well plates (each well) at a density of 1500 cells per well, as counted, with 5% CO at 37 deg.C₂The culture was carried out overnight in an incubator.

8. Recombinant viruses were diluted in multiples. Taking 10 sterile 1.5mL EP tubes, sequentially adding 900 μ L DMEM medium containing 2% FBS into the tubes, adding 100 μ L recombinant virus allantoic fluid into the first tube, mixing, sucking 100 μ L, adding into the second tube, sequentially diluting by 10 times until the dilution reaches 10¹⁰And (4) doubling.

9. The overnight cultured 96-well plate was taken out, the culture supernatant of each well was aspirated, 100. mu.L of the culture supernatant was added to each well, 8-fold dilution was performed to allantoic fluid, 7 duplicate wells were made for each dilution, and a normal cell control was set as 16 wells.

10. Immunofluorescence detection after 36 hours.

11. TCID calculation by Reed-Muench two-law₅₀And further has TCID₅₀Results of (3) calculating the amount of allantoic fluid of recombinant virus at MOI = 1.

In vitro cell killing experiment:

1. HepG-2 cells transferred to the third generation were plated, culture supernatant was aspirated, gently washed 2 times with PBS, and discarded.

2. Add 1mL of pancreatin to the dish at 37 ℃ 5% CO₂The incubator digests for 2 minutes.

6. According to the counting condition, the number of the holes is 1 multiplied by 10⁵Individual cell Density HepG-2 cells were plated evenly into 6-well plates at 37 ℃ with 5% CO₂The culture was carried out overnight in an incubator.

7. After overnight culture, the cell culture supernatant in six-well plates was aspirated, washed twice with PBS, 2mL of 2% FBS DMEM medium was added to each well, 10. mu.L of recombinant virus allantoic fluid was added thereto, mixed well, and then mixed at 37 ℃ with 5% CO₂Culturing in an incubator.

As shown in FIG. 4, the recombinant oncolytic NDV-alpha 1,3 GT-HPSE-FAP scFv acted on tumor cells 72 hours later, a large amount of cells died, the cell membrane was lysed, and a large amount of cells were exfoliated.

The in vivo anticancer effect of the recombinant newcastle disease virus:

as shown in FIG. 5, the experimental animals of the immune reconstituted SCID/beige mice (Hu-PBMC-SCID) human liver cancer model were randomly divided into 3 groups when the average tumor volume of the mice reached 150 mm³Every other day 300ul PBS, 1 x 10⁷pfu/Kg recombinant NDV was injected intravenously for 5 times. The growth of the mouse tumor was observed and the effect of the recombinant virus on the tumor was investigated (FIG. 5). As a result, the tumor volume of the PBS group is increased continuously with the time after the mice are treated by the PBS and the recombinant NDV respectively, and the tumor treating or inhibiting effect is not achieved. The tumor volumes of the recombinant virus treatment groups are slowly increased.

The protection of the present invention is not limited to the above embodiments. Variations and advantages that may occur to those skilled in the art may be incorporated into the invention without departing from the spirit and scope of the inventive concept, which is set forth in the following claims.

Sequence listing

<110> denier Biotechnology (Shanghai) Ltd

<120> preparation and application of targeted hypersensitivity broad-spectrum oncolytic virus

