CN113684225A

CN113684225A - Application of tomato SlHMGA3 gene in cultivation of tomato with delayed fruit ripening

Info

Publication number: CN113684225A
Application number: CN202110592538.6A
Authority: CN
Inventors: 吴寒; 李治飞; 皮颖
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2021-05-28
Filing date: 2021-05-28
Publication date: 2021-11-23
Anticipated expiration: 2041-05-28
Also published as: CN113684225B

Abstract

The invention discloses an application of a tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening, which belongs to the technical field of tomato genetic engineering, and the application method comprises the steps of firstly constructing a tomato SlHMGA3 gene CRISPR/Cas9 expression vector; designing 2 target sequences of the SlHMGA3 gene, then carrying out gene synthesis on a promoter and a sgRNA sequence containing 2 target points, and inserting the promoter and the sgRNA sequence between two enzyme cutting sites of a vector to obtain a SlHMGA3 gene mutation vector. Transferring the constructed sequencing correct vector into a host cell, infecting a tomato cotyledon explant by using the vector, and screening tomato plants with SlHMGA3 gene mutation but without gene knockout vector sequences in the positive transgenic tomato progeny to obtain tomato plants with fruit delayed maturity. In order to facilitate the identification and selection of tomato plants, the vectors used may be processed, for example by adding plant selectable markers or antibiotic markers with resistance.

Description

Application of tomato SlHMGA3 gene in cultivation of tomato with delayed fruit ripening

Technical Field

The invention belongs to the technical field of tomato genetic engineering, and particularly relates to application of a tomato SlHMGA3 gene in cultivation of tomatoes with fruits maturing in a delayed manner.

Background

The tomato is rich in multiple vitamins, has high nutritive value, special flavor and high agricultural economic value. The tomato is diploid, and the genome of the tomato is small; the growth cycle is short, the growth and development stages of the fruits are easy to distinguish, and the mature phenotype is easy to observe; the tomato germplasm resources, the mutant library, the high-density genetic map and the EST resources are rich; the genetic transformation system is mature; fine sequencing of the whole genome of cultivated tomatoes has been completed, so that tomatoes become model plants for studying the ripening of fleshy fruits. The tomato is a respiratory catastrophe fruit, and a series of changes occur in color, taste, smell, fruit texture, physiological and biochemical metabolites and the like in the ripening process. At the transcriptional level, fruit ripening metabolic changes are closely transcriptionally regulated by a variety of related transcription factors. Therefore, the transcription factor regulation network becomes a hot spot for researching the molecular mechanism of fruit ripening.

The HMGA protein is a structural transcription factor, belongs to The family of HMG (The high mobility groups), is a non-histone chromatin binding protein, and plays an important role in assembling reconstructed chromosomes and regulating gene transcription, and comprises three subfamilies of HMGA, HMGB and HMGN. The structure and function of the HMG family have been studied extensively in mammals, but rarely in plants. The HMGA protein is ubiquitously expressed in the various tissues and organs of plants and consists of an N-terminal domain with a GH1 domain (central globular domain of histone H1) and a C-terminal domain comprising an AT-hook motif. The HMGA-like protein family in arabidopsis thaliana includes three proteins: GH1-HMGA1, GH1-HMGA2 and GH1-HMGA 3. These proteins typically have an additional highly conserved H1/H5 linking domain in histone H1 compared to mammalian HMGA proteins. As a classical HMGA protein, GH1-HMGA3 has four well-recognized AT-hook motifs. The maize HMGA protein has strong binding to AT-rich DNA and can be strongly phosphorylated by SUC 1-related kinase, thereby reducing its binding to AT-rich DNA in vitro. AtHMGA (recently more known as GH1-HMGA3) is located in the nucleus, where it is extremely active. HMGA is a structural transcription factor, each protein having three conserved AT-hook DNA binding motifs that can insert into the DNA minor groove and interact with regions rich in AT bases. HMGA proteins can specifically interact with a large number of other proteins in vivo, inhibiting and activating the transcription of these proteins.

The expression level of the transcription factor in the plant is changed by fully utilizing the biotechnology means, and a foundation can be laid for the dominant breeding of the plant and the stable development of agricultural production. Therefore, the cloning and transgenic technology of the SlHMGA3 gene is used for cultivating the SlHMGA3 mutant tomato material, so that good genetic germplasm resources are provided in the working aspect of cultivating late-maturing tomato varieties, and the application prospect is good.

