CN113684214B - Preparation and application of tumor vaccine based on attenuated listeria - Google Patents

Abstract

The present disclosure relates to the preparation and use of attenuated listeria-based tumor vaccines. In particular, the disclosure relates to a recombinant nucleic acid molecule, a recombinant plasmid or recombinant expression vector containing the recombinant nucleic acid molecule, a recombinant protein and a recombinant listeria. At the same time, the present disclosure also relates to pharmaceutical compositions, vaccines, and uses thereof comprising the above ingredients, and further provides methods of sustained killing of tumors and methods of inducing multi-target immune responses in a subject.

Description

Preparation and application of tumor vaccine based on attenuated listeria

Technical Field

The present disclosure relates generally to the field of biotechnology. In particular, the present disclosure provides for the preparation and use of a personalized tumor vaccine. More specifically, the present disclosure provides for the preparation and use of a multi-target personalized tumor vaccine based on attenuated listeria.

Background

In recent years, with the deep search for anti-tumor immune responses, tumor immune escape mechanisms, tumor microenvironment, etc., personalized tumor immunotherapy has become a very active field of cancer research [1]. The main research directions of the current personalized immunotherapy of tumors are tumor immune checkpoint inhibitors, adoptive cell immunotherapy, oncolytic viruses and tumor vaccines [2]. Tumor immune checkpoint inhibitors (Immune Checkpoint Inhibitors, ICIs) induce potent anti-tumor immune responses by eliminating immunosuppressive factors, and have shown exciting results in clinical therapies, but ICI has a low response rate to various cancer patients as a single drug [3-4]. Adoptive cellular immunotherapy (Adoptive Cell Transfer, ACT) involves isolation of immunocompetent cells from tumor patients, in vitro expansion and functional identification, and then delivery to patients, either directly killing the tumor or stimulating an immune response of the organism to kill the tumor, but ACT requires very high selection of appropriate targets, and the cost of reinfusion after cell in vitro culture expansion is quite significant [5-6]. Oncolytic viruses are a class of tumor killing viruses with replication capacity, which can selectively infect and replicate in tumor cells to kill the tumor cells and stimulate the body to generate specific anti-tumor immune response. At present, how to find safe doses capable of exerting the maximum anticancer effect and how to find suitable biomarkers to screen patients becomes a urgent need for oncolytic viruses [7]. Tumor vaccine overcomes the immunosuppression state caused by tumor by expressing specific tumor antigen (such as polypeptide, DNA, RNA, etc.) with immunogenicity, with the help of cytokine, chemotactic factor, etc., activates or strengthens the body's own anti-tumor immunity, induces body's cellular immunity and humoral immunity response, and further kills and eliminates tumor cells [8]. The main reasons for restricting the development of tumor vaccines are that the body has weak immunogenicity to self antigens and is easy to cause tumor immune tolerance and immune escape. The neoantigen is generated by the gene mutation of tumor cells, has tumor specificity and strong immunogenicity, and can induce the immune response of T cells, so that the development of the neoantigen is an important direction for the development of personalized tumor vaccines [9]. However, in personalized treatment, a plurality of neoantigens with higher scores are often selected as targets for treatment, so whether a personalized tumor vaccine carrier can efficiently load a plurality of targets becomes a key of technical implementation.

At the same time, the tumor treatment schemes existing in the prior art have the following defects:

for tumor immune checkpoint inhibitors, they cannot specifically activate tumor-specific T cell responses and ICI as a single drug has a low response rate to various cancer patients; for adoptive cell immunotherapy, the selection requirement on the suitable target point is very high, the tumor cells can not be effectively identified, and the cost of reinfusion after in-vitro culture and amplification of the cells is high; in the case of oncolytic viruses, the occurrence mechanism of the toxic and side effects of the oncolytic viruses is not clear, and the application of the oncolytic viruses to the immune system of the organism is greatly influenced.

Prior art literature:

[1]Topalian S L,Weiner G J,Pardoll D M.Cancer immunotherapy comes of age.[J].Nature Clinical Practice Oncology,2011,2(3):115.

[2]Yoshitaro Shindo,Shoichi Hazama,Ryouichi Tsunedomi.Novel technologies and emerging biomarkers for personalized cancer immunotherapy[J].Journal for ImmunoTherapy of Cancer,2016,4(1):3.

[3]Koji K.Advances in cancer immunotherapy for gastroenterological malignancy[J].Annals of Gastroenterological Surgery,2018,2(4):244-245.

[4]Hodi F S,O'Day S J,Mcdermott D F,et al.Improved Survival with Ipilimumab in Patients with Metastatic Melanoma[J].New England Journal of Medicine,2010,363(8):711-723.

[5]Rosenberg S A,Restifo N P,Yang J C,et al.Adoptive cell transfer:a clinical path to effective cancer immunotherapy[J].NATURE REVIEWS CANCER,2008,8(4):299-308.

[6]Rosenberg S A,Restifo N P.Adoptive cell transfer as personalized immunotherapy for human cancer[J].Science,2015,348(6230):62-68.

[7]Lun X,Yang W,Alain T,et al.Myxoma virus is a novel oncolytic virus with significant antitumor activity against experimental human gliomas.[J].Cancer Research,2005,65(21):9982-9990.

[8]Chakraborty N G,Chattopadhyay S,Mehrotra S,et al.Regulatory T-cell response and tumor vaccine-induced cytotoxic T lymphocytes in human melanoma[J].Human Immunology,2004,65(8):0-802.

[9]Ott P A,Hu Z,Keskin D B,et al.An immunogenic personal neoantigen vaccine for patients with melanoma[J].Nature,2017,547(7662):217.

disclosure of Invention

Problems to be solved by the invention

The invention constructs a non-integrated plasmid expression multi-target tumor vaccine based on listeria, which can improve the immunogenicity of tumor antigens, fully activate various tumor-specific T cells in vivo, simultaneously identify a plurality of targets of a certain tumor or different targets of various tumors, improve the curative effect of the tumor vaccine and lay a foundation for the application of the personalized tumor vaccine of the neoantigens.