<160> 5

<170> PatentIn version 3.3

<210> 1

<211> 1629

<212> DNA

<213> Artificial sequence

<400> 1

atgctgctgc gctcgaagcc tgcgctgccg ccgccgctga tgctgctgct cctggggccg 60

ctgggtcccc tctcccctgg cgccctgccc cgacctgcgc aagcacagga cgtcgtggac 120

ctggacttct tcacccagga gccgctgcac ctggtgagcc cctcgttcct gtccgtcacc 180

attgacgcca acctggccac ggacccgcgg ttcctcatcc tcctgggttc tccaaagctt 240

cgtaccttgg ccagaggctt gtctcctgcg tacctgaggt ttggtggcac caagacagac 300

ttcctaattt tcgatcccaa gaaggaatca acctttgaag agagaagtta ctggcaatct 360

caagtcaacc aggatatttg caaatatgga tccatccctc ctgatgtgga ggagaagtta 420

cggttggaat ggccctacca ggagcaattg ctactccgag aacactacca gaaaaagttc 480

aagaacagca cctactcaag aagctctgta gatgtgctat acacttttgc aaactgctca 540

ggactggact tgatctttgg cctaaatgcg ttattaagaa cagcagattt gcagtggaac 600

agttctaatg ctcagttgct cctggactac tgctcttcca aggggtataa catttcttgg 660

gaactaggca atgaacctaa cagtttcctt aagaaggctg atattttcat caatgggtcg 720

cagttaggag aagattttat tcaattgcat aaacttctaa gaaagtccac cttcaaaaat 780

gcaaaactct atggtcctga tgttggtcag cctcgaagaa agacggctaa gatgctgaag 840

agcttcctga aggctggtgg agaagtgatt gattcagtta catggcatca ctactatttg 900

aatggacgga ctgctaccaa ggaagatttt ctaaaccctg atgtattgga catttttatt 960

tcatctgtgc aaaaagtttt ccaggtggtt gagagcacca ggcctggcaa gaaggtctgg 1020

ttaggagaaa caagctctgc atatggaggc ggagcgccct tgctatccga cacctttgca 1080

gctggcttta tgtggctgga taaattgggc ctgtcagccc gaatgggaat agaagtggtg 1140

atgaggcaag tattctttgg agcaggaaac taccatttag tggatgaaaa cttcgatcct 1200

ttacctgatt attggctatc tcttctgttc aagaaattgg tgggcaccaa ggtgttaatg 1260

gcaagcgtgc aaggttcaaa gagaaggaag cttcgagtat accttcattg cacaaacact 1320

gacaatccaa ggtataaaga aggagattta actctgtatg ccataaacct ccataatgtc 1380

accaagtact tgcggttacc ctatcctttt tctaacaagc aagtggataa ataccttcta 1440

agacctttgg gacctcatgg attactttcc aaatctgtcc aactcaatgg tctaactcta 1500

aagatggtgg atgatcaaac cttgccacct ttaatggaaa aacctctccg gccaggaagt 1560

tcactgggct tgccagcttt ctcatatagt ttttttgtga taagaaatgc caaagttgct 1620

gcttgcatc 1629

<210> 2

<211> 726

<212> DNA

<213> Artificial sequence

<400> 2

atggaggtgc aattgttgga gtctggggga ggcttggtac agcctggggg gtccctgaga 60

ctctcctgtg cagcctccgg attcaccttt agcagttatg ccatgagctg ggtccgccag 120

gctccaggga aggggctgga gtgggtctca gctattagtg gtagtggtgg tagcacatac 180

tacgcagact ccgtgaaggg ccggttcacc atctccagag acaattccaa gaacacgctg 240

tatctgcaga tgaacagcct gagagccgag gacacggccg tatattactg tgcgaaaggg 300

tggctgggta attttgacta ctggggccaa ggaaccctgg tcaccgtctc gagtggcggc 360

ggcggcagcg gcggcggcgg cagcggcggc ggcggcagcg aaatcgtgtt aacgcagtct 420

ccaggcaccc tgtctttgtc tccaggggaa agagccaccc tctcttgcag ggccagtcag 480

agtgttagcc gcagctactt agcctggtac cagcagaaac ctggccaggc tcccaggctc 540

ctcatcattg gggcctccac cagggccact ggcatcccag acaggttcag tggcagtgga 600

tccgggacgg acttcactct caccatcagc agactggagc ctgaagattt tgcagtgtat 660

tactgtcagc agggtcaggt tattccccct acgttcggcc aggggaccaa agtggaaatc 720

aaatga 726

<210> 3

<211> 1077

<212> DNA

<213> Artificial sequence

<400> 3

atgaatgtca aaggaagagt ggttctgtca atgctgcttg tctcaactgt aatggttgtg 60

ttttgggaat acatcaacag aaacccagaa gttggcagca gtgctcagag gggctggtgg 120

tttccgagct ggtttaacaa tgggactcac agttaccacg aagaagaaga cgctataggc 180

aacgaaaagg aacaaagaaa agaagacaac agaggagagc ttccgctagt ggactggttt 240

aatcctgaga aacgcccaga ggtcgtgacc ataaccagat ggaaggctcc agtggtatgg 300

gaaggcactt acaacagagc cgtcttagat aattattatg ccaaacagaa aattaccgtg 360

ggcttgacgg tttttgctgt cggaagatac attgagcatt acttggagga gttcttaata 420

tctgcaaata catacttcat ggttggccac aaagtcatct tttacatcat ggtggatgat 480

atctccagga tgcctttgat agagctgggt cctctgcgtt cctttaaagt gtttgagatc 540

aagtccgaga agaggtggca agacatcagc atgatgcgca tgaagaccat cggggagcac 600

atcctggccc acatccagca cgaggtggac ttcctcttct gcatggacgt ggatcaggtc 660