Disclosure of Invention

Aiming at the defects of the prior art, the invention provides the application of the tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening, and the application is realized by the following technology.

The application of the tomato SlHMGA3 gene in cultivating tomatoes with delayed fruit ripening, wherein the tomato SlHMGA3 gene comprises any one of the following nucleotide sequences:

(1) as shown in SEQ ID NO: 1;

(2) from SEQ ID NO: 1, and has a nucleotide sequence which does not change the function of a prokaryotic nucleotide sequence and has the same function;

(3) and SEQ ID NO: 1 has more than 90% homology and encodes the nucleotide sequence shown as SEQ ID NO: 2 in sequence shown in the figure.

The four tomato SlHMGA3 genes listed above, species (2) refers to although SEQ ID NO: 1, certain nucleotides in the nucleotide sequence shown in the sequence table 1 are substituted, deleted and/or added, but the nucleotide sequence can still normally code and express a sequence which realizes the actual function of the original tomato SlHMGA3 gene. The species (3) means that although there is a partial (no more than 10%) base (nucleotide) difference, the same protein as that obtained by the transcription and translation of the original tomato SlHMGA3 gene can still be obtained by normal transcription and translation.

A method for cultivating tomatoes with delayed fruit ripening comprises the following steps:

s1, constructing host cell engineering bacteria containing tomato SlHMGA3 gene knockout vectors;

s2, transfecting the agrobacterium tumefaciens engineering bacteria obtained in the step S1 into a tomato leaf explant, and screening tomato SlHMGA3 gene mutation tomato plants without the tomato SlHMGA3 gene knockout vector sequence in the step S1;

s3, planting the mutant tomato plant obtained in the step S2 in a greenhouse, and cultivating to obtain a tomato with delayed mature fruits;

the tomato SlHMGA3 gene comprises any one of the following nucleotide sequences:

(1) as shown in SEQ ID NO: 1;

The method for cultivating the tomato with the delayed fruit ripening comprises the steps of firstly constructing an expression vector of a tomato SlHMGA3 gene CRISPR/Cas 9; 2 target sequences of the SlHMGA3 gene are designed by using a CRISPR-P website, then AtU3d and AtU3b promoters and sgRNA sequences AtU3d-sgRNA1-AtU3b-sgRNA2 containing 2 target points are subjected to gene synthesis, and are inserted between SbfI and SmaI enzyme cutting sites of a vector 2300GN-Ubi-Cas9, so that a SlHMGA3 gene mutation vector is obtained. Transferring the constructed vector with correct sequencing into a host cell (such as agrobacterium tumefaciens EHA105), infecting cotyledon explants of tomatoes (such as Micro-Tom) by using the vector, and screening tomato plants with mutation of SlHMGA3 gene but without gene knockout vector sequences in the progeny of positive transgenic tomatoes to obtain tomato plants with delayed fruit maturity. In order to facilitate the identification and screening of the genetically mutated tomato plants, the vectors used can be processed, for example by adding plant selectable markers or antibiotic markers with resistance.

The method for cultivating the tomato with the delayed fruit ripening comprises the steps of knocking out partial bases (nucleotides) of a tomato SlHMGA3 gene by a gene editing technology to obtain a mutant vector, and then transfecting to obtain a tomato plant with the corresponding gene mutation, wherein the tomato plant contains a tomato SlHMGA3 gene mutant, so that the aim of delaying fruit ripening is fulfilled.

Preferably, in the method for breeding tomatoes with delayed fruit ripening, the tomato SlHMGA3 gene knockout in the step S1 is realized by a CRISPR/Cas9 gene editing technology, and the tomato SlHMGA3 gene knockout vector is 2300GN-Ubi-Cas9-AtU3d-sgRNA1-AtU3b-sgRNA 2.

Preferably, in the above cultivation method, step S1 specifically includes the following steps:

s11, designing 2 target sequences on an exon of a SlHMGA3 gene, wherein the nucleotide sequences of the 2 target sequences are shown as SEQ ID No.3 and SEQ ID No. 4; then AtU3d promoter and AtU3b promoter as well as sgRNA sequence AtU3d-sgRNA1-AtU3b-sgRNA2 containing 2 target sequences are subjected to gene synthesis and inserted between SbfI and SmaI enzyme cutting sites of vector 2300GN-Ubi-Cas9 to obtain a SlHMGA3 gene mutation vector;

s12, transfecting the SlHMGA3 gene mutation vector obtained in the step S11 into a host cell to obtain the host cell engineering bacterium.

