CN110579608B - Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein - Google Patents

Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein Download PDF

Info

Publication number
CN110579608B
CN110579608B CN201810597069.5A CN201810597069A CN110579608B CN 110579608 B CN110579608 B CN 110579608B CN 201810597069 A CN201810597069 A CN 201810597069A CN 110579608 B CN110579608 B CN 110579608B
Authority
CN
China
Prior art keywords
llo
listeria
asn
ova
lys
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN201810597069.5A
Other languages
Chinese (zh)
Other versions
CN110579608A (en
Inventor
代楠
关剑
赵勇刚
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Shanghai Ruotai Pharmaceutical Technology Co ltd
Suzhou Royaltech Med Co ltd
Original Assignee
Shanghai Ruotai Pharmaceutical Technology Co ltd
Suzhou Royaltech Med Co ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Shanghai Ruotai Pharmaceutical Technology Co ltd, Suzhou Royaltech Med Co ltd filed Critical Shanghai Ruotai Pharmaceutical Technology Co ltd
Priority to CN201810597069.5A priority Critical patent/CN110579608B/en
Publication of CN110579608A publication Critical patent/CN110579608A/en
Application granted granted Critical
Publication of CN110579608B publication Critical patent/CN110579608B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195—Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Landscapes

  • Life Sciences & Earth Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Molecular Biology (AREA)
  • Chemical & Material Sciences (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Biotechnology (AREA)
  • Analytical Chemistry (AREA)
  • Cell Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

The present disclosure relates to a method of screening for non-integrating attenuated listeria strains that highly express foreign proteins. In particular, the present disclosure relates to a method of detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria, a method of screening for a non-integrated attenuated listeria and non-integrated attenuated listeria obtained according to the screening method described above. The method has the advantages of short time consumption, simple operation and large sample detection amount, and can meet the requirement of rapidly and massively primary screening the produced samples while simultaneously producing a large number of samples. Even if obvious expression difference exists among the non-integrated listeria strains, the method disclosed by the invention can still realize rapid and large-scale screening of the non-integrated listeria strains, so that the listeria strains with optimal expression effects are obtained, and convenience is provided for preparation of non-integrated listeria vaccines.

Description

Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein
Technical Field
The present disclosure relates generally to the field of biotechnology. In particular, the present disclosure provides a method of screening for strains. More specifically, the present disclosure provides a method of screening for non-integrating attenuated listeria strains that highly express a foreign protein.
Background
Listeria monocytogenes (Lm) is an important food-borne pathogenic bacterium, and may cause serious Listeria diseases for the elderly, children, pregnant women, and immunosuppressed people [1 ]. Listeria, a gram-positive intracellular parasite, can survive and multiply in epithelial and phagocytic cells. Due to its unique infection process, listeria can induce inflammatory response and activate the combination of MHC class I and class II antigen presentation pathways at the same time, making listeria a vaccine vector with great application prospects [2-4 ].
At present, there are two main international approaches for constructing tumor vaccines by using attenuated LM strains as vectors: integrative and non-integrative listeria vaccines [5 ]. The integrative listeria vaccine usually uses recombinant plasmid to integrate exogenous gene into listeria genome at fixed point by homologous recombination technology, has the advantages of stable exogenous protein expression, obvious activation of organism specific immune response and the like in application, but has the defects of long vaccine construction period, complicated integrative construction and screening process and the like, thereby prolonging the vaccine preparation period and being not beneficial to clinical personalized treatment. In contrast, non-integrated listeria vaccines are constructed only by plasmid electrotransformation, and have simple and rapid process, short vaccine preparation period, and the like, which can secrete and express foreign proteins and effectively activate specific immune responses of organisms [6-8 ]. However, the inventors found that due to the random number of plasmids electrically transformed into Listeria, significant expression differences exist among single colonies in the same culture plate after screening by using antibiotics, and finally, the treatment effects of vaccines in different batches are different. Therefore, the search and establishment of a technology capable of rapidly screening the Listeria strains with high expression foreign genes in large quantity lays a foundation for the application of the non-integrated Listeria vaccine.
The Western blotting (Western blotting) technology is the most widely used experimental technology in the present protein expression and analysis research, combines the traditional high-resolution sodium dodecyl sulfate-polyacrylamide (SDS-PAGE) electrophoresis with the immunodetection technology with high sensitivity and strong specificity, analyzes the expression of the target protein most effectively, and plays an important role in molecular biology. A sample is separated after SDS-PAGE gel electrophoresis, proteins in the gel are transferred to a chemically inert macromolecule transfer membrane by an electroblotting method, then a primary antibody (primary antibody) specific to a target protein is subjected to an immune binding reaction with the target protein on the transfer membrane, a secondary antibody (secondary antibody) marked (such as HRP) is combined with the primary antibody, and qualitative and semi-quantitative analysis of the target protein is completed by detecting a secondary antibody marker, so that the method has the advantages of high sensitivity, strong specificity and the like [9-10 ]. Dot blotting (Dot blotting) is a method of detecting antibody immunological binding directly on a membrane. The method omits the step of electrophoretic separation, and belongs to the simplified Western blot, northern blot and the like which can be used for detecting DNA, RNA and protein. In addition, the method allows quantification of protein concentration by direct measurement of radioactivity counts for isotopically labeled probes or indirect autoradiography and photometric density values for enzymatically labeled probes [11 ]. The method has no electrophoretic separation step, so that the size of the protein in the sample cannot be detected, but the method is suitable for coarse screening of the sample due to simple and quick experimental process and capability of simultaneously detecting a large number of samples, and is widely applied to the fields of rapid detection of food, screening and evaluation of antibody effectiveness and the like [12-13 ]. In protein expression detection, the Western blot technology has complicated experimental process and long experimental time consumption, and in Listeria expression detection, the Western blot experiment needs large sample preparation amount, complex preparation operation and small sample preparation amount in a single time, and is not beneficial to rapid coarse screening of mass samples.
Because the above problems still exist in the existing schemes, there is a need to provide a method for rapidly screening non-integrated attenuated listeria strains with high expression of foreign proteins, so as to solve the problem that the listeria strains may have differential expression among the colonies generated in the process of preparing the listeria strains.
Documents of the prior art
[1]Ramaswamy V,Cresence V J,Lekshmi M,et al.Listeria-review of epidemiology and pathogenesis[J].Journal of microbiology,immunology,and infection＝Wei mian yu gan ran za zhi,2007,40(1):4.
[2]Cossart,P.,J.Pizarro-Cerda,and M.Lecuit,Invasion of mammalian cells by Listeria monocytogenes:functional mimicry to subvert cellular functions.Trends Cell Biol,2003.13(1):p.23-31.
[3]Mengaud,J.,et al.,Identification of the structural gene encoding the SH-activated hemolysin of Listeria monocytogenes:listeriolysin O is homologous to streptolysin O and pneumolysin.Infect Immun,1987.55(12):p.3225-7.
[4]Tilney,L.G.and D.A.Portnoy,Actin filaments and the growth,movement,and spread of the intracellular bacterial parasite,Listeria monocytogenes.J Cell Biol,1989.109(4Pt 1):p.1597-608.
[5]Singh R,Wallecha A.Cancer immunotherapy using recombinant Listeria monocytogenes:transition from bench to clinic.[J].Hum Vaccin,2011,7(5):497-505.
[6]Singh R,Paterson Y.as a vector for tumor-associated antigens for cancer immunotherapy[J].Expert Review of Vaccines,2006,5(4):541.
[7]Wood L M,Paterson Y.Attenuated Listeria monocytogenes:a powerful and versatile vector for the future of tumor immunotherapy[J].Front Cell Infect Microbiol,2014,4:51.
[8] The current development situation of a Listeria monocytogenes vaccine of Liwengui, Chenyabae and recombinant Listeria monocytogenes [ J ]. J.J.China pathogenic biology, 2013(1):80-86.
[9]Burnette W N.Western blotting:Electrophoretic transfer of proteins from SDS-PAGE to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A[J].Analytical Biochemistry,1981,112(2):195.
[10]Towbin H,Staehelin T,Gordon J.Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets:procedure and some applications.[J].Analytical Biochemistry,1979,102(2):459-471.
[11]Towbin H,Gordon J.Immunoblotting and dot immunobinding—Current status and outlook[J].Journal of Immunological Methods,1984,72(2):313.
[12]Cardona-Castro N,Gotuzzo E,Rodriguez M,et al.Clinical application of a dot blot test for diagnosis of enteric fever due to Salmonella enterica serovar typhi in patients with typhoid fever from Colombia and Peru[J].Clinical&Diagnostic Laboratory Immunology,2000,7(2):312.
[13]Moeremans M,Daneels G,Dijck A V,et al.Sensitive visualization of antigen-antibody reactions in dot and blot immune overlay assays with immunogold and immunogold/silver staining[J].Journal of Immunological Methods,1984,74(2):353-60.
Disclosure of Invention
Problems to be solved by the invention
Based on the defects in the prior art, the method for rapidly screening the non-integrated attenuated Listeria strain with high expression foreign protein is provided, the problem of differential expression among colonies is well solved, and a foundation is laid for the clinical application of the Listeria vaccine.
Means for solving the problems
In one embodiment, the present disclosure provides a method of detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria comprising the steps of:
(1) mixing the listeria monocytogenes and a protein precipitator to obtain a mixed solution; uniformly mixing the mixed solution and precipitating;
(2) collecting the foreign protein precipitate in the precipitate;
(3) dissolving the exogenous protein precipitate by a protein loading buffer solution to obtain an exogenous protein dissolving solution;
(4) after the exogenous protein dissolving solution is denatured, spotting on a spotting membrane, and air-drying; adding sealing liquid for sealing;
(5) incubating the sample application membrane with a substance capable of reacting with the foreign protein and having a detection label;
(6) dripping a developing solution on the incubated sample application membrane, and developing by a developing device;
(7) the amount of the foreign protein expressed by the non-integrated attenuated listeria was detected by visualization.