ttccaaaaca actttggggt ggagaccctg ggccagtcgg tggctcagct acaggcctgg 720

tggtacaagg cacatcctga cgagttcacc tacgagaggc ggaaggagtc cgcagcctac 780

attccgtttg gccaggggga tttttattac cacgcagcca tttttggggg aacacccact 840

caggttctaa acatcactca ggagtgcttc aagggaatcc tccaggacaa ggaaaatgac 900

atagaagccg agtggcatga tgaaagccat ctaaacaagt atttccttct caacaaaccc 960

actaaaatct tatccccaga atactgctgg gattatcata taggcatgtc tgtggatatt 1020

aggattgtca agatagcttg gcagaaaaaa gagtataatt tggttagaaa taacatc 1077

<210> 4

<211> 71

<212> DNA

<213> Artificial sequence

<400> 4

cccaaggtcc aactctgttt aaacttagaa aaaatacggg tagaagtgcc accgaccccc 60

gggtccgccc g 71

<210> 5

<211> 46

<212> DNA

<213> Artificial sequence

<400> 5

aggattgccg cttgggttta aactcatttg atttccactt tggtcc 46

Claims

1. A recombinant virus comprising a recombinant newcastle disease virus NDV-GHF plasmid, wherein the recombinant virus is rescued from cotransfection of BSR cells with the recombinant newcastle disease virus NDV-GHF plasmid and a helper plasmid; the recombinant NDV-GHF plasmid is a recombinant NDV-GHF plasmid obtained by recombining NDV and alpha-1, 3 GT, HPSE and FAP scFv genes.

2. The recombinant virus of claim 1, wherein the helper plasmid comprises N, P, L.

3. The recombinant virus of claim 1, wherein the gene sequence of newcastle disease virus NDV is found in GenBank FJ 766530.1; the sequence of the HPSE gene is shown as SEQ ID NO. 1; the sequence of the FAP scFv gene is shown as SEQ ID NO. 2; the sequence of the alpha-1, 3 GT gene is shown in SEQ ID NO 3.

4. Use of the recombinant virus of any one of claims 1 to 3 for thawing the physical barrier of a tumor.

5. The recombinant newcastle disease virus NDV-GHF plasmid is characterized in that the recombinant newcastle disease virus NDV-GHF plasmid containing alpha-1, 3 GT, HPSE and FAP scFv genes is recombined on newcastle disease virus NDV; the vector of the recombinant Newcastle disease virus NDV-CHF plasmid is JS/0704/Pi, and the sites where the alpha-1, 3 GT, HPSE and FAP scFv genes are inserted are Age I and SanD I.

6. The recombinant NDV-GHF plasmid of claim 5, wherein the sequence of the HPSE gene is set forth in SEQ ID No. 1; the sequence of the FAP scFv gene is shown as SEQ ID NO. 2; the sequence of the alpha-1, 3 GT gene is shown in SEQ ID NO 3.

7. Use of the recombinant newcastle disease virus NDV-GHF plasmid according to claim 5 or 6 in the construction of a recombinant virus comprising the recombinant newcastle disease virus NDV-GHF plasmid.

8. A method for producing a recombinant virus according to any one of claims 1 to 3, comprising the steps of:

step one, constructing the recombinant Newcastle disease virus NDV-GHF plasmid;

recovering BSR cells, changing liquid, carrying out passage and plating;

step four, infecting BSR cells by using vaccinia virus, and then transfecting the BSR cells by using the recombinant Newcastle disease virus NDV-GHF plasmid extracted in the step two;

step five, inoculating the cell supernatant after transfection in the step four into a chick embryo to save viruses;

9. The method of claim 8, wherein in step one, the recombinant NDV-GHF plasmid is constructed by the method comprising the steps of:

(2) amplifying a target gene fragment; the sequence of the target gene is shown as SEQ ID NO 1-3;

10. The method of claim 9, wherein in step (2), the sequence of the primers in the amplification is as follows:

PF：

CCCAAGGTCCAACTCTGTTTAAACTTAGAAAAAATACGGGTAGAAGTGCCACCGACCCCCGGGTCCGCCCG

PR：AGGATTGCCGCTTGGGTTTAAACTCATTTGATTTCCACTTTGGTCC。

11. an intravenous formulation comprising the recombinant virus of any one of claims 1-3.

12. Use of the recombinant virus according to any one of claims 1 to 3, or the intravenous formulation according to claim 11, for the preparation of a vaccine for the prevention and/or treatment of newcastle disease virus.