More preferably, in the breeding method, the sequence AtU3d-sgRNA1-AtU3b-sgRNA2 of the step S11 is shown as SEQ ID No. 5.

Preferably, the host cell used in step S1 is an E.coli strain or an Agrobacterium tumefaciens strain. Agrobacterium tumefaciens is typically used as EHA 105.

The cultivation method can be widely applied to cultivation of the tomatoes with the fruits being delayed to mature.

Compared with the prior art, the invention has the advantages that:

1. the invention constructs a tomato SlHMGA3 gene knockout plant for the first time and performs function research. By phenotypic observation, data statistics, determination of indexes related to fruit ripening, ethylene-related gene expression analysis and ripening-related transcription factor gene expression analysis, the mutation of the knockout SlHMGA3 gene is found to play a role in delaying tomato fruit ripening, and meanwhile, the plant growth is not obviously influenced.

2. The SlHMGA3 gene provided by the invention provides gene resources for cultivating new late-maturing tomato varieties, has a good potential application value, and lays a theoretical foundation for researching a tomato plant maturation related transcription factor regulation network.

Drawings

FIG. 1 is a graph showing the expression pattern of the SlHMGA3 gene in example 1 in different tissues (Root, stem, Leaf, Flower) and different stages of fruit development (fruit IMG 5 days after flowering, fruit IMG 15 days after flowering, fruit MG 30 days after flowering, broken color fruit BR 39 days after flowering, yellow ripe fruit O, red ripe fruit RR) of a wild type tomato (Micro Tom);

FIG. 2 shows target 1(Taget1) and target 2(Taget2) of the SlHMGA3 gene knockout in example 2;

FIG. 3 shows the sequencing results of the mutant target of the tomato homozygous mutant line slhmga3 in example 3;

FIG. 4 is a graph of the delayed ripening phenotype of fruits of the tomato of example 4 wild type and mutant slhmga3 (slhmga3-1 and slhmga 3-2);

FIG. 5 is a statistic of fruit ripening time for wild type and slhmga3-1, slhmga3-2 in example 4;

FIG. 6 is a color record during fruit ripening for wild type and slhmga3-1, slhmga3-2 in example 4; in fig. 6, Hue represents the phase angle of the color, 180 ° represents pure green, 90 ° represents orange, 45 ° represents orange, and 0 ° represents pure red;

FIG. 7 is the change in chlorophyll content of wild type and slhmga3-1, slhmga3-2 mutant during fruit ripening in example 5;

FIG. 8 is the change in carotenoid content during fruit ripening between wild type and slhmga3-1, slhmga3-2 mutant in fruit ripening in example 5;

FIG. 9 is the variation of ethylene content during fruit ripening between wild type and slhmga3-1, slhmga3-2 mutant in fruit ripening in example 6;

FIG. 10 is an analysis of the expression pattern of the ethylene synthesis genes of the wild type and the slhmga3-1 and slhmga3-2 mutants in the fruit ripening process in example 7;

FIG. 11 is an analysis of the expression patterns of the ethylene signal response genes of the wild type and the slhmga3-1 and slhmga3-2 mutants in the fruit ripening process in example 7;

FIG. 12 is an analysis of the expression pattern of the mature-regulated transcript genes associated with the wild type and slhmga3-1 and slhmga3-2 mutants in fruit maturation in example 7;

fig. 13 is a synthetic sgRNA including two 20bp oligonucleotide target sites (bold and bold) and conserved structural sequences (underlined lines), along with the corresponding promoter sequence, AtU3d preceding the first target site, At3Ub At the second target site (not underlined and light);

FIG. 14 is a map of 2300GN-Ubi-Cas9 vector.

Detailed Description

The technical solutions of the present invention will be described clearly and completely below, and it should be understood that the described embodiments are only a part of the embodiments of the present invention, and not all of the embodiments. All other embodiments, which can be derived by a person skilled in the art from the embodiments given herein without making any creative effort, shall fall within the protection scope of the present invention.

The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, tissue culture, molecular biology, biophysiological biochemistry, DNA recombination and bioinformatics, which will be apparent to those skilled in the art. These techniques are explained fully in the prior art literature.