In one embodiment, the present disclosure provides a method of detecting the amount of a foreign protein expressed by a non-integrating attenuated listeria, wherein said non-integrating attenuated listeria comprises a recombinant nucleic acid molecule encoding an open reading frame for a recombinant polypeptide comprising a heterologous antigen fused to a derivative listeriolysin (LLO) polypeptide, said recombinant nucleic acid molecule further comprising a first promoter sequence; wherein, the derived listeriolysin (LLO) polypeptide is selected from the polypeptide which is obtained by substituting, repeating, deleting or adding one or more amino acids in the amino acid sequence shown in SEQ ID NO. 3 and has or partially has the activity of the listeriolysin (LLO) polypeptide shown in SEQ ID NO. 1. Optionally, the derived listeriolysin (LLO) polypeptide is a polypeptide as shown in SEQ ID No. 3.
In one embodiment, the present disclosure provides a method for detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria, wherein said non-integrated attenuated listeria comprises a recombinant nucleic acid molecule comprising an amino acid sequence encoding said derived listeriolysin (LLO) polypeptide and a nucleic acid sequence encoding a polypeptide as set forth in SEQ ID NO:1, has at least 80%, preferably at least 90%, more preferably at least 95%, most preferably at least 97% identity compared to the amino acid sequence of the listeriolysin (LLO) polypeptide. Optionally, the derived listeriolysin (LLO) polypeptide is a polypeptide as shown in SEQ ID No. 3.
In one embodiment, the present disclosure provides a method for detecting the amount of a heterologous protein expressed by a non-integrating attenuated listeria, wherein said non-integrating attenuated listeria comprises a recombinant nucleic acid molecule encoding an open reading frame for a recombinant polypeptide comprising a heterologous antigen fused to a derivative listeriolysin (LLO) polypeptide, wherein said heterologous antigen is selected from a tumor antigen or a non-tumor antigen; optionally, the non-tumor antigen is selected from OVA or a fragment having OVA function.
In one embodiment, the present disclosure provides a method of detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria, wherein said non-integrated attenuated listeria comprises a recombinant nucleic acid molecule further comprising a linker sequence linking a nucleotide sequence encoding said derived listeriolysin (LLO) polypeptide and a nucleotide sequence encoding said heterologous antigen; wherein the heterologous antigen is selected from a tumor antigen or a non-tumor antigen. Optionally, the linker sequence comprises a nucleotide sequence encoding the sequence shown as SEQ ID NO 16; optionally, the linker sequence comprises one, two, or more than three repeats of the sequence shown in SEQ ID NO 16. Optionally, linked to the nucleotide sequence of the derived listeriolysin (LLO) polypeptide, the amino acid sequence encoded by the linker sequence comprising the heterologous antigen is set forth in SEQ ID No. 14 or SEQ ID No. 15.
In one embodiment, the present disclosure provides a method of detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria, wherein said non-integrated attenuated listeria comprises a recombinant nucleic acid molecule comprising a promoter sequence selected from the group consisting of a sequence encoding the Phly gene; optionally, the recombinant nucleic acid molecule further comprises a tag sequence for detection or a gene encoding a metabolite; preferably, the metabolite is selected from the group consisting of secondary metabolites.
In one embodiment, the present disclosure provides a method of detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria, wherein the protein precipitating agent is selected from a TCA/acetone solution.
In one embodiment, the present disclosure provides a method for detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria, wherein, after obtaining a precipitate of the foreign protein, the foreign protein precipitate is removed of impurity components prior to dissolving the foreign protein precipitate; optionally, the impurity component is selected from TCA and/or acetone.
In another embodiment, the present disclosure provides a method for screening non-integrated attenuated listeria, wherein the amount of the foreign protein expressed by the non-integrated attenuated listeria detected by the aforementioned detection method is compared to screen non-integrated attenuated listeria with higher expression level of the foreign protein.
ADVANTAGEOUS EFFECTS OF INVENTION
The plasmid pAM401 adopted by the method is very stable in the process of multiple passages of Listeria, and the phenomenon of plasmid loss or mutation is not found after 10-20 passages, so that the plasmid pAM can be safely used for vaccine construction. The expression transcription of the antigen gene selects a promoter Phly carried by Listeria LLO, the promoter is stable and efficient, and the gene which is constructed by transcription and translation and is used for coding the heterologous antigen can be well started. Meanwhile, with the signal peptide sequence of the LLO, after the vaccine infected cell escapes out of the lysosome, the expressed protein is secreted into the bacterial extracellular plasma to induce the cellular immune response. Optionally, a protein detection tag, such as Flag or His tag, is added to the plasmid for detection of protein expression secretion.
Optionally, the vector construction method adopted by the disclosure and the vector obtained by the method can be free from the influence of enzyme cutting sites on the heterologous antigen, and are convenient to operate, high in insertion efficiency and accurate in insertion.
Optionally, in the technical scheme adopted by the disclosure, in the design optimization of the antigen peptide, the expression characteristics of listeria are met according to the codon preference of escherichia coli as an optimization standard, and the antigen peptide optimally designed by the method can be expressed in listeria and has good stability. The listeria carried heterologous antigen can be efficiently secreted into host cells to fully activate specific tumor immune response, and theoretically obtain better treatment effect.
Optionally, the technical scheme adopted by the disclosure greatly improves the expression of the non-integrated listeria tumor vaccine antigen peptide, so that the antigen peptide has a more prominent effect on anti-tumor immune response.
The present disclosure employs a method for rapid screening of non-integrated transfected listeria strains with high expression of foreign genes. Compared with the Western blot technology used in the conventional protein expression detection, the method disclosed by the invention is short in time consumption, simple in operation and large in sample detection amount, and can meet the requirement of rapidly and massively primary screening the produced samples while simultaneously producing a large number of samples.
Optionally, even if there is an obvious expression difference between the non-integrated listeria strains, the method disclosed by the present disclosure can still realize rapid mass screening of the non-integrated listeria strains, thereby obtaining the listeria strains with the optimal expression effect, and providing convenience for the preparation of non-integrated listeria vaccines.
Drawings
FIG. 1 shows the differences in the expression levels of proteins expressed by single colonies formed by the different strains described above when preparing non-integrated Listeria strains. Wherein M represents a 250KDa protein ladder standard reference substance; lanes 1-5 show Lm10403S Δ actA (pAM 401-LLO), respectively1-28-LLO22-523-(G4S)2-E7peptide-LLO524-529His) supernatant protein pellet concentrates on colonies No. 1-5 on the plate.
FIG. 2 shows LM10403S Δ actA (pAM 401-LLO) detection using the method of the present disclosure1-28-LLO22-267-PstI-LLO524-529His) differences in protein expression between different single colonies. Wherein, sequences No. 1-8 show LM10403 S.DELTA.acta (pAM 401-LLO)1-28-LLO22-267-PstI-LLO524-529His) plate 1-8 colony culture 1ml supernatant protein precipitate concentrate.
FIG. 3 shows LM10403S Δ actA (pAM 401-LLO) detection using the method of the present disclosure1-28-LLO22-267-PstI-LLO524-529His) expression differences of proteins among different single colonies. Wherein, sequences No. 1-8 show LM10403 S.DELTA.acta (pAM 401-LLO)1-28-LLO22-523-(G4S)2-OVA28-LLO524-529His) plate 1-8 colony culture 1ml supernatant protein precipitate concentrate.
FIG. 4 shows LM10403S Δ actA (pAM 401-LLO) detection using the method of the present disclosure1-28-LLO22-523-(G4S)2-NY-ESO-1-LLO524-529His) differences in protein expression between different single colonies. Wherein, sequences No. 1-8 show LM10403 S.DELTA.acta (pAM 401-LLO)1-28-LLO22-523-(G4S)2-NY-ESO-1-LLO524-529His) plate 1-8 colony culture 1ml supernatant protein precipitate concentrate.
FIG. 5 shows LM10403S Δ actA (pAM 401-LLO) detection using the method of the present disclosure1-28-LLO22-523-(G4S)2-OVA28-LLO524-529His) expression of the protein expressed by bacteria No. 1 to 6.
FIG. 6 shows that LM10403 S.DELTA.acta (pAM 401-LLO) was detected by Western blot method1-28-LLO22-523-(G4S)2-OVA28-LLO524-529His) expression of the protein expressed by bacterium No. 2, No. 4, and No. 6.
FIG. 7 shows LM10403S Δ actA (pAM 401-LLO) detection using the method of the present disclosure1-28-LLO22-267-(G4S)2-E7-LLO524-529His) expression of the protein expressed by bacteria Nos. 1 to 8.
FIG. 8 shows LM10403S Δ actA (pAM 401-LLO) detection using the method of the present disclosure1-28-LLO22-267-(G4S)2-E7-LLO524-529His) expression of a protein expressed by a progeny strain of bacterium No. 1.
FIG. 9 shows the effect of LLO full length and conventional LLO signal peptide on foreign protein expression.
FIG. 10 shows the effect of different sizes of antigenic peptides and the presence or absence of the G4S sequence on the expression vector.
FIG. 11 shows the results of tumor curves obtained by subcutaneous inoculation of mice with EG7-OVA to generate tumors, followed by treatment with tumor vaccines.
FIG. 12 shows the test results of tumor generation by mice subcutaneously inoculated with EG7-OVA and treated with tumor vaccine (T test analysis).
Figure 13 shows the activation of Lm OVA vaccine on specific immune responses in mice by ELISPOT.
FIG. 14 shows tetramer experimental validation OVA28Tumor vaccines are specifically immunoreactive in mice.
FIG. 15 shows the detection of OVA28Effective dose of tumor vaccine and activation of tumor-specific immune response in mice (tumor size growth curve results).
FIG. 16 shows the detection of OVA28Effective dose of tumor vaccine and activation of tumor-specific immune response in mice (ELISPOT test results).