Solution for solving the problem

The present disclosure provides the following technical solutions.

(1) A recombinant nucleic acid molecule comprising an open reading frame encoding a recombinant polypeptide comprising a heterologous antigen fused to a derivatized listeriolysin (LLO) polypeptide, wherein the amino acid sequence of the heterologous antigen is a polypeptide having the amino acid sequence depicted in SEQ ID No. 2 substituted, repeated, deleted, or added with one or more amino acids and having or partially having the activity of a heterologous antigen depicted in SEQ ID No. 2.

(2) The recombinant nucleic acid molecule according to (1), wherein the amino acid sequence of the heterologous antigen is a sequence having at least 80% identity to the amino acid sequence shown in SEQ ID NO. 2.

(3) The recombinant nucleic acid molecule according to any one of (1) - (2), wherein the nucleotide sequence encoding the heterologous antigen is as set forth in SEQ ID NO:1, and a sequence shown in 1.

(4) The recombinant nucleic acid molecule according to any one of (1) to (3), wherein the sequence of the recombinant nucleic acid molecule is as set forth in SEQ ID NO: 4.

(5) A recombinant plasmid or recombinant expression vector comprising the sequence of the recombinant nucleic acid molecule according to any one of (1) to (4).

(6) A recombinant protein encoded by the recombinant nucleic acid molecule of any one of (1) to (4), or formed by the recombinant plasmid or recombinant expression vector of (5).

(7) A recombinant Listeria comprising the recombinant nucleic acid molecule of any one of (1) - (4), or comprising the recombinant plasmid or recombinant expression vector of (5), or expressing the recombinant protein of (6).

(8) A pharmaceutical composition comprising a therapeutically effective amount of the recombinant Listeria according to (7).

(9) A prophylactic or therapeutic vaccine, characterized in that it comprises a prophylactically or therapeutically effective amount of the recombinant Listeria according to (7).

(10) The recombinant listeria of (7), (8) said pharmaceutical composition or (9) said vaccine for use in the manufacture of a medicament for killing cells.

(11) The use according to (10), wherein the cells are selected from the group consisting of proliferative, neoplastic, precancerous, or metastatic cells; preferably, the cell is selected from the group consisting of metastatic cells; more preferably, the metastatic cells are selected from metastatic tumor cells.

(12) The use of the recombinant listeria of (7), (8) said pharmaceutical composition or (9) said vaccine in the manufacture of a medicament for treating a patient with a tumor.

(13) A method of sustaining killing a cell comprising contacting said cell with (7) said recombinant listeria, (8) said pharmaceutical composition or (9) said vaccine; preferably, the cell is a tumor cell.

(14) A method of inducing an immune response in a subject, the method comprising administering to the subject: (7) The recombinant listeria, (8) the pharmaceutical composition or (9) the vaccine.

(15) An isolated peptide consisting of an amino acid sequence selected from the group consisting of those that are conservatively mutated and which comprise a sequence identical to SEQ ID NO:2 or SEQ ID NO:4, a sequence having at least 80% identity to the amino acid sequence of seq id no; or the amino acid sequence is selected from the group consisting of SEQ ID NOs: 2 or SEQ ID NO: 4.

(16) A nucleotide sequence for encoding the isolated peptide of (15).

ADVANTAGEOUS EFFECTS OF INVENTION

The patent provides a listeria personalized multi-target tumor vaccine method for simultaneously expressing a plurality of antigen peptides by non-integrated plasmids.

In one embodiment, the method is advantageous in that listeria harboring multiple tumor antigen targets can enhance an anti-tumor immune response.

In another embodiment, the method is further capable of simultaneously activating multiple tumor-specific T cells in the body, recognizing multiple targets for a tumor or recognizing different targets for multiple tumors, thereby inducing a multi-target immune response in the subject.

In another embodiment, the method can increase the efficacy of a tumor vaccine and drive the development of a personalized tumor vaccine against a neoantigen.

Drawings

FIG. 1 shows a plasmid map of a Listeria-expressed antigen gene;

FIG. 2 shows colony PCR detection of LM-LLO ₂₆₇ -MA2 vaccine sequence of interestDetection results, wherein M shows a 500bp DNA band reference; line 1-3 shows Lm 10403 S.DELTA.acta (pAM 401-LLO) respectively ₂₆₇ -MA 2-His) PCR product;

FIG. 3 shows Western blot verification of LM-LLO ₂₆₇ -protein expression of MA2 vaccine;

FIG. 4 shows Elispot validated Normal mice versus LM-LLO ₂₆₇ -activation of MA2 vaccine specific immune response;

FIG. 5 shows a tumor growth curve;

figure 6 shows the results of the Elispot response 7 days after cell therapy.

Detailed Description

Definition of the definition

The terms "a" or "an" when used in conjunction with the term "comprising" in the claims and/or specification may refer to "one" but may also refer to "one or more", "at least one" and "one or more".

As used in the claims and specification, the words "comprise," "have," "include" or "contain" mean including or open-ended, and do not exclude additional, unrecited elements or method steps. In the meantime, "comprising," "having," "including," or "containing" may also mean enclosed, excluding additional, unrecited elements or method steps.

Throughout this application, the term "about" means: one value includes the standard deviation of the error of the device or method used to determine the value.

Although the disclosure supports the definition of the term "or" as being inclusive of alternatives and "and/or", the term "or" in the claims means "and/or" unless expressly indicated otherwise as being exclusive of each other, as defined by the alternatives or alternatives.

When used in the claims or specification, the term "numerical range" is intended to include both the numerical endpoints of the range and all natural numbers covered in the middle of the numerical endpoints relative to the numerical endpoints.

