CN113684225B - Application of tomato SlHMGA3 gene in cultivation of tomatoes with delayed fruit ripening - Google Patents

Abstract

The invention discloses the application of tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening, and belongs to the field of tomato genetic engineering technology. The application method first constructs a tomato SlHMGA3 gene CRISPR/Cas9 expression vector; and designs two target sequences of the SlHMGA3 gene. , and then the promoter and the sgRNA sequence containing the two target sites were gene synthesized and inserted between the two restriction sites of the vector to obtain the SlHMGA3 gene mutation vector. The constructed sequence-correct vector was transferred into host cells, and then used to infect tomato cotyledon explants. The progeny of positive transgenic tomatoes were screened for tomato plants with SlHMGA3 gene mutations but not containing the gene knockout vector sequence, and the results of delayed fruit ripening were obtained. Tomato plant. In order to facilitate the identification and screening of tomato plants, the vector used can be processed, such as adding plant selectable markers or resistant antibiotic markers.

Description

Application of tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening

Technical field

The invention belongs to the technical field of tomato genetic engineering, especially the application of tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening.

Background technique

Tomatoes are rich in multiple vitamins, have high nutritional value, special flavor and high agricultural economic value. Tomato is diploid and has a small genome; the growth cycle is short, the fruit growth and development stages are easy to distinguish, and the mature phenotype is easy to observe; tomato germplasm resources, mutant libraries, high-density genetic maps, and EST resources are abundant; the genetic transformation system is mature; Fine sequencing of the whole genome of cultivated tomatoes has been completed, making tomatoes a model plant for studying fleshy fruit ripening. Tomato is a climacteric fruit. During the ripening process, a series of changes occur in color, taste, smell, fruit texture, and physiological and biochemical metabolites. At the transcriptional level, metabolic changes in fruit ripening are subject to precise transcriptional regulation by a variety of related transcription factors. Therefore, the transcription factor regulatory network has become a hot topic in studying the molecular mechanisms of fruit ripening.

HMGA protein is a structural transcription factor that belongs to the HMG protein (The high mobility groups) family. HMG protein is a non-histone chromatin-binding protein that plays an important role in assembling and remodeling chromosomes and regulating gene transcription, including HMGA, HMGB and HMGN three subfamilies. The structure and function of the HMG family have been extensively studied in mammals but rarely in plants. HMGA protein is ubiquitously expressed in various plant tissues and organs and consists of an N-terminal domain with a GH1 domain (histone H1 central globular domain) and a C-terminal domain containing an AT-hook motif. The HMGA-like protein family in Arabidopsis includes three proteins: GH1-HMGA1, GH1-HMGA2 and GH1-HMGA3. Compared with mammalian HMGA proteins, these proteins usually present an additional highly conserved H1/H5 linking domain in histone H1. As classic HMGA proteins, GH1-HMGA3 has four clearly identified AT-hook motifs. Maize HMGA protein has strong binding ability to AT-rich DNA and can be strongly phosphorylated by SUC1-related kinase, thereby reducing its binding ability to AT-rich DNA in vitro. AtHMGA (recently renamed GH1-HMGA3) is located in the nucleus, where it is extremely active. HMGA serves as a structural transcription factor. Each protein has three conserved AT-hook DNA-binding motifs that can be inserted into the DNA minor groove and interact with AT-rich regions. HMGA proteins can specifically interact with a large number of other proteins in the body, inhibiting and activating the transcription of these proteins.

Making full use of biotechnological means to change the expression levels of transcription factors in plants can lay the foundation for plant advantageous breeding and the stable development of agricultural production. Therefore, cultivating SlHMGA3 mutant tomato materials through cloning of the SlHMGA3 gene and transgenic technology will provide good genetic germplasm resources for cultivating late-maturing tomato varieties and have good application prospects.

Contents of the invention

In view of the shortcomings of the above existing technologies, the present invention provides the application of the tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening, which is specifically achieved through the following technologies.

Application of the tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening, the tomato SlHMGA3 gene comprising any one of the following nucleotide sequences:

(1) The nucleotide sequence shown in SEQ ID NO: 1;

(2) Cores that replace, delete and/or add one or more nucleotides from the nucleotide sequence shown in SEQ ID NO: 1 without changing the function of the original nucleotide sequence and have the same function nucleotide sequence;

(3) A DNA molecule that has more than 90% homology with the nucleotide sequence shown in SEQ ID NO: 1 and encodes the amino acid sequence shown in SEQ ID NO: 2.