FIG. 17 shows OVA28The drug effect of the tumor vaccine is compared with that of the OVA-integrated listeria vaccine (the result of the tumor size growth curve).
FIG. 18 shows OVA28The tumor vaccine was compared with OVA-integrated Listeria vaccine for efficacy (ELISPOT test results after 7 days).
FIG. 19 shows OVA28The tumor vaccine was compared with OVA-integrated Listeria vaccine for efficacy (ELISPOT test results after 12 days).
FIG. 20 shows OVA28The tumor vaccine was the validation result (plate-coated result) of the non-integrative OVA listeria vaccine.
FIG. 21 shows OVA28The tumor vaccine is the verification result of the non-integrative OVA listeria vaccine (the identification result of agarose gel electrophoresis).
FIG. 22 shows OVA28The tumor vaccine is the verification result of the non-integrative OVA listeria vaccine (the identification result of agarose gel electrophoresis).
Detailed Description
Definition of
The terms "a" or "an" when used in conjunction with the term "comprising" in the claims and/or the specification can mean "one," but can also mean "one or more," at least one, "and" one or more than one.
As used in the claims and specification, the terms "comprising," "having," "including," or "containing" are intended to be inclusive or open-ended and do not exclude additional, unrecited elements or method steps.
Throughout this specification, the term "about" means: a value includes the standard deviation of error for the device or method used to determine the value.
Although the disclosure supports the definition of the term "or" as merely an alternative as well as "and/or," the term "or" in the claims means "and/or" unless expressly indicated to be merely an alternative or a mutual exclusion between alternatives.
When used in the claims or specification, the term "range of values" is selected/preferred to include both the end points of the range and all natural numbers subsumed within the middle of the end points of the range with respect to the aforementioned end points of values.
The term "TCA/acetone solution" in this disclosure refers to a mixture of TCA and acetone.
The term "NY-ESO-1 antigen" in this disclosure refers to the New York esophageal squamous carcinoma antigen 1.
The term "E7 polypeptide" in the present disclosure refers to an E7 polypeptide derived from Human Papilloma Virus (HPV).
The term "OVA" in the present disclosure refers to chicken egg albumin (Ovalbumin), also known as chicken egg albumin, consisting of 386 amino acids, having a molecular weight of about 45 kD.
The term "Phyy" in this disclosure is a promoter encoding the LLO (lysin) gene.
The term "vaccine" in the present disclosure is an immune preparation for preventing diseases, which is prepared from pathogenic microorganisms (such as bacteria, etc.) and metabolites thereof by artificial attenuation, inactivation, or using transgenosis, etc.
The term "substitution, repetition, deletion or addition of one or more amino acids" in the present disclosure includes "conservative mutation". The term "conservative mutation" in the present disclosure refers to a conservative mutation that can normally maintain the function of a protein. A representative example of conservative mutations is conservative substitutions. Conservative substitution refers to, for example, a mutation in which Phe, Trp, Tyr are substituted for each other when the substitution site is an aromatic amino acid; a mutation wherein Leu, Ile and Val are substituted with each other when the substitution site is a hydrophobic amino acid; a mutation wherein Gln and Asn are substituted with each other in the case of a polar amino acid; a mutation wherein Lys, Arg and His are substituted with each other in the case of a basic amino acid; a mutation wherein Asp and Glu are substituted with each other in the case of an acidic amino acid; in the case of an amino acid having a hydroxyl group, the amino acid is substituted for Ser or Thr. Examples of the substitution regarded as conservative substitution include substitution of Ala with Ser or Thr, substitution of Arg with Gln, His or Lys, substitution of Asn with Glu, Gln, Lys, His or Asp, substitution of Asp with Asn, Glu or Gln, substitution of Cys with Ser or Ala, substitution of Gln with Asn, Glu, Lys, His, Asp or Arg, substitution of Glu with Gly, Asn, Gln, Lys or Asp, substitution of Gly with Pro, substitution of His with Asn, Lys, Gln, Arg or Tyr, substitution of Ile with Leu, Met, Val or Phe, substitution of Leu with Ile, Met, Val or Phe, substitution of Lys with Asn, Glu, Gln, His or Arg, substitution of Met with Met, Leu, Val or Phe, substitution of Phe with Trp, Tyr, Met, Ile or Leu, substitution of Ser with Thr or Ala, substitution of Thr with Ser or Ala, substitution of Trp with Phe, Tyr, His, Val or Phe, and substitution of Met with Phe or Phe. Furthermore, conservative mutations include naturally occurring mutations due to individual differences in the origin of the gene, differences in strain, species, and the like.
"methods in general Biology in the art" in the present disclosure can be referred to corresponding methods described in publications such as "Current Protocols in Molecular Biology, Wiley publication", "Molecular Cloning, A Laboratory Manual, Cold spring harbor Laboratory publication", and the like.
Technical scheme
In the technical scheme of the disclosure, the meanings represented by the numbers of the nucleotide and amino acid sequence table in the specification are as follows:
SEQ ID NO. 1 shows the nucleotide sequence of wild-type Listeriolysin LLO (LLO)529)
SEQ ID NO:2 shows the amino acid sequence (LLO) of wild-type Listeriolysin LLO529)
SEQ ID NO 3 shows a nucleotide sequence (LLO) of recombinant listeriolysin LLO540)
SEQ ID NO. 4 shows an amino acid sequence (LLO) of recombinant listeriolysin LLO540)
SEQ ID NO. 5 shows LLO28Amino acid sequence of (1)
SEQ ID NO 6 shows LLO28Nucleotide sequence of (A)
SEQ ID NO 7 shows OVA28Nucleotide sequence of (A)
SEQ ID NO 8 shows OVA28Amino acid sequence of (1)
SEQ ID NO 9 shows OVA8Amino acid sequence of (1)
SEQ ID NO 10 shows OVA8Nucleotide sequence of (A)
11 shows the 5' homologous nucleotide sequence
The 3' homologous nucleotide sequence is shown in SEQ ID NO. 12
SEQ ID NO 13 shows the amino acid sequence of the linker sequence
SEQ ID NO. 14 shows OVA8Amino acid sequence linked to a linker sequence
SEQ ID NO 15 shows OVA28Amino acid sequence linked to a linker sequence
16 is the amino acid sequence of the E7 polypeptide
17 shows the nucleotide sequence of the E7 polypeptide
18 is the amino acid sequence of NY-ESO-1 polypeptide shown in SEQ ID NO
SEQ ID NO 19 shows the nucleotide sequence of NY-ESO-1 polypeptide
20 shows LLO22-267Amino acid sequence of (1)
Shown in SEQ ID NO 21 is LLO22-267Nucleotide sequence of (A)
Examples
Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific examples, while indicating specific embodiments of the disclosure, are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.
Unless specifically stated to the contrary, all examples of the present disclosure relate to technical solutions wherein the insertion site of the antigenic peptide is located between amino acids 523 and 524 relative to the amino acid sequence of the wild-type LLO polypeptide as set forth in SEQ ID No. 1.
All reagents and starting materials used in this disclosure are commercially available unless otherwise indicated.
The main reagents used in the present disclosure are as follows:
ECl chemiluminescence hypersensitivity color development kit (BIORAD); TBST Buffer (BIORAD); brain-heart infusion broth BHI (cantonese microbiology co., ltd); plasmid miniprep kit PLASMID MINIPREP KIT 250-prep (axygen); q5PCR high fidelity enzyme (NEB).
The reagents used in the examples are commercially available products unless otherwise specified.
Example 1: solid and liquid media for unconformity attenuated listeria, antibiotic use, and unconformity attenuated listeria Culture system and strain preservation of Stateomyces sp
Liquid medium BHI (brain heart extract broth): 74g/L, natural pH value, 121 ℃ 20min sterilization.
Solid medium BHI: on the basis of the liquid BHI, 1.5g/L of agar powder is added. Sterilizing at 121 deg.C for 20min, cooling to about 50 deg.C, adding antibiotic (chloramphenicol resistance), shaking, and pouring.
Chloramphenicol (cm): the stock solution (1000x) is prepared into 25-34mg/ml by absolute ethyl alcohol, filtered and subpackaged by a 0.22 mu m filter membrane, and stored at-20 ℃. The final concentration was 25-34. mu.g/ml. Care was taken to avoid light.
A culture system: will be about 107CFU Listeria initial culture (e.g., LM-OVA)28) 5ml of liquid BHI culture medium containing chloramphenicol resistance is added, and shaking culture is carried out at 230rpm and 37 ℃ for 14-16h, namely the growth plateau stage of the listeria is reached, and the method can be used for experiments of subsequent examples.
And (3) strain preservation: 30-50% glycerol (prepared with water or culture medium, sterilized and stored at 4 deg.C)
Culturing the culture solution containing the strain to the stage of thallus for preservation (the initial addition amount of Listeria is about 10)7CFU 37 deg.C, 230rpm, shake cultivation for 14-16 h). Optionally, the present disclosure adopts the following two strain preservation modes: mixing 500 mul bacterial liquid and 500 mul 50% glycerin; ② taking 1.5ml of bacterial liquid, centrifuging at 9000rpm for 1min to obtain thalli, removing the culture medium, and resuspending the thalli by 800 mul of 30-50% glycerol. The temperature for short-term storage is-30 ℃ and, if long-term storage is required, the storage temperature is-80 ℃.
Example 2: preparation of non-integrated attenuated listeria vaccine and determination of CFU concentration
Will contain about 107Adding the initial culture of the CFU listeria monocytogenes into 10ml of liquid BHI culture medium containing chloramphenicol resistance, shaking at 230rpm and 37 ℃ for 14-16h, centrifuging at 4500rpm for 15-20min to collect thalli, washing the thalli twice with PBS of the same volume, re-suspending the thalli with PBS of 1/10 volume (containing 7% DMSO), subpackaging, and storing at-80 ℃.