The terms "inhibit," "reduce," or "prevent," or any variation of these terms, when used in the claims and/or specification, include any measurable reduction or complete inhibition to achieve a desired result (e.g., cancer treatment). Desirable outcomes include, but are not limited to, alleviation, diminishment, slowing or eradication of cancer or a proliferative disorder or cancer-associated symptoms, and improved quality of life or life prolongation.

The vaccination methods in the present disclosure are useful for treating cancer in a mammal. The term "cancer" as used in this disclosure includes any cancer, including but not limited to melanoma, sarcoma, lymphoma, carcinoma (e.g., brain cancer, breast cancer, liver cancer, stomach cancer, lung cancer, and colon cancer), and leukemia.

The term "mammal" in this disclosure refers to both human and non-human mammals.

The methods of the present disclosure comprise administering to a mammal a vaccine that expresses a tumor antigen to which the mammal has a pre-existing immunity. The term "pre-existing immunity" as used in the present disclosure is meant to include immunity induced by vaccination with an antigen as well as naturally occurring immunity in mammals.

The term "OVA" in the present disclosure refers to chicken Ovalbumin (ovabumin), also known as chicken Ovalbumin, consisting of 386 amino acids with a molecular weight of about 45kD.

The term "Phyy" in the present disclosure is a promoter of LLO (lysin) gene.

The term "vaccine" in the present disclosure is an immune preparation for preventing diseases, which is prepared by artificially attenuating, inactivating or using transgenes and the like, of pathogenic microorganisms (such as bacteria and the like) and metabolites thereof.

The term "radiotherapeutic agent" in the present disclosure includes the use of drugs that cause DNA damage. Radiation therapy has been widely used in cancer and disease treatment and includes those commonly referred to as gamma rays, X-rays and/or targeted delivery of radioisotopes to tumor cells.

The term "chemotherapeutic agent" in this disclosure is a chemical compound useful in the treatment of cancer. Classes of chemotherapeutic agents include, but are not limited to: alkylating agents, antimetabolites, kinase inhibitors, spindle poison plant alkaloids, cytotoxic/antitumor antibiotics, topoisomerase inhibitors, photosensitizers, anti-estrogens and selective estrogen receptor modulators, anti-progesterone, estrogen receptor down-regulators, estrogen receptor antagonists, luteinizing hormone releasing hormone agonists, anti-androgens, aromatase inhibitors, EGFR inhibitors, VEGF inhibitors, antisense oligonucleotides inhibiting expression of genes involved in abnormal cell proliferation or tumor growth. Chemotherapeutic agents useful in the methods of treatment of the present disclosure include cytostatic and/or cytotoxic agents.

The term "immunotherapeutic" in this disclosure includes "immunomodulators" and agents that promote or mediate antigen presentation that promote a cell-mediated immune response. Wherein an "immune modulator" comprises an immune checkpoint modulator, such as an immune checkpoint protein receptor and its ligand-mediated inhibition of T cell-mediated cytotoxicity, and is typically expressed on a tumor or non-responsive T cells in the tumor microenvironment, and allows the tumor to evade immune attack. Inhibitors of the activity of immunosuppressive checkpoint protein receptors and their ligands can overcome the immunosuppressive tumor environment to allow cytotoxic T cell attack of the tumor. Examples of immune checkpoint proteins include, but are not limited to, PD-1, PD-L1, PDL2, CTLA4, LAG3, TIM3, TIGIT and CD103. Modulation (including inhibition) of the activity of such proteins may be accomplished by immune checkpoint modulators, which may include, for example, antibodies, aptamers, small molecules, and soluble forms of checkpoint receptor proteins that target checkpoint proteins, and the like. PD-1 targeted inhibitors include approved pharmaceutical agents pembrolizumab (pembrolizumab) and nivolumab (nivolumab), while iplimumab (ipilimumab) is an approved CTLA-4 inhibitor. Antibodies specific for PD-L1, PD-L2, LAG3, TIM3, TIGIT and CD103 are known and/or commercially available and may also be generated by one of skill in the art.

The term "substitution, repetition, deletion, or addition of one or more amino acids" in the present disclosure includes "conservative mutations". The term "conservative mutation" in the present disclosure refers to a conservative mutation that can normally maintain the function of a protein. Representative examples of conservative mutations are conservative substitutions. Conservative substitutions are, for example, mutations that, when the substitution site is an aromatic amino acid, result in a mutual substitution between Phe, trp, tyr; a mutation which, when the substitution site is a hydrophobic amino acid, causes mutual substitution between Leu, ile, val; in the case of polar amino acids, a mutation by which Gln and Asn are substituted for each other; in the case of basic amino acids, a mutation by which the amino acids are substituted for each other between Lys, arg, his; in the case of acidic amino acids, a mutation by which Asp and Glu are substituted for each other; in the case of an amino acid having a hydroxyl group, a mutation is substituted between Ser and Thr. Specific examples of the substitution to be regarded as a conservative substitution include substitution of Ala to Ser or Thr, substitution of Arg to Gln, his or Lys, substitution of Asn to Glu, gln, lys, his or Asp, substitution of Asp to Asn, glu or Gln, substitution of Cys to Ser or Ala, substitution of Gln to Asn, glu, lys, his, asp or Arg, substitution of Glu to Gly, asn, gln, lys or Asp, substitution of Gly to Pro, substitution of His to Asn, lys, gln, arg or Tyr, substitution of Ile to Leu, met, val or Phe, substitution of Leu to Ile, met, val or Phe, substitution of Lys to Asn, glu, gln, his or Arg, substitution of Met to Ile, leu, val or Phe, substitution of Phe to Trp, tyr, met, ile or Leu, substitution of Ser to Thr or Ala, substitution of Thr to Ser or Ala, substitution of Trp to Phe or Tyr, substitution of Tyr to His, phe or Trp, and substitution of Val to Met, ile or Leu. In addition, conservative mutations include naturally occurring mutations resulting from individual differences, strains, species differences, and the like from which the gene is derived.