Of the four tomato SlHMGA3 genes listed above, type (2) means that although certain nucleotides in the nucleotide sequence shown in SEQ ID NO: 1 are substituted, deleted and/or added, they can still be encoded and expressed normally. Sequence that realizes the actual function of the original tomato SlHMGA3 gene. Category (3) means that although there is a partial (no more than 10%) base (nucleotide) difference, it can still be transcribed and translated normally to obtain the same protein as the original tomato SlHMGA3 gene.

A method for cultivating tomatoes with delayed ripening fruits, including the following steps:

S1. Construct host cell engineering bacteria containing tomato SlHMGA3 gene knockout vector;

S2. Transfect the Agrobacterium tumefaciens engineering strain obtained in step S1 into tomato leaf explants, and screen tomato plants that have tomato SlHMGA3 gene mutations and do not contain the tomato SlHMGA3 gene knockout vector sequence described in step S1;

S3. Plant the mutant tomato plants obtained in step S2 in a greenhouse, and cultivate tomatoes with delayed ripening fruits;

The tomato SlHMGA3 gene contains any one of the following nucleotide sequences:

(1) The nucleotide sequence shown in SEQ ID NO: 1;

(2) Cores that replace, delete and/or add one or more nucleotides from the nucleotide sequence shown in SEQ ID NO: 1 without changing the function of the original nucleotide sequence and have the same function nucleotide sequence;

(3) A DNA molecule that has more than 90% homology with the nucleotide sequence shown in SEQ ID NO: 1 and encodes the amino acid sequence shown in SEQ ID NO: 2.

The above method for cultivating tomatoes with delayed ripening fruits is to first construct a tomato SlHMGA3 gene CRISPR/Cas9 expression vector; use the CRISPR-P website to design two target sequences of the SlHMGA3 gene, and then combine the AtU3d and AtU3b promoters together with the two target sequences. After gene synthesis, the sgRNA sequence AtU3d-sgRNA1-AtU3b-sgRNA2 was inserted between the SbfI and SmaI restriction sites of the vector 2300GN-Ubi-Cas9 to obtain the SlHMGA3 gene mutation vector. The constructed sequence-correct vector is transferred into host cells (such as Agrobacterium tumefaciens EHA105), and then used to infect cotyledon explants of tomatoes (varieties such as Micro-Tom), and the SlHMGA3 gene mutation is screened in the progeny of positive transgenic tomatoes but not Tomato plants containing gene knockout vector sequences are used to obtain tomato plants with delayed fruit ripening. In order to facilitate the identification and screening of genetically mutated tomato plants, the vector used can be processed, such as adding plant selectable markers or resistant antibiotic markers.

The above-mentioned method of cultivating tomatoes with delayed ripening fruits is to use gene editing technology to knock out part of the bases (nucleotides) of the tomato SlHMGA3 gene to obtain a mutation vector, and then transfect it to obtain a tomato plant with the corresponding gene mutation. This tomato plant It contains tomato SlHMGA3 gene mutant to achieve the purpose of delaying fruit ripening.

Preferably, in the above tomato cultivation method with delayed fruit ripening, the tomato SlHMGA3 gene knockout in step S1 is achieved through CRISPR/Cas9 gene editing technology, and the tomato SlHMGA3 gene knockout vector is 2300GN-Ubi-Cas9 -AtU3d-sgRNA1-AtU3b-sgRNA2.

Preferably, in the above cultivation method, step S1 specifically includes the following steps:

S11. Design two target sequences on the exon of the SlHMGA3 gene. The nucleotide sequences of the two target sequences are as shown in SEQ ID No. 3 and SEQ ID No. 4; then combine the AtU3d promoter and AtU3b promoter together with 2 After the sgRNA sequences AtU3d-sgRNA1-AtU3b-sgRNA2 of the target sequence are gene synthesized, they are inserted between the SbfI and SmaI restriction sites of the vector 2300GN-Ubi-Cas9 to obtain the SlHMGA3 gene mutation vector;

S12. Transfect the SlHMGA3 gene mutation vector of step S11 into the host cell to obtain the host cell engineering strain.