Example 1: wild type tomato SlHMGA3 gene expression pattern

5 tomato (variety Micro-Tom) tissues in the same tissue or development stage are taken as biological repetition, and the plant tissue RNA of the wild tomato root, stem, leaf, flower and fruits in different development stages is extracted. Fruits at different developmental stages refer to: fruits IMG (immaturity green) 5 days after flowering, fruits IMG (immaturity green) 15 days after flowering, fruits MG (formatity green) 30 days after flowering, broken-color BR (breaker), yellow ripe O (orange), red ripe RR (red pen). And reverse transcribing the plant tissue RNA into cDNA serving as a template, detecting the expression level of SlHMGA3 gene in tomato fruits by utilizing qRT-PCR (quantitative reverse transcription-polymerase chain reaction), taking Actin as an internal reference gene, and adopting 2^-ΔCTMethodThe primer information is shown in Table 1 below.

TABLE 1 primer information used in this experiment

Name of Gene	Gene numbering	Upstream primer (5'-3')	Downstream primer (5'-3')
				ACTIN	Solyc11g005330	TGTCCCTATCTACGAGGGTTAT	AGTTAAATCACGACCAGCAAGA
SlHMGA3	Solyc04g007890	GCAAGCTGGGCAATTAGTTATG	ACTGAACTTTTCGGCTTCGG
				SlACS2	Solyc01g095080	TGTTAGCGTATGTATTGACAAC	TCATAACATAACTTCACTTTTGC
SlACO1	Solyc07g049530	GCCAAAGAGCCAAGATTTGA	TTTTTAATTGAATTGGGATCTAA
				SlACS4	Solyc05g050010	CTCCTCAAATGGGGAGTACG	TTTTGTTTGCTCGCACTACG
SlE4	Solyc03g111720	GACCACTCTAAATCGCCAGG	TTCCTGAGCGGTATTGCTTT
				SlE8	Solyc09g089580	TGGCTCCGAATCCTCCCAGTCT	GTCCGCCTCTGCCACTGAGC
SlETR3	Solyc09g075440	TGCTGTTCGTGTACCGCTTT	TCATCGGGAGAACCAGAACC
				SlTAGL1	Solyc07g055920	ACTTTCTGTTCTTTGTGATGCT	TTGGATGCTTCTTGCTGGTAG
SlETR4	Solyc06g053710	TGGAGGAGTGAGTGTGGATGC	ATGGCTGTCGTTCTTGGGC
				SlEIN2	Solyc09g007870	GTGTGCTGAATAAGTTTAGTGG	TGCTGTACAATAGAAGAATGGA
SlEIL3	Solyc01g096810	ACAGGACTTCAAGAAACAACC	GTGTTGTGCTCATAGTTGATCTG

As shown in FIG. 1, the expression level of SlHMGA3 in tomato tissues is found to be high in flowers and fruits according to the analysis of Qrt-PCR (polymerase chain reaction) in FIG. 1, and the expression level is increased along with the ripening of the fruits and is highest when the tomato fruits reach the red-ripe stage.

Example 2: SlHMGA3 gene knockout vector and construction of corresponding host cell engineering bacteria

S11, designing 2 target sequences on an exon of a SlHMGA3 gene by using a CRISPR-P website, wherein the nucleotide sequences of the 2 target sequences are shown as SEQ ID No.3(GGTACACTACCACCAGCGCA) and SEQ ID No.4(GATGGGTATCCTAGACCACG), and the reference is shown in the attached figure 2; then AtU3d promoter and AtU3b promoter are combined with sgRNA sequence AtU3d-sgRNA1-AtU3b-sgRNA2 (shown as SEQ ID No. 5) containing 2 target sequences to be subjected to gene synthesis, and the gene is inserted between SbfI and SmaI enzyme cutting sites of vector 2300GN-Ubi-Cas9 to obtain a SlHMGA3 gene mutation vector; the method specifically comprises the steps of synthesizing sgRNA and a corresponding promoter fragment thereof in Nanjing Kingsry company, cloning the sgRNA and the corresponding promoter fragment between the two enzyme cutting sites Sbf I and Sma I of a 2300GN-Ubi-Cas9 binary vector, and sending the obtained SlHMGA3 gene mutation vector to the Scenario company for sequencing confirmation;

s12, transfecting the SlHMGA3 gene mutation vector which is confirmed to be correct through sequencing in the step S11 into a host cell, namely the Agrobacterium tumefaciens EHA105, and obtaining the host cell engineering bacterium.