"sequence identity" and "percent identity" in the present disclosure refer to the percentage of nucleotides or amino acids that are identical (i.e., identical) between two or more polynucleotides or polypeptides. Sequence identity between two or more polynucleotides or polypeptides may be determined by: the nucleotide or amino acid sequences of the polynucleotides or polypeptides are aligned and the number of positions in the aligned polynucleotides or polypeptides that contain the same nucleotide or amino acid residue is scored and compared to the number of positions in the aligned polynucleotides or polypeptides that contain a different nucleotide or amino acid residue. Polynucleotides may differ at one position, for example, by containing different nucleotides (i.e., substitutions or mutations) or by deleting nucleotides (i.e., nucleotide insertions or nucleotide deletions in one or both polynucleotides). The polypeptides may differ at one position, for example, by containing different amino acids (i.e., substitutions or mutations) or by deleting amino acids (i.e., amino acid insertions or amino acid deletions in one or both polypeptides). Sequence identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of amino acid residues in the polynucleotide or polypeptide. For example, percent identity can be calculated by dividing the number of positions containing the same nucleotide or amino acid residue by the total number of nucleotide or amino acid residues in the polynucleotide or polypeptide and multiplying by 100.

In one aspect of the disclosure, the MA2 antigen peptide sequence and the sequence as set forth in SEQ ID NO:2, having at least 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% sequence identity (including all ranges and percentages between these values). In the present disclosure, a MA2 antigenic peptide sequence having a specific percentage of identity refers to a sequence encoding the MA2 antigenic peptide when the MA2 antigenic peptide is still present for its antigenic activity.

The "routine biological methods in the art" in the present disclosure can be referred to the corresponding methods described in the publications such as "the latest molecular biology laboratory method Assembly (Current Protocols in Molecular Biology, wiley publication)", "the molecular cloning laboratory Manual (Molecular Cloning: A Laboratory Manual, cold spring harbor laboratory publication)", and the like.

In the present disclosure, the numbers of nucleotides or amino acids indicated by different sequence numbers have the following meanings:

SEQ ID NO:1 is the nucleotide sequence of the MA2 antigen peptide;

SEQ ID NO:2 is the amino acid sequence of the MA2 antigen peptide;

SEQ ID NO:3 is the nucleotide sequence of LLO267-MA 2;

SEQ ID NO:4 is the amino acid sequence of LLO267-MA 2.

Examples

Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

Unless specifically indicated, all reagents and starting materials employed in the disclosure are commercially available.

Example 1: attenuated listeria carrying non-integrated G4S sequence as connecting sequence for connecting multiple antigen peptide plasmids Construction of bacterial strains and vectors

The strain used as vaccine in this study was Lm 10403S Δacta. The preparation methods of the aforementioned strains can be exemplified by the following documents: shen H et al, PNAS,92 (9): 3987-91, 1995. The bacterium lacks the actA gene, so that the bacterium infecting host cells cannot spread to adjacent cells through the special actin tail, thereby greatly weakening the toxicity and pathogenicity. Compared with the wild strain Lm 10403S (LD) ₅₀ 1x10 ⁴ ) LD of Lm- Δacta ₅₀ 0.5-1x10 ⁸ Proved to be highly attenuated.

The plasmids used for expression of the antigen genes in this study were essentially composed of: (as shown in FIG. 1)

(1) Basic sequence to maintain plasmid replication stability: pAM401;

(2) Promoters for transcription of antigen genes: phly, the promoter of the virulence island LLO on Lm chromosomes;

(3) Expression of signal peptide sequences secreting antigenic proteins outside listeria: LLO signal peptide (LLO 1-28 aa) and LLO half-cut gene for increasing the expression level of exogenous proteins;

(4) Listeria belongs to prokaryotic cells, while antigenic peptides which are usually required to be used as tumor vaccines belong to eukaryotic cells, and eukaryotic cell proteins can be expressed in the prokaryotic cells by performing corresponding codon optimization;

(5) Detecting the tag sequence of the secreted protein: flag tag or His tag;

cleavage site for antigen peptide insertion: pstI.

Example 2: construction of antigenic peptide plasmids

The construction of listeria vaccine plasmid requires that antigen genes are inserted into a plasmid vector, enzyme cutting sites are designed on the vector, and the gene sequence of target antigen is synthesized after gene codon optimization by a company. The composition for connecting 2 antigen peptides of mice by using G4S as linker is specifically shown below, and comprises Ovalbumin 257-264 and Tyrosinase related protein-2 180-188 antigen peptides, which are abbreviated as MA2.

We cloned the product into pAM401-phly-LLO using homologous recombination techniques based on certain homologous sequences _1-28 -LLO _22-267 -PstI-LLO _524-529 The PstI site on the His vector (abbreviated as PstI vector plasmid) to obtain pAM401-phly-LLO _1-28 -LLO _22-267 -PstI-MA2-PstI-LLO _524-529 His, abbreviated pAM401-LLO ₂₆₇ -MA2 vector plasmid and preparing LM-LLO267-MA2 vaccine.

The homologous sequences are: 5' terminal homologous sequence (CCGAAATATAGTAATAAACTGCAG); 3' homologous sequence (CTGCAGGTAGATAATCCAATCGAA)

The method mainly comprises the following steps:

PstI vector plasmid 20. Mu.L PstI Single cleavage System:

PstI plasmid	2ug
		PstI restriction endonuclease (NEB)	2μL
10x NEBuffer 3.1	2μL
		Deionized water	Supplement to 20 mu L

And (3) a water bath kettle at 37 ℃ for reaction for 30min.

DNA recovery and purification of 20. Mu.L of the digested product, namely, digestion linearization PstI vector

Homologous recombination 20 μl system:

ddH ₂ o: supplement to 20 mu L

The mixture was immediately placed on ice for 5 minutes in a water bath at 37℃and 100. Mu.L of E.coli competent was all transformed, and the resistance plate was coated and the monoclonal was selected for sequencing verification.