More preferably, in the above cultivation method, the sequence AtU3d-sgRNA1-AtU3b-sgRNA2 in step S11 is shown in SEQ ID No. 5.

Preferably, the host cell used in step S1 is an Escherichia coli strain or an Agrobacterium tumefaciens strain. Generally, Agrobacterium tumefaciens is used as EHA105.

The above cultivation method can be widely used in cultivating tomatoes with delayed fruit ripening.

Compared with the prior art, the benefits of the present invention are:

1. The present invention constructed tomato SlHMGA3 gene knockout plants for the first time and conducted functional studies. Through phenotypic observation, data statistics, determination of fruit ripening-related indicators, ethylene-related gene expression analysis and ripening-related transcription factor gene expression analysis, it was found that knocking out the mutation of the SlHMGA3 gene can delay tomato fruit ripening, and there is no obvious effect. Affect plant growth.

2. The SlHMGA3 gene provided by the present invention provides genetic resources for cultivating new late-maturing tomato varieties, has good potential application value, and lays a theoretical foundation for studying the regulatory network of transcription factors related to tomato plant maturity.

Description of the drawings

Figure 1 shows the expression of SlHMGA3 gene in different tissues (Root, Shoot, Leaf, Flower) and fruit development stages of wild-type tomato (Micro Tom) in Example 1 (IMG of fruit 5 days after flowering, fruit IMG 15 days after flowering). Expression pattern analysis in IMG, MG in fruits 30 days after flowering, BR in fruits with discoloration on 39 days after flowering, O in yellow-ripened fruits, and RR in red-ripened fruits);

Figure 2 shows target 1 (Taget1) and target 2 (Taget2) of SlHMGA3 gene knockout in Example 2;

Figure 3 is the sequencing result of the slhmga3 mutation target of the tomato homozygous mutant strain in Example 3;

Figure 4 shows the delayed ripening phenotype of tomatoes of wild type and slhmga3 mutants (slhmga3-1 and slhmga3-2) in Example 4;

Figure 5 is the fruit ripening time statistics of wild type, slhmga3-1 and slhmga3-2 in Example 4;

Figure 6 shows the color records during fruit ripening of the wild type and slhmga3-1 and slhmga3-2 in Example 4; in Figure 6, Hue represents the phase angle of the color, 180° represents pure green, 90° represents orange, and 45° represents Orange-red, 0° means pure red;

Figure 7 shows the changes in chlorophyll content of wild type and slhmga3-1, slhmga3-2 mutants during fruit ripening in Example 5;

Figure 8 shows the changes in carotenoid content in the fruit ripening process of wild type and slhmga3-1, slhmga3-2 mutants in the fruit ripening process in Example 5;

Figure 9 shows the changes in ethylene content of the wild type and slhmga3-1, slhmga3-2 mutants during the fruit ripening process in Example 6;

Figure 10 is an analysis of the expression pattern of ethylene synthesis genes of wild type and slhmga3-1, slhmga3-2 mutants during fruit ripening in Example 7;

Figure 11 is an analysis of the expression pattern of ethylene signal response genes of wild type and slhmga3-1, slhmga3-2 mutants during fruit ripening in Example 7;

Figure 12 is an analysis of the expression patterns of regulatory ripening-related transcription genes of wild type and slhmga3-1, slhmga3-2 mutants during the fruit ripening process in Example 7;

Figure 13 shows that the synthesized sgRNA includes two 20bp oligonucleotide target sites (dark bold) and conserved structural sequences (underlined straight lines), as well as the corresponding promoter sequence, AtU3d before the first target site , At3Ub at the second target site (light color not underlined);

Figure 14 is a map of the 2300GN-Ubi-Cas9 vector.

Detailed ways

The technical solution of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some of the embodiments of the present invention, rather than all the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts fall within the scope of protection of the present invention.

Unless otherwise stated, the practice of the present invention will use routine techniques of botany, tissue culture, molecular biology, biophysiology and biochemistry, DNA recombinant and bioinformatics techniques that are obvious to those skilled in the art. These techniques are well explained in the existing literature.