Example 3: construction and detection of tomato SlHMGA3 mutant material

The host cell engineering bacteria prepared in the example 2 are used for infecting the cotyledon explants of the tomato variety Micro-Tom, tissue culture seedlings are obtained by inducing callus, resistance induced differentiation and rooting culture, and positive SlHMGA3 gene mutation tomato plants are screened out by utilizing PCR and sequencing technology verification.

Sequencing shows that in the mutant tomato plant, slhmga3-1 lacks 6 bases at target 1 and lacks 4 bases at target 2, and slhmga3-2 inserts 1 base at target 1 and lacks 2 bases at target 2 (as shown in figure 3).

Example 4: delayed maturation trait observation of SlHMGA3 gene mutant material

The tomato SlHMGA3 mutant material prepared in example 3 (i.e. tomato plants with delayed fruit ripening) was subjected to marking during flowering, the flowering time was noted, the fruits were photographed just before the fruits enter the ripening stage, the ripening process was recorded (as shown in fig. 4), the time until the wild type and mutant materials reached the fruit broke (as shown in fig. 5) was counted, and the fruit color change was measured with a nikka color difference meter CR-400 (as shown in fig. 6).

Fruit ripening in the mutant tomato is significantly delayed compared to wild type, with a delay of 3 days for slhmga3-1 and 6 days for slhmga 3-2.

Example 5: determination of total chlorophyll content and total carotenoid content of tomato fruits

The color of tomato fruit is mainly related to the accumulation and relative proportion of chlorophyll, carotenoid and flavonoid in the peel and pulp, and the decrease of chlorophyll content and the increase of carotenoid content cause the tomato to turn from green to red.

Taking 5 tomato peels at the same stage as biological repetition, weighing 0.75g of sample, adding a small amount of quartz sand, calcium carbonate powder and 2mL of 95% ethanol, grinding into homogenate, adding 10mL of ethanol, continuously grinding until the tissue turns white, and standing for 5 min. Filtering into a 25mL brown volumetric flask, adding ethanol to a constant volume of 25mL, shaking, pouring the chloroplast pigment extract into a cuvette with an optical path of 1cm, and measuring absorbance at 665nm and 649nm with 95% ethanol as a blank.

The absorbance of the carotenoids was measured at 470 nm. Substituting the measured absorbance into the following equation:

Ca＝13.95A₆₆₅-6.88A₆₄₉；

Cb＝24.96A₆₄₉-7.32A₆₆₅；

C(X.C)＝(1000A₄₇₀-2.05Ca-114.8Cb)/245。

thus, the concentration (mg/L) of chlorophyll a, chlorophyll b and carotenoid can be obtained, and the sum of the chlorophyll a and the chlorophyll b is the total chlorophyll concentration. Finally, the content of chlorophyll or carotenoid in the plant tissue can be further calculated according to the following formula:

the chlorophyll content (mg/L) is (concentration of chlorophyll x volume of extract x dilution factor)/fresh weight (or dry weight) of the sample.

The results show that chlorophyll degradation (as shown in fig. 7) and carotenoid accumulation (as shown in fig. 8) processes in the fruit are delayed after knockout of SlHMGA3, further demonstrating that the fruit ripening process is delayed.

Example 6: determination of the ethylene Release from tomato fruits

Ethylene release amount is measured by adopting a Thermo Trace Ultra GC gas chromatograph, fresh fruits are picked and then are stood for 2 hours at room temperature, the ethylene release causing stress is avoided, 5 fruits at the same stage are a group of biological repetition, the fruits are respectively weighed and then are placed into a 50mL centrifuge tube, a sealing film is sealed, and the measurement is carried out after the fruits are stood for 8 hours. Chromatographic conditions are as follows: sample introduction temperature of 130 ℃, column temperature of 80 ℃, FID temperature of 230 ℃, N₂0.2Mpa, 0.2Mpa air, H₂0.2Mpa, the sample size is 10 mul. And after the baseline is stable, injecting 10 mu L of ethylene standard substance, making a standard curve, after the standard curve is made, extracting the gas in the sealed centrifuge bottle by using a 1ml syringe, injecting the gas into a machine for measurement, and repeating the technology for 3 times for each sample.