Example 3: preparation of attenuated listeria harboring non-integral antigenic peptide plasmids

The correct plasmid is converted into attenuated listeria strain by electrotransformation technology, and monoclonal is selected for subsequent plasmid and expression verification.

The specific steps of the electric conversion are as follows:

(1) Preparation of electrotransformation competence

a) Listeria cultured overnight was transferred to BHI medium and shake cultured at 37℃to OD ₆₀₀ A value of 0.2 to 0.25;

b) PNG was added and culture continued for about two hours to OD ₆₀₀ To 0.3-0.9;

c) After 10 minutes of ice bath, 5000g of the bacteria are collected centrifugally;

d) Re-suspending the cells with 200ml glycerol and washing twice;

e) The cells were resuspended in 45ml glycerol and added with sterile lysozyme solution, water bath at 37℃for 20 min;

f) Centrifuging 5000g to collect thalli at 4 ℃, and washing the thalli once with 20ml of glycerol;

g) The cells were resuspended in 1ml glycerol and stored in 50. Mu.L/tube aliquots.

(2) Determining the optimal electrotransformation conditions:

a) Taking a tube of competent cells, thawing with the heart, and placing on ice;

b) The plasmid to be transferred was added to competent cells, mixed well and ice-bathed for 5 min.

c) Adding the mixed system into a precooled 1mm electric rotating cup, and performing electric shock treatment;

d) Immediately adding the BHI culture medium, uniformly mixing, and taking out to an EP tube;

e) The bacterial cells were coated with BHI+ resistant plates, cultured upside down at 37℃and single colonies were picked for verification.

Example 4: improvement and detection of expression of exogenous protein of attenuated listeria harboring non-integral antigenic peptide plasmid

Listeria overnight was cultured in BHI broth at 37℃and centrifuged to remove the cells, and the supernatant was mixed with 3 volumes of 10% TCA (trichloroacetic acid)/acetone solution and precipitated overnight at-20 ℃. The precipitated protein was collected by centrifugation at 15000rpm for 30 minutes, washed twice with ice-chilled acetone, and the residual TCA was removed. Excess acetone was evaporated in the fume hood and the pellet was dissolved with protein loading buffer containing 0.01N NaOH. And (3) boiling the denatured protein, loading the denatured protein, and carrying out Western blot to detect the protein expression quantity through the flag tag or his tag received by the protein.

Collecting the strain with high expression, adding into DMSO frozen stock solution, preparing into LM-LLO267-MA2 vaccine, and preserving at-80deg.C.

Example 5: elispot to verify activation of specific immune response in normal mice to MA2 vaccine

Three normal C57 mice were inoculated with LM-LLO267-MA2 vaccine by tail vein, the mice were taken from all peripheral blood, red blood cells were lysed, PBS was washed twice to obtain peripheral blood mononuclear cells, and 1ml 1640 was used to complete the immunizationThe culture medium is resuspended for use. Taking lymph nodes and spleens of the cells, grinding a filter screen, staining the collected cells with CD8-PE dye, washing with PBS twice, incubating the collected cells and anti-PE magnetic beads on ice together, centrifuging, collecting, adsorbing the cells combined with the anti-PE magnetic beads on the magnetic column, removing the magnetic column from the magnetic frame, and collecting target cells, namely CD8+T cells. Lymph node T cells, spleen T cells were resuspended in 1640 complete medium, and 100 μl per well was added to Elispot pretreatment well plates, followed by the addition of 100 μl per well of mouse peripheral blood mononuclear cells. Then, the Tyrosinase related protein-2-180-188 polypeptide and the Ovalbumin 257-264 polypeptide are respectively added into an Elispot pore plate to stimulate T cells to generate INF-gamma, and finally, the spot number is quantified through an enzyme-linked reaction to indicate the specific immunoreaction condition of each group of response Tyrosinase related protein-2-180-188 polypeptide and OVA polypeptide (the specific Elispot experimental flow refers to BD ^TM ELISPOT Mouse IFN-gamma ELISPOT Set Specification, product No. 551083).

Example 6: molecular characterization of MA2 vaccine

LLO to be constructed ₂₆₇ The vector plasmid connected with MA2 is electrically transformed into LM competence, bacterial cells are coated on BHI chloramphenicol plates, single colonies are grown after the incubator is inverted and cultured at 37 ℃, and colony PCR verification is carried out on each group of single colonies.

The experimental results are shown in fig. 2, and the experimental group appears to be the target product which obviously accords with the actual size. Indicating that the plasmid has been electrotransformed into LM competence and can be used for vaccine preparation.

₂₆₇ Example 7: LM-LLO-MA2 vaccine expression verification

For accurate detection of LM-LLO ₂₆₇ Protein expression of MA2 vaccine, we verified by Western blot experiments by culturing different single colonies to precipitate the supernatant protein. The specific process comprises the following steps: colonies No. 1 and No. 2 of MA2 were picked up and added to a chloramphenicol-resistant BHI broth, followed by shaking culture for 14-16 hours, and centrifugation at 4500rpm to pellet the cells. 10ml of the supernatant was mixed with TCA/acetone solution and precipitated overnight. Centrifuging at 15000rpm to collect precipitate protein, pre-cooling with acetone, washing twice, and removing residueLeaving TCA. Volatilizing excessive acetone in a fume hood, dissolving precipitate with protein loading buffer solution, boiling, denaturing and preserving.

Preparing 10% of separating gel and 4% of concentrating gel respectively, loading 20 mu L of electrophoresis sample at each hole, and changing the joint of the electrophoresis sample and the separating gel of the concentrating gel into 120v. After electrophoresis was completed, the separation gel was taken, filter paper and 0.22um PVDF membrane (activated in methanol in advance) were cut to the same size as the gel, and a transfer ice bath was performed. 5% skim milk TBST was blocked and TBST was washed 3 times. Incubation with HRP-labeled Anti-His antibody at room temperature, TBST washing 3 times. ECL developer is dripped on the PVDF film, and the film is developed by a Bio-Rad gel imager.