CFU statistical method: the thalli is diluted by PBS or culture medium according to a gradient of 10 times, the thalli can only be diluted from the previous gradient to the next gradient during gradient dilution, and the thalli are fully mixed by shaking. Respectively take 10-5、10-6、10-7、10-8BHI plates were plated at 100ul concentrations and colonies were counted. Such as 10-8When the number of colonies grown out is N, the CFU is N x10 x108One per ml. Finally pass through 10-6、10-7、10-8Calculating colony number and averaging to obtain sample CFU.
Example 3: detection of secreted foreign protein in supernatant of non-integrating attenuated listeria using methods of the present disclosure Amount of
Picking single colony in the Listeria monocytogenes culturing plate, adding the single colony into 10ml of liquid BHI culture medium containing chloramphenicol resistance, shaking at 230rpm and 37 ℃ for 14-16h, and centrifuging at 4500rpm for 15-20min to precipitate thallus. 1ml of the supernatant was mixed with 3 volumes of 10% TCA/acetone solution and precipitated overnight at-20 ℃. The precipitated protein was collected by centrifugation at 15000rpm for 30 minutes, washed twice with ice-cold acetone to remove residual TCA. Excess acetone was evaporated in a fume hood and the pellet was dissolved in 30. mu.l of protein loading buffer containing 0.01N NaOH. After boiling denaturation, 30. mu.l of the sample was spotted on NC membrane, air-dried and washed 3 times for 5min in TBST. 5% skimmed milk was TBST blocked for 1h and washed 3 times with TBST for 5min each time. Incubation with HRP-labeled Anti-His antibody at room temperature for 1.5h or overnight at 4 ℃ and TBST washing 3 times for 5min each. ECL developer is dropped on the NC membrane, and the development is carried out by a Bio-Rad gel imager.
Example 4: detection of foreign protein expression of non-integrated attenuated listeria by Western blot
And (3) selecting a single colony of the plate, adding the single colony into 10ml of a liquid BHI culture medium containing chloramphenicol resistance, shaking at 230rpm and 37 ℃ for 14-16h, and centrifuging at 4500rpm for 15-20min to precipitate thalli. 10ml of the supernatant was mixed with 3 volumes of 10% TCA/acetone solution and precipitated overnight at-20 ℃. The precipitated protein was collected by centrifugation at 15000rpm for 30 minutes, washed twice with ice-cold acetone to remove residual TCA. The excess acetone was evaporated in a fume hood, the precipitate was dissolved in 200. mu.l of a protein loading buffer containing 0.01N NaOH, and the precipitate was boiled for denaturation and stored at-80 ℃.
10% of separation gel and 4% of concentrated gel are respectively configured, each hole is loaded with 20 mul, and the volume of an 80v electrophoresis sample is changed to 120v when the electrophoresis sample runs to the junction of the concentrated gel and the separation gel. After the electrophoresis was completed, the separation gel was taken, the filter paper and 0.22 μm PVDF membrane (pre-activated in methanol) were cut to the same size as the gel, and subjected to 200mA in a film-transferring ice bath for 1.5 h. 5% skimmed milk was TBST blocked for 1h and washed 3 times with TBST for 5min each time. Incubation with HRP-labeled Anti-His antibody at room temperature for 1.5h or overnight at 4 ℃ and TBST washing 3 times for 5min each. ECL developer is dropped on the PVDF membrane, and the development is carried out by a Bio-Rad gel imager.
Example 5: construction of plasmids from attenuated Listeria
Attenuated listeria are used as carrier strains for the preparation of vaccines in the present disclosure. Illustratively, the strain used as a vaccine in the present disclosure is Lm10403 S.DELTA.acta (the construction of the aforementioned strain can be exemplified by the following references: Shen H et al,PNAS, 92(9):3987-91 (1995) which lacks the actA gene, so that the cells infecting the host cells cannot spread to neighboring cells through their characteristic actin tails, thereby greatly reducing their toxicity and pathogenicity. Compared with the wild strain Lm10403S (LD)50Is 1x104) Lm- Δ actA LD50Is 0.5-1x108Proved to be highly attenuated. Meanwhile, the strain keeps the complete capacity of LLO escaping from lysosomes, enters the cytoplasm of host cells for rapid proliferation, and expresses protein to activate specific T cell immune response.
The plasmids used for expressing the antigen genes of the present disclosure are basically constituted as follows:
(1) basic sequences for maintaining plasmid replication stability: illustratively, the present disclosure employs pAM401 as the base sequence of the plasmid;
(2) promoter for transcription of antigenic gene: illustratively, the present disclosure employs phyy, a promoter of virulence island LLO on the Lm chromosome;
(3) signal peptide sequence for expressing secretory antigen protein out of listeria: illustratively, the present disclosure employs LLO signal peptide sequences, e.g., LLO1-28The sequence shown, and LLO22-529For increasing the expression level of the foreign protein;
(4) listeria belongs to prokaryotic cells, while antigen peptides which are generally required to be used as tumor vaccines belong to eukaryotic cells, and corresponding codon optimization is required to express eukaryotic cell proteins in prokaryotic cells.
(5) Detection of tag sequence of secreted protein: illustratively, the present disclosure employs a His tag as the tag sequence;
(6) cleavage sites for insertion of antigenic peptides: illustratively, the present disclosure employs PstI as the cleavage site.
Illustratively, the present disclosure constructs plasmid pAM401-Phly-LLO1-28-BamHI-LLO22-523-PstI-LLO524-529The His method is as follows: in plasmid pAM401-Phly-LLO1-28On the basis of BamHI, using BamHI as enzyme cutting site to synthesize BamHI-LLO22-529the-His-BamHI sequence is constructed on the vector through enzyme digestion and enzyme ligation reaction to obtain pAM401-Phly-LLO1-28-BamHI-LLO22-529His-BamHI, selected at LLO for adding foreign gene insertion site523-524Designing upstream and downstream primers at positions, performing PCR reaction on LLO523And LLO524The PstI restriction site is inserted between the two enzymes.
Cloning of the product into pAM401-phly-LLO Using homologous recombination technology based on certain homologous sequences1-28-BamHI-LLO22-523-PstI-LLO524-540-a PstI site on a His vector (abbreviated as PstI vector plasmid), the homologous sequence of which is: 5' homologous sequence (CCGAAATATAGTAATAAACTGCAG, SEQ ID NO: 11); 3' terminal homologous sequence (CTGCAGGTAGATAATCCAATCGAA, SEQ ID NO:12)
The method mainly comprises the following steps:
PstI vector plasmid 20. mu.l PstI single cleavage system:
PstI plasmid 2μg
PstI restriction enzyme 2μl
10 XNEB buffer 3.1 2μl
Deionized water Make up to 20 μ l
Water bath at 37 deg.c for 10 min.
DNA recovery and purification are carried out on the enzyme digestion product, namely the enzyme digestion linearization PstI vector
A20. mu.l homologous recombination system was obtained from the following components (1) to (5):
(1) enzyme-cleaved linearized PstI vector
(2) Exogenous PCR fragment containing homologous sequences at both ends
(3)5 Xbuffer: 4 μ l
(4) Reaction enzyme: 2 μ l
(5)ddH2O: make up to 20 μ l
Water bath at 37 ℃ for 30 minutes, transforming E.coli competence, coating resistant plate, screening single clone for sequencing verification.
Example 6: preparation of attenuated listeria vaccine
The plasmid of attenuated listeria for vaccine with correct sequencing verification is transformed into the attenuated listeria strain by an electrotransformation technology, and the single clone is selected for subsequent plasmid and expression verification.
The specific steps of the electrical conversion are as follows:
(1) preparation of electrotransformation competence
(i) The overnight cultured Listeria monocytogenes was transferred to 100-250ml brain-heart infusion Broth (BHI) at a ratio of 1:50-1:200, and shake-cultured at 37 ℃ to OD600A value of 0.2-0.25;
(ii) adding Penicillin (PNG) to the final concentration of 10 mu g/ml, and continuing to culture for about two hours;
(iii) centrifuging at 4 deg.C for 5-10 min, and collecting thallus;
(iv) resuspending the cells with 200ml of 10% glycerol and washing twice;
(v) resuspending the cells with 45ml of 10% glycerol, adding sterile lysozyme solution to a final concentration of 10 mug/ml, and mixing the solution by reversing the solution every 10 minutes at a room temperature for 20 minutes;
(vi) centrifuging at high speed for 10min at 4 deg.C, collecting thallus, and washing once with 20ml 10% glycerol;
(vii) the cells were resuspended in 1ml of 10% glycerol, aliquoted at 50. mu.l/tube and stored at-80 ℃.
(2) Determining the optimal electrotransformation conditions:
(i) taking a tube of competent cells, thawing, and placing on ice;
(ii) add 1. mu.g of plasmid to be transferred to competent cells and mix well.
(iii) Adding the mixed system into a pre-cooled 1mm electric rotating cup, and performing electric shock treatment under the conditions of electric field intensity of 10kV/cm, resistance of 200 omega, capacitance of 25 muF and duration of 5-6 ms;
(iv) resuspending with BHI culture medium, standing for 1 hr at normal temperature;
(v) the thalli is coated on a BHI + resistant plate, inverted cultured at 37 ℃ overnight, and a single colony is picked for verification.
The strains/colonies that passed the validation can be used as attenuated listeria vaccines.
Example 7: differences in expression among different single colonies of non-integrating attenuated Listeria
Lm10403S delta actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-E7peptide-LLO524-529His) as an example, and detecting the expression condition of the secretory protein in the supernatant of different single colonies by a Western blot experiment. The specific experimental steps are as follows: lm10403 S.DELTA.acta (pAM 401-LLO) was picked up separately1-28-LLO22-523-(G4S)2-E7peptide-LLO524-529His) was added to 10ml of BHI culture solution containing chloramphenicol resistance and labeled as No. 1-5 in sequence, and subjected to shaking culture at 230rpm for 14-16h at 37 ℃ and then centrifuged at 4500rpm for 15-20min to precipitate the mycelia. 10ml of the supernatant was mixed with 3 volumes of 10% TCA/acetone solution and precipitated overnight at-20 ℃. The precipitated protein was collected by centrifugation at 15000rpm for 30 minutes, washed twice with precooled acetone and the residual TCA was removed. The excess acetone was evaporated in a fume hood, the precipitate was dissolved in 200. mu.l of a protein loading buffer containing 0.01N NaOH, and the precipitate was boiled for denaturation and stored at-80 ℃.