Example 1: Wild-type tomato SlHMGA3 gene expression pattern

Take 5 tomatoes (variety Micro-Tom) of the same tissue or developmental stage as biological replicates, and extract RNA from plant tissues of wild-type tomato roots, stems, leaves, flowers, and fruits at different developmental stages. Fruits at different development stages refer to: IMG (immature green) fruits 5 days after flowering, IMG (immature green) fruits 15 days after flowering, MG (mature green) 30 days after flowering, and BR (breaker). , yellow ripe O (orange), red ripe RR (red ripen). The above plant tissue RNA was reverse transcribed into cDNA as a template, and qRT-PCR was used to detect SlHMGA3 gene expression in tomato fruits. Actin was used as the internal reference gene and the 2 ^-ΔCT method was used. The primer information is shown in Table 1 below.

Table 1 Primer information used in this experiment

Gene name Gene number Upstream primer (5'-3') Downstream primer (5'-3') ACTIN Solyc11g005330 TGTCCCTATCTACGAGGGTTAT AGTTAAATCACGACCAGCAAGA SlHMGA3 Solyc04g007890 GCAAGCTGGGCAATTAGTTATG ACTGAACTTTTCGGCTTCGG SlACS2 Solyc01g095080 TGTTAGCGTATGTATTGACAAC TCATAACATAACTTCACTTTTGC SlACO1 Solyc07g049530 GCCAAAGAGCCAAGATTTGA TTTTTAATTGAATTGGGATCTAA SLACS4 Solyc05g050010 CTCCTCAAATGGGGAGTACG TTTTGTTTGCTCGCACTACG SlE4 Solyc03g111720 GACCACTCTAAATCGCCAGG TTCCTGAGCGGTATTGCTTT slE8 Solyc09g089580 TGGCTCCGAATCCTCCCAGTCT GTCCCGCCTCTGCCACTGAGC SlETR3 Solyc09g075440 TGCTGTTCGTGTACCGCTTT TCATCGGGAGAACCAGAACC SlTAGL1 Solyc07g055920 ACTTTCTGTTCTTTGTGATGCT TTGGATGCTTCTTGCTGGTAG SlETR4 Solyc06g053710 TGGAGGAGTGAGTGTGGATGC ATGGCTGTCGTTCTTGGGC SlEIN2 Solyc09g007870 GTGTGCTGAATAAGTTTAGTGG TGCTGTACAATAGAAGAATGGA SlEIL3 Solyc01g096810 ACAGGACTTCAAGAAACAACC GTGTTGTGCTCATAGTTGATCTG

The results are shown in Figure 1. Qrt-PCR analysis was used. According to Figure 1, it was found that SlHMGA3 is expressed in various tissues of tomato. Among them, the expression level is higher in flowers and fruits, and as the fruit matures, the expression level increases. In tomato fruits The expression level is highest when it reaches the red ripe stage.

Example 2: Construction of SlHMGA3 gene knockout vector and corresponding host cell engineering bacteria

S11. Use the CRISPR-P website to design two target sequences on the exons of the SlHMGA3 gene. The nucleotide sequences of the two target sequences are such as SEQ ID No. 3 (GGTACACTACCACCAGCGCA) and SEQ ID No. 4 (GATGGGTATCCTAGACCACG). As shown in Figure 2; and then the AtU3d promoter and AtU3b promoter together with the sgRNA sequence AtU3d-sgRNA1-AtU3b-sgRNA2 (as shown in SEQ ID No. 5) containing the two target sequences are gene synthesized, Insert it between the SbfI and SmaI restriction sites of vector 2300GN-Ubi-Cas9 to obtain the SlHMGA3 gene mutation vector; the specific operation of the above method is to synthesize sgRNA and its corresponding promoter fragment at Nanjing Genscript Company and clone it Between the Sbf I and Sma I double enzyme cutting sites of the 2300GN-Ubi-Cas9 binary vector, the obtained SlHMGA3 gene mutation vector was sent to Qingke Company for sequencing confirmation;

S12. Transfect the SlHMGA3 gene mutation vector confirmed by sequencing to be correct in step S11 into the host cell Agrobacterium tumefaciens EHA105 to obtain the host cell engineered bacterium.

Example 3: Construction and detection of tomato SlHMGA3 mutation materials

Use the host cell engineering bacteria prepared in Example 2 to infect the cotyledon explants of the tomato variety Micro-Tom, and obtain tissue culture seedlings through callus induction, resistance induction differentiation and rooting culture. PCR and sequencing technology are used to verify and screen out Positive SlHMGA3 gene mutant tomato plants.