The experimental results are shown in FIG. 3, LM-LLO ₂₆₇ The MA2 vaccine has significant protein expression.

₂₆₇ Example 8: verifying that a plurality of antigen peptides connected by using G4S sequence as connecting sequence in LM-LLO-MA2 are connected in vivo Specific antigen presentation, activation of specific T cells

We took three normal mice for intravenous LM-LLO at the tail ₂₆₇ After 7 days of immunization, taking mouse peripheral blood, lymph node T cells and spleen T cells for co-culture in an Elispot pore plate, taking the Ovalbumin 257-264 and Tyrosinase related protein-2-180-188 polypeptides as stimulators, and if a plurality of antigen peptides connected by taking a G4S sequence as a connecting sequence can be specifically presented, specific CD8+ T cells can be activated to secrete INF-gamma interferon so as to display spots in the Elispot, and taking co-cultured cells which are not stimulated by any polypeptides as negative controls. The specific process comprises the following steps: taking three normal C57 mice with LM-LLO inoculated at tail vein ₂₆₇ -MA2 vaccine, day 7 of immunization, taking all peripheral blood of the mice, lysing erythrocytes, washing twice with PBS to obtain peripheral blood mononuclear cells, and re-suspending with 1640 complete medium for later use. Taking lymph nodes and spleens of the cells, grinding a filter screen, staining the collected cells with CD8-PE dye, washing with PBS twice, incubating the collected cells and anti-PE magnetic beads on ice together, centrifuging, collecting, adsorbing the cells combined with the anti-PE magnetic beads on the magnetic column, removing the magnetic column from the magnetic frame, and collecting target cells, namely CD8+T cells. Will be sprayed withThe barely T cells, splenic T cells were resuspended in 1640 complete medium and 100. Mu.l per well was inoculated into Elispot pretreatment well plates, followed by the addition of 100. Mu.l per well of mouse peripheral blood mononuclear cells. Then, the Tyrosinase related protein-2-180-188 polypeptide and the Ovalbumin 257-264 polypeptide are respectively added into an Elispot pore plate to stimulate T cells to generate INF-gamma, and finally, the spot number is quantified through an enzyme-linked reaction to indicate the specific immunoreaction condition of each group responding to OVA polypeptide (the specific Elispot experimental flow refers to BD ^TM ELISPOT Mouse IFN-gamma ELISPOT Set Specification, product No. 551083).

As shown in FIG. 4, the results of experiments show that the Elispot with the Ovalbumin 257-264 and Tyrosinase related protein-2-180-188 polypeptides as the stimulus has obvious speckle reaction, which proves that the LM-LLO ₂₆₇ A plurality of antigen peptides connected by taking a G4S sequence as a connecting sequence in MA2 are presented by specific antigens in vivo, so that specific CD8+ T cells are activated to secrete INF-gamma interferon, and direct evidence is provided for in vivo anti-tumor multi-target personalized immune response.

₂₆₇ Example 9: demonstration that multiple antigen peptides connected by using G4S sequence as connecting sequence in LM-LLO-MA2 activate multiple antigen peptides Effectiveness of specific CD8+ T cells in killing tumor cells in vivo

Taking 15C 57 mice, subcutaneously inoculating B16-OVA to generate tumor, injecting LM-LLO ₂₆₇ MA2 vaccine verifies the anti-tumor effect. B16-OVA cell inoculum size was 2X 10 ⁶ Tumor measurements were started on day 4 post inoculation. The 15 mice were uniformly divided into three groups according to tumor size as follows:

/>

PBS control and LLO on day 9 ₂₆₇ The control group and MA2 experimental group are injected with vaccine, and the tumor size is continuously observed. Tumor persistence trackingThe measurement was carried out for 23 days.

Tumor curves are shown in FIG. 5, PBS control group and LLO ₂₆₇ The tumor growth of the mice in the control group is continuously increased along with the time, and the MA2 experimental group has relatively slow tumor growth from 12 days, and has obvious tumor inhibition effect.

₂₆₇ Example 10: detection of LM-LLO-MA2 vs. B16-OVA tumor model mice in vivo from functionality Using Elispot Activation of tumor-specific immune response

We obtained peripheral blood mononuclear cells by 3-7 drops from tail vein, lysing erythrocytes, and PBS washing twice on day 7 after cell therapy injection, and finally resuspended cells using 100 μl of 1640 complete medium, respectively, into Elispot pretreatment well plates. Peripheral blood mononuclear cells were then stimulated to produce INF-gamma by addition of OVA257-264, TRP-2 180-188 polypeptides in Elispot plates, and the spot numbers were finally quantified by ELISA to indicate the specific immune response of each group in response to OVA polypeptides (see BD for specific Elispot protocols ^TM ELISPOT Mouse IFN-gamma ELISPOT Set Specification, product No. 551083).

The experimental results are shown in FIG. 6, PBS control group and LLO ₂₆₇ The control group has no or a small amount of Elispot spot reaction, and the MA2 experimental group stimulated by OVA257-264 polypeptide and TRP-2 180-188 polypeptide has obvious Elispot reaction, which indicates that the LM-LLO ₂₆₇ The MA2 takes the G4S sequence as the connecting sequence to connect a plurality of antigen peptides which can be presented by specific antigens in vivo, thereby recognizing a plurality of targets of tumor and activating a plurality of specific CD8+T cells of mice to kill tumor cells, and improving the curative effect of tumor vaccine.

The above examples of the present disclosure are merely examples for clearly illustrating the present disclosure and are not limiting of the embodiments of the present disclosure. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. Any modifications, equivalent substitutions, improvements, etc. that fall within the spirit and principles of the present disclosure are intended to be included within the scope of the claims of the present disclosure.