10% of separation gel and 4% of concentrated gel are respectively configured, 20 mul of sample is loaded on each hole, and the volume of the electrophoresis sample is changed to 120V when the electrophoresis sample runs to the junction of the concentrated gel and the separation gel. After the electrophoresis was completed, the separation gel was taken, the filter paper and 0.22 μm PVDF membrane (pre-activated in methanol) were cut to the same size as the gel, and subjected to 200mA in a film-transferring ice bath for 1.5 h. 5% skimmed milk was TBST blocked for 1h and washed 3 times with TBST for 5min each time. Incubation with HRP-labeled Anti-His antibody at room temperature for 1.5h or overnight at 4 ℃ and TBST washing 3 times for 5min each. ECL developer is dropped on the PVDF membrane, and the development is carried out by a Bio-Rad gel imager.
The results of the experiment are shown in FIG. 1. The experimental result shows that Lm10403S delta actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-E7peptide-LLO524-529-His) on the plate, there is an expression difference between the single colonies No. 1 and No. 5, wherein the expression levels of the bacteria No. 3 and No. 5 are higher, the expression levels of the bacteria No. 1 are lower, and the expression levels of the bacteria No. 2 and No. 4 are lower. That is, the experimental results prove that there is a significant expression difference between different single colonies, so it is necessary to establish a rapid mass screening method to help rapidly obtain high expression strains.
Example 8: establishment of method for rapidly detecting expression of secretory protein of non-integrated attenuated Listeria strain in large quantity
Using a strain vector LM10403S delta actA (pAM 401-LLO) without antigen peptide1-28-LLO22-267-PstI-LLO524-529His) as an example, a method for rapid mass detection of Listeria secretory protein expression is provided. The specific experimental process is as follows: LM10403 S.DELTA.acta (pAM 401-LLO) was picked up separately1-28-LLO22-267-PstI-LLO524-529-His) plate, adding single colony into 10ml of BHI culture solution containing chloramphenicol resistance, sequentially marking as No. 1-8, shaking at 230rpm and 37 ℃ for 14-16h, and centrifuging at 4500rpm for 15-20min to precipitate thallus. 1ml of the supernatant was mixed with 3 volumes of 10% TCA/acetone solution and precipitated overnight at-20 ℃. The precipitated protein was collected by centrifugation at 15000rpm for 30 minutes, washed twice with ice-cold acetone to remove residual TCA. Excess acetone was evaporated in a fume hood and the pellet was dissolved in 30. mu.l of protein loading buffer containing 0.01N NaOH. After boiling denaturation, 30. mu.l of the sample was spotted on NC membrane, air-dried and washed 3 times for 5min in TBST. 5% skimmed milk was TBST blocked for 1h and washed 3 times with TBST for 5min each time. Incubation with HRP-labeled Anti-His antibody at room temperature for 1.5h or overnight at 4 ℃ and TBST washing 3 times for 5min each. ECL developer is dropped on the NC membrane, and the development is carried out by a Bio-Rad gel imager.
The results of the experiment are shown in FIG. 2. The experimental result shows that LM10403S delta actA (pAM 401-LLO)1-28-LLO22-267-PstI-LLO524-529-His) different single colonies on the plate have expression difference, the expression of No. 1-5 is stronger, and the expression of No. 6-8 is weaker. Therefore, based on the method of the embodiment, the expression conditions of different single colonies can be rapidly detected, and the colony with higher expression is selected for vaccine preparation.
28Example 9: method for rapidly screening expression quantity of OVA antigen peptide of different non-integrated attenuated Listeria strains
With LM10403S Δ actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-OVA28-LLO524-529His) as an example, to verify secretory expression of OVA28Whether there is a difference in expression of the antigenic peptide from non-integrated attenuated listeria. The specific experimental process is as follows: LM10403 S.DELTA.acta (pAM 401-LLO) was picked up separately1-28-LLO22-523-(G4S)2-OVA28-LLO524-529-His) plate, adding single colony into 10ml of BHI culture solution containing chloramphenicol resistance, sequentially marking as No. 1-8, shaking at 230rpm and 37 ℃ for 14-16h, and centrifuging at 4500rpm for 15-20min to precipitate thallus. 1ml of the supernatant was mixed with 3 volumes of 10% TCA/acetone solution and precipitated overnight at-20 ℃. The precipitated protein was collected by centrifugation at 15000rpm for 30 minutes, washed twice with ice-cold acetone to remove residual TCA. Excess acetone was evaporated in a fume hood and the pellet was dissolved in 30. mu.l of protein loading buffer containing 0.01N NaOH. After boiling denaturation, 30. mu.l of the sample was spotted on NC membrane, air-dried and washed 3 times for 5min in TBST. 5% skimmed milk was TBST blocked for 1h and washed 3 times with TBST for 5min each time. Incubation with HRP-labeled Anti-His antibody at room temperature for 1.5h or overnight at 4 ℃ and TBST washing 3 times for 5min each. ECL developer is dropped on the NC membrane, and the development is carried out by a Bio-Rad gel imager.
The results of the experiment are shown in FIG. 3. The experimental result shows that LM10403S delta actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-OVA28-LLO524-529His) on the plate, different single colonies showed expression differences, with higher expression at No. 1, No. 2, No. 5, and weaker expression in the rest. Therefore, the method can quickly detect the different single colony secretion expression OVA28Antigen peptide condition, and selecting colony with higher expression for vaccine preparation, which can ensure the vaccineThe effectiveness of the seedling.
Example 10: method for rapidly screening expression quantity of NY-ESO-1 antigen peptide of different non-integrated attenuated Listeria strains Method
With LM10403S Δ actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-NY-ESO-1-LLO524-529His) as an example, to verify whether expression difference exists in non-integrated Listeria secreting NY-ESO-1 antigen peptide. The specific experimental process is as follows: LM10403 S.DELTA.acta (pAM 401-LLO) was picked up separately1-28-LLO22-523-(G4S)2-NY-ESO-1-LLO524-529-His) plate, adding single colony into 10ml of BHI culture solution containing chloramphenicol resistance, sequentially marking as No. 1-8, shaking at 230rpm and 37 ℃ for 14-16h, and centrifuging at 4500rpm for 15-20min to precipitate thallus. 1ml of the supernatant was mixed with 3 volumes of 10% TCA/acetone solution and precipitated overnight at-20 ℃. The precipitated protein was collected by centrifugation at 15000rpm for 30 minutes, washed twice with ice-cold acetone to remove residual TCA. Excess acetone was evaporated in a fume hood and the pellet was dissolved in 30. mu.l of protein loading buffer containing 0.01N NaOH. After boiling denaturation, 30. mu.l of the sample was spotted on NC membrane, air-dried and washed 3 times for 5min in TBST. 5% skimmed milk was TBST blocked for 1h and washed 3 times with TBST for 5min each time. Incubation with HRP-labeled Anti-His antibody at room temperature for 1.5h or overnight at 4 ℃ and TBST washing 3 times for 5min each. ECL developer is dropped on the NC membrane, and the development is carried out by a Bio-Rad gel imager.
The results of the experiment are shown in FIG. 4. The experimental result shows that LM10403S delta actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-NY-ESO-1-LLO524-529His) on the plate, different single colonies showed expression differences, with higher expression at number 6 and weaker expression at the rest. Therefore, the method can quickly detect the expression quantity of NY-ESO-1 antigen peptide secreted and expressed by different single colonies, and select the colony with higher expression to prepare the vaccine, thereby ensuring the effectiveness of the vaccine.
Example 11: verify that the expression quantity of the antigen peptide is rapidly screened in a large quantity from different non-integrated attenuated Listeria strains High accuracy of the strain
Firstly, the method in the embodiment 3 or the embodiment 9 of the disclosure is utilized to carry out rapid large-scale primary screening on the non-integrated attenuated listeria strains, then several colonies are randomly picked from the strains with higher expression quantity obtained by screening, and the expression quantity is detected by a Western blot method, so as to verify the accuracy of the screening method.
With LM10403S Δ actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-OVA28-LLO524-529His), we first performed LM10403S Δ actA (pAM 401-LLO)1-28-LLO22-523-(G4S)2-OVA28-LLO524-529His) plates were picked and added to 10ml of BHI medium containing chloramphenicol resistance, and the samples were sequentially labeled as Nos. 1 to 6, and screened according to the method described in example 3 or example 9 of the present disclosure. Randomly screening the obtained strains with higher expression amount, and verifying the strains by a Western blot experiment.
The results of the rapid mass screening experiments are shown in figure 5. The experimental results show that the colonies No. 1-6 have obvious expression difference. Therefore, we randomly selected strain No. 1, No. 2, No. 4 and No. 6 to perform Western blot experiment (the experimental steps are as in example 5). The results of the Western blot are shown in FIG. 6. The results of the experiment showed that the expression of bacterium No. 6 in FIG. 6 was high, while the expression of bacterium No. 1 and No. 2 was low, which was consistent with the results of the experiment shown in FIG. 5. Therefore, the method disclosed by the disclosure can realize rapid and large-scale screening of high-expression strains by non-integrated listeria species, has accuracy, and can be used as an index before preparation of non-integrated listeria vaccines.
Example 12: progeny resulting from screening of parental non-integrative attenuated listeria strains by the methods of the present disclosure Determination of expression level of antigenic peptide in Strain
With LM10403S Δ actA (pAM 401-LLO)1-28-LLO22-267-(G4S)2-E7-LLO524-529His), first in LM10403S Δ actA (pAM 401-LLO)1-28-LLO22-267-(G4S)2-E7-LLO524-529His) plate from single colony added to 10ml of chloramphenicol-resistantSex BHI culture fluids were sequentially labeled as Nos. 1-8, and screened according to the method described in example 3 or example 9 of the present disclosure. The progeny single colonies of the resulting non-integrated attenuated listeria strain were picked and tested as described in example 3 or example 9 of the present disclosure.