After sequencing, it was found that in the above-mentioned mutant tomato plants, slhmga3-1 deleted 6 bases at target site 1 and 4 bases at target site 2, while slhmga3-2 inserted 1 base at target site 1 and target site 2. 2 bases are missing (as shown in Figure 3).

Example 4: Observation of delayed maturation traits of SlHMGA3 gene mutation materials

Mark the flowers during the flowering period of the tomato SlHMGA3 mutant material prepared in Example 3 (i.e., the tomato plant with delayed fruit ripening), indicate the flowering time, take photos of the fruit when it is about to enter the ripening period, and record the ripening process (as shown in Figure 4) , count the time it takes for wild-type and mutant materials to reach fruit color breakage (as shown in Figure 5), and use a Japanese Konica Minolta colorimeter CR-400 to measure the color change of the fruit (as shown in Figure 6).

The fruit ripening of mutant tomatoes was significantly delayed compared with the wild type, with slhmga3-1 delayed by 3 days and slhmga3-2 delayed by 6 days.

Example 5: Determination of total chlorophyll content and total carotenoid content of tomato fruits

The color of tomato fruit is mainly related to the accumulation and relative proportion of pigments such as chlorophyll, carotenoids and flavonoids in the peel and pulp. The decrease in chlorophyll content and the increase in carotenoid content cause tomatoes to change from green to red.

Take 5 tomato peels at the same stage as biological replicates. Weigh 0.75g of the sample, add a small amount of quartz sand, calcium carbonate powder and 2mL of 95% ethanol, grind it into a homogenate, add 10mL of ethanol, continue grinding until the tissue turns white, and let stand. Leave for 5 minutes. Filter into a 25mL brown volumetric flask, dilute to 25mL with ethanol, shake well, pour the chloroplast pigment extract into a cuvette with a light diameter of 1cm, use 95% ethanol as the blank, and measure the absorbance at wavelengths of 665nm and 649nm.

The absorbance of carotenoids was measured at 470 nm. Substitute the measured absorbance value into the following formula:

Ca=13.95A ₆₆₅ -6.88A ₆₄₉ ;

Cb=24.96A ₆₄₉ -7.32A ₆₆₅ ;

C(XC)=(1000A _470-2.05Ca -114.8Cb)/245.

From this, the concentrations of chlorophyll a, chlorophyll b and carotenoids (mg/L) can be obtained. The sum of chlorophyll a and chlorophyll b is the total chlorophyll concentration. Finally, the content of chlorophyll or carotenoids in plant tissues can be further calculated according to the following formula:

Chlorophyll content (mg/L) = (chlorophyll concentration × extraction liquid volume × dilution factor)/sample fresh weight (or dry weight).

The results showed that after knocking out SlHMGA3, the chlorophyll degradation (shown in Figure 7) and carotenoid accumulation (shown in Figure 8) processes in the fruit were delayed, further proving that the fruit ripening process was delayed.

Example 6: Determination of ethylene release from tomato fruits

Ethylene release was measured using a Thermo Trace Ultra GC gas chromatograph. Fresh fruits were picked and left to stand at room temperature for 2 hours to avoid stress-induced ethylene release caused by picking. Five fruits at the same stage were a set of biological replicates. Weigh them separately and put them into 50mL centrifuge tubes, seal them with parafilm, and let them stand for 8 hours before measuring. Chromatographic conditions: injection temperature 130°C, column temperature 80°C, FID temperature 230°C, N ₂ 0.2Mpa, air 0.2Mpa, H ₂ 0.2Mpa, injection volume 10μl. After the baseline is stable, inject 10 μL of ethylene standard to prepare a standard curve. After the standard curve is prepared, use a 1ml syringe to extract the gas from the closed centrifuge bottle and inject it into the machine for measurement. Each sample is technically repeated three times.

The results (shown in Figure 9) are similar to Example 5. Compared with the wild type, the peak time of ethylene release in the slhmga3-1 and slhmga3-2 mutants is delayed, and the maximum peak value is lower than the wild type. This result proves that the SlHMGA3 gene can regulate fruit ripening through ethylene.