Sequence listing

<110> Suzhou Ruotai pharmaceutical technology Co., ltd

Shanghai Ruotai Pharmaceutical Technology Co.,Ltd.

<120> preparation and use of an attenuated listeria-based tumor vaccine

<130> 6709-191365I-SH

<160> 4

<170> SIPOSequenceListing 1.0

<210> 1

<211> 531

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 1

ggtggtggcg gttcaggtgg tggtggcagc agcattatca actttgaaaa actgggcggc 60

ggcggttcag gtggtggtgg ctcaaaagtt gtgcgctttg ataaactggg cggtggtggt 120

agcggtggtg gtggtagcag cgtgtatgat ttttttgtgt ggctgggtgg tggtggttca 180

ggtggtggtg gcagccatta tttaagcacc cagagcgcgt taggcggtgg tggtagcggt 240

ggtggtggtt caactcctca tcctgcgcgt attggtttag gtggtggtgg tagcggtggt 300

ggtggtagcc ctagcaaacc gagctttcag gaatttgtgg attgggaaaa cgtgagcccg 360

gaactgaact caaccgatca gccgttttta ggcggtggtg gctcaggtgg tggtggtagc 420

ttacatagcg gccagaacca tctgaaagaa atggcgatta gcgtgttaga agcgcgtgca 480

tgtgcagcag caggtcaatc aggtggtggt ggttcaggtg gtggtggtag c 531

<210> 2

<211> 177

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 2

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Ile Ile Asn Phe Glu

1 5 10 15

Lys Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Lys Val Val Arg

20 25 30

Phe Asp Lys Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Val

35 40 45

Tyr Asp Phe Phe Val Trp Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly

50 55 60

Ser His Tyr Leu Ser Thr Gln Ser Ala Leu Gly Gly Gly Gly Ser Gly

65 70 75 80

Gly Gly Gly Ser Thr Pro His Pro Ala Arg Ile Gly Leu Gly Gly Gly

85 90 95

Gly Ser Gly Gly Gly Gly Ser Pro Ser Lys Pro Ser Phe Gln Glu Phe

100 105 110

Val Asp Trp Glu Asn Val Ser Pro Glu Leu Asn Ser Thr Asp Gln Pro

115 120 125

Phe Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Leu His Ser Gly

130 135 140

Gln Asn His Leu Lys Glu Met Ala Ile Ser Val Leu Glu Ala Arg Ala

145 150 155 160

Cys Ala Ala Ala Gly Gln Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly

165 170 175

Ser

<210> 3

<211> 1425

<212> DNA

<213> Artificial sequence (Artificial Sequence)

<400> 3

atgaaaaaaa taatgctagt ttttattaca cttatattag ttagtctacc aattgcgcaa 60

caaactgaag caaaggatgc atcggatcct actgaagcaa aggatgcatc tgcattcaat 120

aaagaaaatt caatttcatc catggcacca ccagcatctc cgcctgcaag tcctaagacg 180

ccaatcgaaa agaaacacgc ggatgaaatc gataagtata tacaaggatt ggattacaat 240

aaaaacaatg tattagtata ccacggagat gcagtgacaa atgtgccgcc aagaaaaggt 300

tacaaagatg gaaatgaata tattgttgtg gagaaaaaga agaaatccat caatcaaaat 360

aatgcagaca ttcaagttgt gaatgcaatt tcgagcctaa cctatccagg tgctctcgta 420

aaagcgaatt cggaattagt agaaaatcaa ccagatgttc tccctgtaaa acgtgattca 480

ttaacactca gcattgattt gccaggtatg actaatcaag acaataaaat cgttgtaaaa 540

aatgccacta aatcaaacgt taacaacgca gtaaatacat tagtggaaag atggaatgaa 600

aaatatgctc aagcttatcc aaatgtaagt gcaaaaattg attatgatga cgaaatggct 660

tacagtgaat cacaattaat tgcgaaattt ggtacagcat ttaaagctgt aaataatagc 720

ttgaatgtaa acttcggcgc aatcagtgaa gggaaaatgc aagaagaagt cattagtttt 780

aaacaaattt actataacgt gaatgttaat gaacctacaa gaccttcccc gaaatatagt 840

aataaactgc agggtggtgg cggttcaggt ggtggtggca gcagcattat caactttgaa 900

aaactgggcg gcggcggttc aggtggtggt ggctcaaaag ttgtgcgctt tgataaactg 960

ggcggtggtg gtagcggtgg tggtggtagc agcgtgtatg atttttttgt gtggctgggt 1020

ggtggtggtt caggtggtgg tggcagccat tatttaagca cccagagcgc gttaggcggt 1080

ggtggtagcg gtggtggtgg ttcaactcct catcctgcgc gtattggttt aggtggtggt 1140

ggtagcggtg gtggtggtag ccctagcaaa ccgagctttc aggaatttgt ggattgggaa 1200

aacgtgagcc cggaactgaa ctcaaccgat cagccgtttt taggcggtgg tggctcaggt 1260

ggtggtggta gcttacatag cggccagaac catctgaaag aaatggcgat tagcgtgtta 1320

gaagcgcgtg catgtgcagc agcaggtcaa tcaggtggtg gtggttcagg tggtggtggt 1380

agcctgcagg tagataatcc aatcgaacat catcatcatc atcat 1425

<210> 4

<211> 475

<212> PRT

<213> Artificial sequence (Artificial Sequence)