The results of the experiment for screening the parents are shown in FIG. 7. Experimental results show that the antigen peptide expression quantity of the bacterial colonies No. 1-8 has obvious expression difference, wherein the antigen peptide expression quantity of the bacterial colony No. 1 is obviously the highest. Therefore, the strain No. 1 was streaked on a chloramphenicol-resistant plate, and the expression level of the antigenic peptide was confirmed by the method described in example 3 or example 9 of the present disclosure by picking up single colonies of the strain No. 1. The results of the experiment are shown in FIG. 8. The experimental result shows that most of the progeny strains of the strain No. 1 have higher expression level, wherein the expression of the progeny strain No. 3 is obviously higher than that of the parent strain No. 1. Thus, the methods of the present disclosure can be used to screen for non-integrating attenuated listeria strains multiple times, ultimately obtaining higher expressing strains from progeny of the foregoing strains.
Example 13: effect of LLO full Length and conventional LLO Signal peptides on foreign protein expression
On the basis of the plasmid obtained in example 5, the corresponding plasmid used in example 13 was obtained by a conventional biological method in the art. To further increase the expression level of foreign proteins, LLO was used by comparison28Signal peptide segment (pAM 401-Phly-LLO)28His) or a full LLO containing a signal peptide540Section (pAM 401-Phly-LLO)540His) on the subsequent foreign protein expression, to determine whether LLO full-length is more favorable for foreign protein expression than conventional LLO signal peptide.
The constructed pAM401-Phly-LLO is added28His or pAM401-Phly-LLO540The strain was inoculated into 10ml of BHI (brain Heart infusion broth) liquid medium containing chloramphenicol resistance at a ratio of 1:100, and shaken at 230rpm in a shaker at 37 ℃ for 12 to 14 hours. And then centrifuging the bacterial liquid at a high speed for 10min, taking the supernatant, adding a TCA (trichloroacetic acid)/acetone solution, uniformly mixing, and precipitating at the temperature of minus 20 ℃. Then ultra-high speed centrifugation is carried out to collect eggsThe white precipitate was washed twice with acetone. Finally, the precipitate is resuspended by using a protein Loading Buffer containing 0.01N NaOH, and the precipitate is denatured by a metal bath at 98 ℃ for 5min and stored in a refrigerator at-80 ℃. Protein detection was performed using a western blot assay using Anti-His-HRP antibody.
The results of the experiment are shown in FIG. 9. Results show LLO540The expression level of the experimental group is obviously higher than that of LLO28Experimental group, therefore the experiments hereafter used LLO540The full-length sequence drives the expression of the foreign protein, and an ideal expression effect can be obtained.
Example 14: effect of antigenic peptides of different sizes and the presence or absence of the G4S sequence on expression vectors
On the basis of the plasmid obtained in example 5, the corresponding plasmid used in example 14 was obtained by a method conventional in the art. Separately constructed plasmid containing pAM401-Phly-LLO540-(G4S)2-OVA28-(G4S)2-His、pAM401-Phly-LLO540-(G4S)2-OVA8-(G4S)2-His、pAM401-Phly-LLO540-OVA28Attenuated Lm strain of-His plasmid was inoculated into 10ml of BHI (brain Heart infusion broth) broth containing chloramphenicol resistance at a ratio of 1:100, and inoculated with pAM401-Phly-LLO540Attenuated Lm strain of His vector as control was shake-cultured at 37 deg.C and 230rpm for 12-14 h. And then centrifuging the bacterial liquid at a high speed for 10min, taking the supernatant, adding a TCA (trichloroacetic acid)/acetone solution, uniformly mixing, and precipitating at the temperature of minus 20 ℃. The protein precipitate was then collected by ultracentrifugation and washed twice with acetone. Finally, the precipitate is resuspended by using a protein Loading Buffer containing 0.01N NaOH, and the precipitate is denatured by a metal bath at 98 ℃ for 5min and stored in a refrigerator at-80 ℃. Protein detection was performed using a western blot assay using Anti-His-HRP antibody.
The results of the experiment are shown in FIG. 10. The results showed that the product contained (G4S)2-OVA28-(G4S)2、(G4S)2-OVA8-(G4S)2、OVA28The Lm strains with attenuated sequences all have higher expression level and contain (G4S)2The sequence has no effect on the expression of the antigen peptide and has relatively higher protein expression level; at the same time, do notOVA antigen peptides with the same size have little influence on expression, and have higher expression level. The experimental system is suitable for the secretory expression of the exogenous antigen peptide. In one aspect of the present disclosure, (G4S)2As a linker peptide.
Example 15: EG7-OVA was used to subcutaneously inoculate mice to generate tumors, which were then treated with tumor vaccines to test for anti-tumor efficacy Fruit
On the basis of the plasmid obtained in example 5, the corresponding plasmid used in example 15 was obtained by a method conventional in the art. Mice were inoculated subcutaneously with EG7-OVA tumors, tumor measurements were started on day 6 post-inoculation, and the experiment was divided into three groups (pAM401 control, pAM 401-LLO)540Control group, pAM401-LLO540-(G4S)2-OVA28-(G4S)2Experimental group), pAM401 and pAM401-LLO were performed on day 9540、pAM401-LLO540-(G4S)2-OVA28-(G4S)2The tail vein injection of three groups of tumor vaccines is carried out, and the injection dosage is 107cfu (Lm Δ actA attenuated Listeria mouse semi-lethal LD50：108Therefore 0.1 sesquilethal dose was chosen as the highest injected dose) and follow-up measurements were continued. Tumor size was followed for 24 days to obtain a tumor curve. At the same time, three sets of data at days 20, 22, and 24 were analyzed by a graph-based multiple comparison test.
The tumor profile results are shown in figure 11. Visible OVA28Treatment group comparisons pAM401, pAM401-LLO540The two groups showed a clear trend of tumor size after vaccine injection. The results of the T-test analysis are shown in FIG. 12, which shows the experimental group pAM401-LLO540-(G4S)2-OVA28And control group pAM401, pAM401-LLO540All showed significant differences in comparison, while pAM401-LLO540Groups were not significantly different from pAM401 group.
By combining the above experimental results, the antigen peptide OVA can be carried by Listeria28Activating body's immune system to realize specific antitumor reaction to EG7-OVA tumor and the LLO expressed separately540Not involving the antigenPeptide anti-tumor immune response.
Example 16: activation of Lm OVA vaccine on specific immune response in mice was detected by ELISPOT
On the basis of the plasmid obtained in example 5, the corresponding plasmid used in example 16 was obtained by a conventional biological method in the art. The experimental groups are: pAM401 control group, pAM401-LLO540Control group, pAM401-LLO540-(G4S)2-OVA28-(G4S)2Experimental group and positive control group OT 1. OT1 transgenic mice harboring the complete gene encoding OVA-specific T cell antigen receptor were selected as positive controls, and experiments were first run with pAM401, pAM401-LLO540、pAM401-LLO540-(G4S)2-OVA28-(G4S)2And (3) tail vein injection of three groups of tumor vaccines, separating peripheral blood mononuclear cells by submaxillary blood taking on the 6 th day of vaccine injection to perform ELISPOT related experiments, adding EDTA (ethylene diamine tetraacetic acid) as an anticoagulant in the blood taking process, then cracking the red blood cells by red blood cell lysate, washing the red blood cells twice by PBS (400 Xg), centrifuging for 5min to obtain the peripheral blood mononuclear cells, and finally adding 100 mu l of 1640 complete culture medium (containing 10% FBS and 1% double antibody) re-suspended cells into an ELISPOT pretreatment pore plate. Peripheral blood mononuclear cells are then stimulated to produce IFN- γ by addition of OVA polypeptides in ELISPOT well plates, and spot numbers are finally quantitated by enzyme-linked reactions to indicate the specific immunoreactivity profile of each group in response to OVA polypeptides (see BD for specific ELISPOT experimental procedures)TMELISPOT Mouse IFN-. gamma.ELISPOTSet Specification, product Cat 551083).
The results of the experiment are shown in FIG. 13. The results showed that spot formation was evident in the OT1 positive control group, indicating that there was no problem with the experimental procedure, pAM401 and pAM401-LLO540The number of control groups spotted was within 10, indicating no significant specific immune response, compared to pAM401-LLO540-(G4S)2-OVA28-(G4S)2The number of spots in the experimental group is more than 200, and the obvious ELISPOT reaction is shown, which indicates that the injected LM-OVA28The tumor vaccine can activate tumor specific immune response of mouse immune system, and prove the functionality of the vaccine.
28Example 17: tetramer experiment verifies that OVA tumor vaccine has specific immune response in mice
On the basis of the plasmid obtained in example 5, the corresponding plasmid used in example 17 was obtained by a conventional biological method in the art. The experimental groups are: pAM401 control group, pAM401-LLO540-(G4S)2-OVA28-(G4S)2Experimental group and OT1 positive control group. pAM401 and pAM401-LLO540-(G4S)2-OVA28-(G4S)2On day 7 after the vaccine injection, blood was collected from the submaxillary region, stained with OVA tetramer and flow antibodies CD8-PB and CD3-PE, and examined by flow cytometry.
The results of the experiment are shown in FIG. 14. The following are found through flow detection: OVA-specifically recognized CD8 of OT1 positive control group+The proportion of T cells is 95.34 percent, the consistency with the OT1 characteristic shows that the experiment operation is correct, and the CD8 specifically identified by the OVA of the pAM401 control group+The proportion of T cells was 0.45%, pAM401-LLO540-(G4S)2-OVA28-(G4S)2Experimental group OVA-specific recognized CD8+The proportion of T cells was 25.96% which was significantly higher than the control group. Indicating high expression of OVA by injection28The Lm vaccine can activate specific immune response in C57 mice and effectively improve CD8 specifically recognized by OVA+T cell ratio, and enhanced OVA-specific tumor immune response.