Example 7: Analysis of expression patterns of ethylene synthesis genes, ethylene signal response genes and maturation-related transcription factors

Fruit RNA from wild-type and slhmga3-1, slhmga3-2 mutant tomato fruit ripening processes at different time points (32dap, 36dap, 38dap, 42dap, 46dap, 50dap) was extracted and reverse transcribed into cDNA as a template, and used qRT-PCR detects changes in the expression of ethylene synthesis genes, signal response genes and ripening-related transcription factors in tomato fruits (as shown in Figure 10-12). Actin is used as the internal reference gene and the 2 ^-ΔCT method is used. The primer information is shown in the table above. 1. In the slhmga3-1 and slhmga3-2 mutants, the expression of ethylene synthesis genes ACS2, ACS4, and ACO1 is delayed and the highest expression level is lower than the highest expression level in WT (as shown in Figure 10); in the slhmga3-1 and slhmga3-2 mutants The expression of ethylene signal response genes ETR3, ETR4, CTR1, EIL3 and EIN2 is delayed, which is consistent with the expression trend of ethylene synthesis genes (as shown in Figure 11); starting from 36dpa in wild-type fruits, the expression of ripening-related transcription factors E4 and E8 sharply increase, whereas in the slhmga3 mutant, this increase was delayed to 38 dpa, the induction of ripening-related transcription factors in mutant fruits was delayed by approximately 3 to 6 days, and the largest difference between WT and mutants occurred at 38 dpa (Fig. shown in 12). These results indicate that SlHMGA3 regulates ethylene synthesis and signaling-related genes to regulate ethylene conduction and some key ripening-related transcription factors, thereby regulating fruit ripening.

In addition, as common knowledge in the field, when the nucleotide sequence shown in SEQ ID NO: 1 has the above-mentioned functions, certain changes to it by conventional means will not affect its functional effects, such as substitution, A nucleotide sequence that has the same function by deleting and/or adding one or more nucleotides without changing the function of the original nucleotide sequence; or a nucleotide sequence that has more than 90% homology and encodes the same functional protein .

sequence list

<110> Nanjing Agricultural University

<120> Application of tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening

<141> 2021-05-28

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 974

<212> DNA

<213> Tomato (Solanum lycopersicum)

<400> 1

tatatctgaa acgaattacc aactgtacga tcattctccc attgttgatt tcatccattt 60

aaatcctctt cttcctctgc catttttttc acagattttt gtttttctct gtaacaaaaa 120

tggctactga agaacataat ctaactttgc ctagttatcc tgatgttagt cacaattttt 180

tcaatttttt tttgctagtt ttggtaattt ttttttgtta acaattttgg taatttttgt 240

ttgtagatga ttatggaagc tatagatgcg ttgaatgaag aagaagggtc gaataaatca 300

gctatatgga agcaaattga agcgactcat ggtacactac caccagcgca tggtacactc 360

cttgcacatc atttgaatca aatgaagcaa gctgggcaat tagttatgtt gaagaacaac 420

tacatgaagc caaatccaaa cgcgccgccg cgccgtggta gaggccgtcc gccgaagccg 480

aaaagttcag ttccggtacc ggatgggtat cctagaccac gtggaaggcc accgaaggag 540

cgggatccgt acgcgccgat aacggtacct atgaagaaga cgagtgaggg tagctctggg 600

ggaagtggga agaagcgtgg aaggccaagg aagtatccga tgacggagga tacgccggtg 660

gtgaagccaa ttggtgctcc gagaggaaga ggaaggccgc cgaaggtgaa aactccggta 720

gctgcaactg taggggctta attgaagaaa gacgaattaa attagggact tgtatggcaa 780

aatatgctaa cttgttgttt ttcacttttt atctgttttg aattttcatg tttagtccct 840

gtagttttgt tttaattaca atttgtagga agaattgtgt gactttgtga gtgattttta 900

tcatgtaatt gggccaatgt aaatccaaat tgagggcttt ttatttatat ataaaaaaaa 960

aggttcagta ttat 974

<210> 2

<211> 179

<212> PRT

<213> Tomato (Solanum lycopersicum)