The results (as shown in FIG. 9) were similar to those of example 5, with the peak ethylene release time delayed for the slhmga3-1 and slhmga3-2 mutants compared to the wild type, and the highest peak was lower than that of the wild type. This result demonstrates that the SlHMGA3 gene can regulate fruit ripening through ethylene.

Example 7: ethylene synthesis gene, ethylene signal response gene and maturation associated transcription factor expression pattern analysis

Extracting RNA of fruits of wild type tomato, slhmga3-1 and slhmga3-2 mutant tomato at different time points (32dap, 36dap, 38dap, 42dap, 46dap and 50dap) in the fruit ripening process, carrying out reverse transcription on the RNA to obtain cDNA serving as a template, detecting the changes of expression levels of ethylene synthesis genes, signal response genes and ripening related transcription factors in tomato fruits by utilizing qRT-PCR (shown in figures 10-12), taking Actin as an internal reference gene and adopting 2^-ΔCTThe method, primer information is shown in Table 1 above. The expression of ethylene synthesis genes ACS2, ACS4 and ACO1 in the slhmga3-1 and slhmga3-2 mutants is delayed, and the highest expression level is lower than that of WT (as shown in figure 10); the expression delay of ethylene signal response genes ETR3, ETR4, CTR1, EIL3 and EIN2 in the slhmga3-1 and slhmga3-2 mutants is consistent with the expression trend of ethylene synthesis genes (as shown in FIG. 11); expression of maturation-related transcription factors E4 and E8 increased dramatically starting from 36dpa in the wild type fruit, whereas in the slhmga3 mutant this increase was delayed to 38dpa, induction of maturation-related transcription factors in the mutant fruit was delayed by approximately 3 to 6 days, and the greatest difference in WT and mutant occurred at 38dpa (as shown in figure 12). These results indicate that SlHMGA3 regulates ethylene transmission and some key transcription factors involved in maturation by regulating ethylene synthesis and signal-related genes, thereby regulating fruit maturation.

In addition, as is common general knowledge in the art, in SEQ ID NO: 1, the functional action of which is not affected by a certain change made by conventional means, such as substitution, deletion and/or addition of one or more nucleotides, and having a function of not changing the prokaryotic nucleotide sequence, a nucleotide sequence having the same function; or nucleotide sequences having more than 90% homology and encoding proteins having the same function.

Sequence listing

<110> Nanjing university of agriculture

Application of <120> tomato SlHMGA3 gene in cultivation of tomato with delayed fruit ripening

<141> 2021-05-28

<160> 5

<170> SIPOSequenceListing 1.0

<210> 1

<211> 974

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 1

tatatctgaa acgaattacc aactgtacga tcattctccc attgttgatt tcatccattt 60

aaatcctctt cttcctctgc catttttttc acagattttt gtttttctct gtaacaaaaa 120

tggctactga agaacataat ctaactttgc ctagttatcc tgatgttagt cacaattttt 180

tcaatttttt tttgctagtt ttggtaattt ttttttgtta acaattttgg taatttttgt 240

ttgtagatga ttatggaagc tatagatgcg ttgaatgaag aagaagggtc gaataaatca 300

gctatatgga agcaaattga agcgactcat ggtacactac caccagcgca tggtacactc 360

cttgcacatc atttgaatca aatgaagcaa gctgggcaat tagttatgtt gaagaacaac 420

tacatgaagc caaatccaaa cgcgccgccg cgccgtggta gaggccgtcc gccgaagccg 480

aaaagttcag ttccggtacc ggatgggtat cctagaccac gtggaaggcc accgaaggag 540

cgggatccgt acgcgccgat aacggtacct atgaagaaga cgagtgaggg tagctctggg 600

ggaagtggga agaagcgtgg aaggccaagg aagtatccga tgacggagga tacgccggtg 660

gtgaagccaa ttggtgctcc gagaggaaga ggaaggccgc cgaaggtgaa aactccggta 720

gctgcaactg taggggctta attgaagaaa gacgaattaa attagggact tgtatggcaa 780

aatatgctaa cttgttgttt ttcacttttt atctgttttg aattttcatg tttagtccct 840

gtagttttgt tttaattaca atttgtagga agaattgtgt gactttgtga gtgattttta 900

tcatgtaatt gggccaatgt aaatccaaat tgagggcttt ttatttatat ataaaaaaaa 960

aggttcagta ttat 974

<210> 2

<211> 179

<212> PRT

<213> tomato (Solanum lycopersicum)