28Example 18: detection of effective dose of OVA tumor vaccine and activation of tumor-specific immune response in mice Situation(s)
On the basis of the plasmid obtained in example 5, the corresponding plasmid used in example 18 was obtained by a method conventional in the art. Tumor model establishment was performed using EG7-OVA cells subcutaneously inoculated into 20C 57 mice. By mixing OVA28Tumor vaccine 107Multiple gradient doses were set up for the standard for the experiment. The experiment was divided into four groups: pAM401-LLO540 (10)7)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(107)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(106)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(105). Tumor measurements were performed on day 6 after establishment of the EG7-OVA tumor model, and vaccine tail vein injections were performed on day 7 with continuous follow-up measurements of tumor size growth curves.
Blood was taken under the jaw on day 7 after vaccine injection and peripheral blood mononuclear cells were finally obtained by lysing erythrocytes with erythrocyte lysate for ELISPOT experiments. ELISPOT grouping: using OT1 mouse as positive control, pAM401-LLO540The group is an experimental control group, and the experimental group is pAM401-LLO540-(G4S)2-OVA28-(G4S)2(107)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(106)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(105) Three mice were randomly selected for blood collection, and peripheral blood mononuclear cells collected from each mouse were divided into two parts, one part was stimulated with OVA polypeptide, and the other part was not stimulated with OVA polypeptide.
The tumor size growth curve results are shown in figure 15. The results show that the experimental group pAM401-LLO540-(G4S)2-OVA28-(G4S)2(107)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(106)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(105) The tumor size decreased at day 12 and the tumor was significantly eliminated at day 15. Experiment shows that OVA28 tumor vaccine is injected at 10 doses7cfu、106cfu、105cfu has obvious tumor eliminating effect.
The results of the ELISPOT experiment are shown in fig. 16. The results show that the control group without OVA polypeptide in each group has no ELISPOT reaction, the positive control group OT1 has obvious ELISPOT reaction when added with OVA polypeptide, and pAM401-LLO540The control group is stimulated by polypeptide without ELISPOT reaction, which indicates that LLO alone expression can not activate OVA specific of organismThe heterogenous immune response, whereas the experimental group pAM401-LLO540-(G4S)2-OVA28-(G4S)2(107)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(106)、pAM401-LLO540-(G4S)2-OVA28-(G4S)2(105) A strong ELISPOT response was observed after OVA stimulation. Experiment shows that OVA28 tumor vaccine is injected at 10 doses7cfu、106cfu、105cfu is able to activate OVA-specific tumor immune responses in mice.
28Example 19: comparison of drug effects between OVA tumor vaccine and OVA-integrated listeria vaccine
On the basis of the plasmid obtained in example 5, the corresponding plasmid used in example 19 was obtained by a conventional biological method in the art. Tumor model establishment was performed using EG7-OVA cells subcutaneously inoculated into 20C 57 mice. The experiment was divided into four groups: LM Δ actA (pAM401) control group (non-integration type), LM Δ actA (pAM 401-LLO)540-(G4S)2-OVA28-(G4S)2) Experimental group (non-integrative); LM Δ actA control group (integrative type), LM-OVA Δ actA experimental group (integrative type). Tumor measurements were performed on day 6 after establishment of EG7-OVA tumor model and vaccine tail vein injection (injection dose 10) was performed on day 75cfu) and follow-up measurements were continued to determine the tumor growth curve.
The ELISPOT was also used for functional validation, blood was drawn from the jaw 7 days after vaccine injection, and peripheral blood mononuclear cells were finally obtained by lysis of erythrocytes with an erythrocyte lysate for ELISPOT experiments. Peripheral blood mononuclear cells were stimulated to produce IFN- γ by addition of OVA polypeptides in ELISPOT well plates, and the number of spots was finally quantified by enzyme-linked reactions to indicate the specific immunoreactivity profile of each group in response to OVA polypeptides. Then, the eyeball and spleen tissues are respectively picked up and blood is taken out for 12 days to carry out ELISPOT experiment, and the cell amount of the peripheral blood mononuclear cells is 1-10 x105The experimental inoculation amount of ground spleen tissue and centrifugally collected by a 75-micron filter is 1x105And 1x106。
The results of the tumor growth curve experiment are shown in fig. 17. Both the LM Δ actA (pAM401) control group and the LM Δ actA control group showed a sustained increase in tumor size. LM Δ actA (pAM 401-LLO)540-(G4S)2-OVA28-(G4S)2) The experimental group began to decline in tumor size at day 11 and was significantly eliminated at day 17. The LM-OVA Δ actA experimental group had controlled tumor size, no significant growth and no significant elimination after vaccine injection until day 19. Experimental results show that the OVA28 non-integrated tumor vaccine constructed by the experimental method has better tumor eliminating effect than the integrated OVA listeria vaccine.
The results of the ELISPOT experiment after 7 days are shown in fig. 18. No obvious ELISPOT reaction exists in the control group LM delta actA (pAM401), LM delta actA and the experimental group LM-OVA delta actA, and LM delta actA (pAM 401-LLO)540-(G4S)2-OVA28-(G4S)2) The experimental group had a significantly strong ELISPOT response. The experiment shows that the OVA28 non-integrated tumor vaccine constructed by the experiment method can better activate the in vivo tumor specific immune response compared with the integrated OVA listeria vaccine.
The results of the ELISPOT experiment after 12 days are shown in fig. 19. Consistent with the 7-day ELISPOT results, there was no apparent ELISPOT reaction in the test group LM-OVA. DELTA.acta, but LM. DELTA.acta (pAM 401-LLO)540-(G4S)2-OVA28-(G4S)2) The experimental group showed a strong ELISPOT response in peripheral blood mononuclear cells and spleen.
28Example 20: the OVA tumor vaccine is a non-integrated OVA listeria vaccine
Taking the LM strain obtained in the previous examples of the disclosure, for example, in one embodiment, taking LM10403S Δ actA (pAM 401-Phly-LLO)540-(G4S)2-OVA28-(G4S)2His), after shaking overnight, plasmids were extracted and electrotransformed into new LM competent plates coated with CM resistant plates, and negative controls were plated with non-electrotransformed LM competent strains. See the protocol for electrotransformation in example 6 of the present disclosure.
By the plasmid electrotransformation LM competent method, only the LM of the electrotransformed plasmid survives the resistance to CM. The results of the foregoing coating of the flat plate are shown in FIG. 20.
For LM colonies obtained after plating, the total DNA of the strains in the above colonies was extracted by a conventional biological method in the art, and LM10403 S.DELTA.actA strain was used as a negative control, and plasmid pAM401-Phly-LLO was used540-(G4S)2-OVA28-(G4S)2His as a positive control, purified LM genomic DNA and plasmid DNA were obtained by electrophoresis on a 1% agarose gel followed by recovery by gel cutting of the LM genomic DNA and plasmid DNA on the gel. Then respectively using the obtained purified DNA as a template pair OVA28The sequences were amplified by PCR and identified by agarose gel electrophoresis.
The results of the agarose gel electrophoresis are shown in FIGS. 21-22. Proved by molecular experiments, LM10403S delta actA (pAM 401-Phly-LLO)540-(G4S)2-OVA28-(G4S)2His) strain genome DNA as a template, and LM10403S delta actA (pAM 401-Phly-LLO)540-(G4S)2-OVA28-(G4S)2His) strain plasmid DNA as a template, PCR has a target gene band with correct size (the size of the target band is 200bp, and a primer dimer is arranged at 50 bp). The above experimental results show that the gene of interest is present only on the plasmid and is not integrated into the genomic DNA. Therefore, the LM vaccine constructed by the method disclosed by the invention is proved to be a non-integrated LM vaccine.
The above examples of the present disclosure are merely examples provided for clearly illustrating the present disclosure and are not intended to limit the embodiments of the present disclosure. Other variations and modifications will be apparent to persons skilled in the art in light of the above description. And are neither required nor exhaustive of all embodiments. Any modification, equivalent replacement, and improvement made within the spirit and principle of the present disclosure should be included in the protection scope of the claims of the present disclosure.
Sequence listing
<110> Suzhou Ruita medicine science and technology Co., Ltd
Shanghai Ruotai Pharmaceutical Technology Co.,Ltd.