<400> 4

Met Lys Lys Ile Met Leu Val Phe Ile Thr Leu Ile Leu Val Ser Leu

1 5 10 15

Pro Ile Ala Gln Gln Thr Glu Ala Lys Asp Ala Ser Asp Pro Thr Glu

20 25 30

Ala Lys Asp Ala Ser Ala Phe Asn Lys Glu Asn Ser Ile Ser Ser Met

35 40 45

Ala Pro Pro Ala Ser Pro Pro Ala Ser Pro Lys Thr Pro Ile Glu Lys

50 55 60

Lys His Ala Asp Glu Ile Asp Lys Tyr Ile Gln Gly Leu Asp Tyr Asn

65 70 75 80

Lys Asn Asn Val Leu Val Tyr His Gly Asp Ala Val Thr Asn Val Pro

85 90 95

Pro Arg Lys Gly Tyr Lys Asp Gly Asn Glu Tyr Ile Val Val Glu Lys

100 105 110

Lys Lys Lys Ser Ile Asn Gln Asn Asn Ala Asp Ile Gln Val Val Asn

115 120 125

Ala Ile Ser Ser Leu Thr Tyr Pro Gly Ala Leu Val Lys Ala Asn Ser

130 135 140

Glu Leu Val Glu Asn Gln Pro Asp Val Leu Pro Val Lys Arg Asp Ser

145 150 155 160

Leu Thr Leu Ser Ile Asp Leu Pro Gly Met Thr Asn Gln Asp Asn Lys

165 170 175

Ile Val Val Lys Asn Ala Thr Lys Ser Asn Val Asn Asn Ala Val Asn

180 185 190

Thr Leu Val Glu Arg Trp Asn Glu Lys Tyr Ala Gln Ala Tyr Pro Asn

195 200 205

Val Ser Ala Lys Ile Asp Tyr Asp Asp Glu Met Ala Tyr Ser Glu Ser

210 215 220

Gln Leu Ile Ala Lys Phe Gly Thr Ala Phe Lys Ala Val Asn Asn Ser

225 230 235 240

Leu Asn Val Asn Phe Gly Ala Ile Ser Glu Gly Lys Met Gln Glu Glu

245 250 255

Val Ile Ser Phe Lys Gln Ile Tyr Tyr Asn Val Asn Val Asn Glu Pro

260 265 270

Thr Arg Pro Ser Pro Lys Tyr Ser Asn Lys Leu Gln Gly Gly Gly Gly

275 280 285

Ser Gly Gly Gly Gly Ser Ser Ile Ile Asn Phe Glu Lys Leu Gly Gly

290 295 300

Gly Gly Ser Gly Gly Gly Gly Ser Lys Val Val Arg Phe Asp Lys Leu

305 310 315 320

Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Val Tyr Asp Phe Phe

325 330 335

Val Trp Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser His Tyr Leu

340 345 350

Ser Thr Gln Ser Ala Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser

355 360 365

Thr Pro His Pro Ala Arg Ile Gly Leu Gly Gly Gly Gly Ser Gly Gly

370 375 380

Gly Gly Ser Pro Ser Lys Pro Ser Phe Gln Glu Phe Val Asp Trp Glu

385 390 395 400

Asn Val Ser Pro Glu Leu Asn Ser Thr Asp Gln Pro Phe Leu Gly Gly

405 410 415

Gly Gly Ser Gly Gly Gly Gly Ser Leu His Ser Gly Gln Asn His Leu

420 425 430

Lys Glu Met Ala Ile Ser Val Leu Glu Ala Arg Ala Cys Ala Ala Ala

435 440 445

Gly Gln Ser Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Leu Gln Val

450 455 460

Asp Asn Pro Ile Glu His His His His His His

465 470 475

Claims (17)

1. A recombinant nucleic acid molecule comprising an open reading frame encoding a recombinant polypeptide comprising a heterologous antigen fused to a derivatized listeriolysin (LLO) polypeptide, wherein the amino acid sequence of the heterologous antigen is a polypeptide having the activity of a heterologous antigen of the amino acid sequence shown in SEQ ID No. 2.

2. The recombinant nucleic acid molecule of claim 1, wherein the nucleotide sequence encoding the heterologous antigen is as set forth in SEQ ID NO:1, and a sequence shown in 1.

3. The recombinant nucleic acid molecule of claim 1 or 2, wherein the sequence of the recombinant nucleic acid molecule is as set forth in SEQ ID NO: 3.

4. A recombinant plasmid or recombinant expression vector comprising the sequence of the recombinant nucleic acid molecule of any one of claims 1-3.

5. A recombinant protein encoded by the recombinant nucleic acid molecule of any one of claims 1-3, or formed from the recombinant plasmid or recombinant expression vector of claim 4.

6. A recombinant listeria comprising the recombinant nucleic acid molecule of any one of claims 1-3, or comprising the recombinant plasmid or recombinant expression vector of claim 4, or expressing the recombinant protein of claim 5.

7. A pharmaceutical composition comprising a therapeutically effective amount of the recombinant listeria of claim 6.

8. A prophylactic or therapeutic vaccine, characterized in that it comprises a prophylactically or therapeutically effective amount of the recombinant listeria of claim 6.

9. Use of the recombinant listeria of claim 6, the pharmaceutical composition of claim 7 or the vaccine of claim 8 in the manufacture of a medicament for killing cells.

10. The use according to claim 9, wherein the cells are selected from proliferative, neoplastic, precancerous or metastatic cells.

11. The use according to claim 10, wherein the cells are selected from metastatic cells.

12. The use according to claim 11, wherein the metastatic cells are selected from metastatic tumor cells.

13. Use of the recombinant listeria of claim 6, the pharmaceutical composition of claim 7 or the vaccine of claim 8 in the manufacture of a medicament for treating a patient with a tumor.

14. A method of sustaining killing a cell comprising contacting the cell with the recombinant listeria of claim 6, the pharmaceutical composition of claim 7, or the vaccine of claim 8; the method is not aimed at diagnosis and treatment of diseases.

15. The method of claim 14, wherein the cell is a tumor cell.

16. An isolated peptide consisting of an amino acid sequence selected from the group consisting of SEQ ID NOs: 2 or SEQ ID NO: 4.

17. A nucleic acid molecule encoding the isolated peptide of claim 16.

Images