<400> 2

Met Ala Thr Glu Glu His Asn Leu Thr Leu Pro Ser Tyr Pro Asp Met

1 5 10 15

Ile Met Glu Ala Ile Asp Ala Leu Asn Glu Glu Glu Gly Ser Asn Lys

20 25 30

Ser Ala Ile Trp Lys Gln Ile Glu Ala Thr His Gly Thr Leu Pro Pro

35 40 45

Ala His Gly Thr Leu Leu Ala His His Leu Asn Gln Met Lys Gln Ala

50 55 60

Gly Gln Leu Val Met Leu Lys Asn Asn Tyr Met Lys Pro Asn Pro Asn

65 70 75 80

Ala Pro Pro Arg Arg Gly Arg Gly Arg Pro Pro Lys Pro Lys Ser Ser

85 90 95

Val Pro Val Pro Asp Gly Tyr Pro Arg Pro Arg Gly Arg Pro Pro Lys

100 105 110

Glu Arg Asp Pro Tyr Ala Pro Ile Thr Val Pro Met Lys Lys Thr Ser

115 120 125

Glu Gly Ser Ser Gly Gly Ser Gly Lys Lys Arg Gly Arg Pro Arg Lys

130 135 140

Tyr Pro Met Thr Glu Asp Thr Pro Val Val Lys Pro Ile Gly Ala Pro

145 150 155 160

Arg Gly Arg Gly Arg Pro Pro Lys Val Lys Thr Pro Val Ala Ala Thr

165 170 175

Val Gly Ala

<210> 3

<211> 20

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 3

ggtacactac caccagcgca 20

<210> 4

<211> 20

<212> DNA

<213> tomato (Solanum lycopersicum)

<400> 4

gatgggtatc ctagaccacg 20

<210> 5

<211> 633

<212> DNA/RNA

<213> Artificial Sequence (Artificial Sequence)

<400> 5

ataagcttat gatttctttt ttcttacgaa ttttgcgtcc cacatcggta agcgagtgaa 60

gaaataactg ctttatatat ggctacaaag caccattggt caggtacact accaccagcg 120

cagttttaga gctagaaata gcaagttaaa ataaggctag tccgttatca acttgaaaaa 180

gtggcaccga gtcggtgctt ttttttttac tttaaatttt ttcttatgca gcctgtgatg 240

gataactgaa tcaaacaaat ggcgtctggg tttaagaaga tctgttttgg ctatgttgga 300

cgaaacaagt gaacttttag gatcaacttc agtttatata tggagcttat atcgagcaat 360

aagataagtg ggctttttat gtaatttaat gggctatcgt ccatagattc actaataccc 420

atgcccagta cccatgtatg cgtttcatat aagctcctaa tttctcccac atcgctcaaa 480

tctaaacaaa tcttgttgta tatataacac tgagggagca acattggtca cgtggtctag 540

gatacccatc gttttagagc tagaaatagc aagttaaaat aaggctagtc cgttatcaac 600

ttgaaaaagt ggcaccgagt cggtgctttt ttt 633

Claims

1. The application of the knockout tomato SlHMGA3 gene in culturing tomatoes with delayed fruit ripening is characterized in that the tomato SlHMGA3 gene comprises any one of the following nucleotide sequences:

(1) as shown in SEQ ID NO: 1;

2. A method for cultivating tomatoes with delayed fruit ripening is characterized by comprising the following steps:

(1) as shown in SEQ ID NO: 1;

3. The method for breeding tomatoes with delayed fruit ripening of claim 2, wherein the tomato SlHMGA3 knockout vector of step S1 is 2300GN-Ubi-Cas9-AtU3d-sgRNA1-AtU3b-sgRNA 2.

4. The method for cultivating tomatoes with delayed fruit ripening of claim 2 or 3, wherein the step S1 comprises the following steps:

5. The method for breeding tomatoes characterized in that the fruit delayed maturity of the tomato is set forth in step S11, wherein the sequence AtU3d-sgRNA1-AtU3b-sgRNA2 is shown in SEQ ID No. 5.

6. The method for producing tomato with delayed fruit ripening according to claim 2, wherein the host cell used in step S1 is a strain of Escherichia coli or Agrobacterium tumefaciens.

7. Use of the cultivation method as claimed in any one of claims 2 to 6 for cultivating tomatoes with delayed fruit ripening.