<400> 2

Met Ala Thr Glu Glu His Asn Leu Thr Leu Pro Ser Tyr Pro Asp Met

1 5 10 15

Ile Met Glu Ala Ile Asp Ala Leu Asn Glu Glu Glu Gly Ser Asn Lys

20 25 30

Ser Ala Ile Trp Lys Gln Ile Glu Ala Thr His Gly Thr Leu Pro Pro

35 40 45

Ala His Gly Thr Leu Leu Ala His His Leu Asn Gln Met Lys Gln Ala

50 55 60

Gly Gln Leu Val Met Leu Lys Asn Asn Tyr Met Lys Pro Asn Pro Asn

65 70 75 80

Ala Pro Pro Arg Arg Gly Arg Gly Arg Pro Pro Lys Pro Lys Ser Ser

85 90 95

Val Pro Val Pro Asp Gly Tyr Pro Arg Pro Arg Gly Arg Pro Pro Lys

100 105 110

Glu Arg Asp Pro Tyr Ala Pro Ile Thr Val Pro Met Lys Lys Thr Ser

115 120 125

Glu Gly Ser Ser Gly Gly Ser Gly Lys Lys Arg Gly Arg Pro Arg Lys

130 135 140

Tyr Pro Met Thr Glu Asp Thr Pro Val Val Lys Pro Ile Gly Ala Pro

145 150 155 160

Arg Gly Arg Gly Arg Pro Pro Lys Val Lys Thr Pro Val Ala Ala Thr

165 170 175

Val Gly Ala

<210> 3

<211> 20

<212> DNA

<213> Tomato (Solanum lycopersicum)

<400> 3

ggtacactac caccagcgca 20

<210> 4

<211> 20

<212> DNA

<213> Tomato (Solanum lycopersicum)

<400> 4

gatgggtatcctagaccacg 20

<210> 5

<211> 633

<212>DNA/RNA

<213> Artificial Sequence

<400> 5

ataagcttt gatttctttt ttcttacgaa ttttgcgtcc cacatcggta agcgagtgaa 60

gaaataactg ctttatatat ggctacaaag caccattggt caggtacact accaccagcg 120

cagttttaga gctagaaata gcaagttaaa ataaggctag tccgttatca acttgaaaaa 180

gtggcaccga gtcggtgctt ttttttttac tttaaatttt ttctttatgca gcctgtgatg 240

gataactgaa tcaaacaaat ggcgtctggg tttaagaaga tctgttttgg ctatgttgga 300

cgaaacaagt gaacttttag gatcaacttc agtttatata tggagcttat atcgagcaat 360

aagataagtg ggctttttat gtaatttaat gggctatcgt ccatagattc actaataccc 420

atgcccagta cccatgtatg cgtttcatat aagctcctaa tttctcccac atcgctcaaa 480

tctaaacaaa tcttgttgta tatataacac tgaggggagca acattggtca cgtggtctag 540

gatacccatc gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac 600

ttgaaaaagt ggcaccgagt cggtgctttt ttt 633

Claims (4)

1. The application of knocking out the tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening is characterized in that the tomato SlHMGA3 gene is any one of the following nucleotide sequences:

(1) As set forth in SEQ ID NO:1, and a nucleotide sequence shown in the specification;

(2) And SEQ ID NO:1 and encodes a nucleotide sequence having more than 90% homology as set forth in SEQ ID NO:2, and a DNA molecule having an amino acid sequence shown in the specification.

2. A method for cultivating tomatoes with delayed ripening fruits, which is characterized by comprising the following steps:

s1, constructing a host cell engineering bacterium containing a tomato SlHMGA3 gene knockout vector;

s2, in the tomato leaf explant transfected by the agrobacterium tumefaciens engineering bacteria obtained in the step S1, screening tomato plants which are subjected to the mutation of the tomato SlHMGA3 gene and do not contain the tomato SlHMGA3 gene knockout carrier sequence in the step S1;

s3, planting the mutant tomato plants obtained in the step S2 in a greenhouse, and culturing to obtain tomatoes with delayed mature fruits;

the tomato SlHMGA3 gene is any one of the following nucleotide sequences:

(1) As set forth in SEQ ID NO:1, and a nucleotide sequence shown in the specification;

(2) And SEQ ID NO:1 and encodes a nucleotide sequence having more than 90% homology as set forth in SEQ ID NO:2, and a DNA molecule having an amino acid sequence shown in the specification.

3. The method of cultivation of tomatoes with delayed ripening of fruits according to claim 2, wherein the host cell used in step S1 is escherichia coli strain or agrobacterium tumefaciens strain.

4. Use of a cultivation method according to claim 2 or 3 for cultivating tomatoes whose fruits are delayed from ripening.