<120> a method for screening a non-integration attenuated Listeria strain highly expressing a foreign protein
<130> 6709-180322I-SH
<160> 21
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1587
<212> DNA
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 1
atgaaaaaaa taatgctagt ttttattaca cttatattag ttagtctacc aattgcgcaa 60
caaactgaag caaaggatgc atctgcattc aataaagaaa attcaatttc atccatggca 120
ccaccagcat ctccgcctgc aagtcctaag acgccaatcg aaaagaaaca cgcggatgaa 180
atcgataagt atatacaagg attggattac aataaaaaca atgtattagt ataccacgga 240
gatgcagtga caaatgtgcc gccaagaaaa ggttacaaag atggaaatga atatattgtt 300
gtggagaaaa agaagaaatc catcaatcaa aataatgcag acattcaagt tgtgaatgca 360
atttcgagcc taacctatcc aggtgctctc gtaaaagcga attcggaatt agtagaaaat 420
caaccagatg ttctccctgt aaaacgtgat tcattaacac tcagcattga tttgccaggt 480
atgactaatc aagacaataa aatagttgta aaaaatgcca ctaaatcaaa cgttaacaac 540
gcagtaaata cattagtgga aagatggaat gaaaaatatg ctcaagctta tccaaatgta 600
agtgcaaaaa ttgattatga tgacgaaatg gcttacagtg aatcacaatt aattgcgaaa 660
tttggtacag catttaaagc tgtaaataat agcttgaatg taaacttcgg cgcaatcagt 720
gaagggaaaa tgcaagaaga agtcattagt tttaaacaaa tttactataa cgtgaatgtt 780
aatgaaccta caagaccttc cagatttttc ggcaaagctg ttactaaaga gcagttgcaa 840
gcgcttggag tgaatgcaga aaatcctcct gcatatatct caagtgtggc gtatggccgt 900
caagtttatt tgaaattatc aactaattcc catagtacta aagtaaaagc tgcttttgat 960
gctgccgtaa gcggaaaatc tgtctcaggt gatgtagaac taacaaatat catcaaaaat 1020
tcttccttca aagccgtaat ttacggaggt tccgcaaaag atgaagttca aatcatcgac 1080
ggcaacctcg gagacttacg cgatattttg aaaaaaggcg ctacttttaa tcgagaaaca 1140
ccaggagttc ccattgctta tacaacaaac ttcctaaaag acaatgaatt agctgttatt 1200
aaaaacaact cagaatatat tgaaacaact tcaaaagctt atacagatgg aaaaattaac 1260
atcgatcact ctggaggata cgttgctcaa ttcaacattt cttgggatga agtaaattat 1320
gatcctgaag gtaacgaaat tgttcaacat aaaaactgga gcgaaaacaa taaaagcaag 1380
ctagctcatt tcacatcgtc catctatttg cctggtaacg cgagaaatat taatgtttac 1440
gctaaagaat gcactggttt agcttgggaa tggtggagaa cggtaattga tgaccggaac 1500
ttaccacttg tgaaaaatag aaatatctcc atctggggca ccacgcttta tccgaaatat 1560
agtaataaag tagataatcc aatcgaa 1639
<210> 2
<211> 529
<212> PRT
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 2
Met Lys Lys Ile Met Leu Val Phe Ile Thr Leu Ile Leu Val Ser Leu
1 5 10 15
Pro Ile Ala Gln Gln Thr Glu Ala Lys Asp Ala Ser Ala Phe Asn Lys
20 25 30
Glu Asn Ser Ile Ser Ser Met Ala Pro Pro Ala Ser Pro Pro Ala Ser
35 40 45
Pro Lys Thr Pro Ile Glu Lys Lys His Ala Asp Glu Ile Asp Lys Tyr
50 55 60
Ile Gln Gly Leu Asp Tyr Asn Lys Asn Asn Val Leu Val Tyr His Gly
65 70 75 80
Asp Ala Val Thr Asn Val Pro Pro Arg Lys Gly Tyr Lys Asp Gly Asn
85 90 95
Glu Tyr Ile Val Val Glu Lys Lys Lys Lys Ser Ile Asn Gln Asn Asn
100 105 110
Ala Asp Ile Gln Val Val Asn Ala Ile Ser Ser Leu Thr Tyr Pro Gly
115 120 125
Ala Leu Val Lys Ala Asn Ser Glu Leu Val Glu Asn Gln Pro Asp Val
130 135 140
Leu Pro Val Lys Arg Asp Ser Leu Thr Leu Ser Ile Asp Leu Pro Gly
145 150 155 160
Met Thr Asn Gln Asp Asn Lys Ile Val Val Lys Asn Ala Thr Lys Ser
165 170 175
Asn Val Asn Asn Ala Val Asn Thr Leu Val Glu Arg Trp Asn Glu Lys
180 185 190
Tyr Ala Gln Ala Tyr Pro Asn Val Ser Ala Lys Ile Asp Tyr Asp Asp
195 200 205
Glu Met Ala Tyr Ser Glu Ser Gln Leu Ile Ala Lys Phe Gly Thr Ala
210 215 220
Phe Lys Ala Val Asn Asn Ser Leu Asn Val Asn Phe Gly Ala Ile Ser
225 230 235 240
Glu Gly Lys Met Gln Glu Glu Val Ile Ser Phe Lys Gln Ile Tyr Tyr
245 250 255
Asn Val Asn Val Asn Glu Pro Thr Arg Pro Ser Arg Phe Phe Gly Lys
260 265 270
Ala Val Thr Lys Glu Gln Leu Gln Ala Leu Gly Val Asn Ala Glu Asn
275 280 285
Pro Pro Ala Tyr Ile Ser Ser Val Ala Tyr Gly Arg Gln Val Tyr Leu
290 295 300
Lys Leu Ser Thr Asn Ser His Ser Thr Lys Val Lys Ala Ala Phe Asp
305 310 315 320
Ala Ala Val Ser Gly Lys Ser Val Ser Gly Asp Val Glu Leu Thr Asn
325 330 335
Ile Ile Lys Asn Ser Ser Phe Lys Ala Val Ile Tyr Gly Gly Ser Ala
340 345 350
Lys Asp Glu Val Gln Ile Ile Asp Gly Asn Leu Gly Asp Leu Arg Asp
355 360 365
Ile Leu Lys Lys Gly Ala Thr Phe Asn Arg Glu Thr Pro Gly Val Pro
370 375 380
Ile Ala Tyr Thr Thr Asn Phe Leu Lys Asp Asn Glu Leu Ala Val Ile
385 390 395 400
Lys Asn Asn Ser Glu Tyr Ile Glu Thr Thr Ser Lys Ala Tyr Thr Asp
405 410 415
Gly Lys Ile Asn Ile Asp His Ser Gly Gly Tyr Val Ala Gln Phe Asn
420 425 430
Ile Ser Trp Asp Glu Val Asn Tyr Asp Pro Glu Gly Asn Glu Ile Val
435 440 445
Gln His Lys Asn Trp Ser Glu Asn Asn Lys Ser Lys Leu Ala His Phe
450 455 460
Thr Ser Ser Ile Tyr Leu Pro Gly Asn Ala Arg Asn Ile Asn Val Tyr
465 470 475 480
Ala Lys Glu Cys Thr Gly Leu Ala Trp Glu Trp Trp Arg Thr Val Ile
485 490 495
Asp Asp Arg Asn Leu Pro Leu Val Lys Asn Arg Asn Ile Ser Ile Trp
500 505 510
Gly Thr Thr Leu Tyr Pro Lys Tyr Ser Asn Lys Val Asp Asn Pro Ile
515 520 525
Glu
<210> 3
<211> 1620
<212> DNA
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 3
atgaaaaaaa taatgctagt ttttattaca cttatattag ttagtctacc aattgcgcaa 60
caaactgaag caaaggatgc atcggatcct actgaagcaa aggatgcatc tgcattcaat 120
aaagaaaatt caatttcatc catggcacca ccagcatctc cgcctgcaag tcctaagacg 180
ccaatcgaaa agaaacacgc ggatgaaatc gataagtata tacaaggatt ggattacaat 240
aaaaacaatg tattagtata ccacggagat gcagtgacaa atgtgccgcc aagaaaaggt 300
tacaaagatg gaaatgaata tattgttgtg gagaaaaaga agaaatccat caatcaaaat 360
aatgcagaca ttcaagttgt gaatgcaatt tcgagcctaa cctatccagg tgctctcgta 420
aaagcgaatt cggaattagt agaaaatcaa ccagatgttc tccctgtaaa acgtgattca 480
ttaacactca gcattgattt gccaggtatg actaatcaag acaataaaat cgttgtaaaa 540
aatgccacta aatcaaacgt taacaacgca gtaaatacat tagtggaaag atggaatgaa 600
aaatatgctc aagcttatcc aaatgtaagt gcaaaaattg attatgatga cgaaatggct 660
tacagtgaat cacaattaat tgcgaaattt ggtacagcat ttaaagctgt aaataatagc 720
ttgaatgtaa acttcggcgc aatcagtgaa gggaaaatgc aagaagaagt cattagtttt 780
aaacaaattt actataacgt gaatgttaat gaacctacaa gaccttccag atttttcggc 840
aaagctgtta ctaaagagca gttgcaagcg cttggagtga atgcagaaaa tcctcctgca 900
tatatctcaa gtgtggcgta tggccgtcaa gtttatttga aattatcaac taattcccat 960
agtactaaag taaaagctgc ttttgatgct gccgtaagcg gaaaatctgt ctcaggtgat 1020
gtagaactaa caaatatcat caaaaattct tccttcaaag ccgtaattta cggaggttcc 1080
gcaaaagatg aagttcaaat catcgacggc aacctcggag acttacgcga tattttgaaa 1140
aaaggcgcta cttttaatcg agaaacacca ggagttccca ttgcttatac aacaaacttc 1200
ctaaaagaca atgaattagc tgttattaaa aacaactcag aatatattga aacaacttca 1260
aaagcttata cagatggaaa aattaacatc gatcactctg gaggatacgt tgctcaattc 1320
aacatttctt gggatgaagt aaattatgat cctgaaggta acgaaattgt tcaacataaa 1380
aactggagcg aaaacaataa aagcaagcta gctcatttca catcgtccat ctatttgcca 1440
ggtaacgcga gaaatattaa tgtttacgct aaagaatgca ctggtttagc ttgggaatgg 1500
tggagaacgg taattgatga ccggaactta ccacttgtga aaaatagaaa tatctccatc 1560
tggggcacca cgctttatcc gaaatatagt aataaactgc aggtagataa tccaatcgaa 1672
<210> 4
<211> 540
<212> PRT
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 4
Met Lys Lys Ile Met Leu Val Phe Ile Thr Leu Ile Leu Val Ser Leu
1 5 10 15
Pro Ile Ala Gln Gln Thr Glu Ala Lys Asp Ala Ser Asp Pro Thr Glu
20 25 30
Ala Lys Asp Ala Ser Ala Phe Asn Lys Glu Asn Ser Ile Ser Ser Met
35 40 45
Ala Pro Pro Ala Ser Pro Pro Ala Ser Pro Lys Thr Pro Ile Glu Lys
50 55 60
Lys His Ala Asp Glu Ile Asp Lys Tyr Ile Gln Gly Leu Asp Tyr Asn
65 70 75 80
Lys Asn Asn Val Leu Val Tyr His Gly Asp Ala Val Thr Asn Val Pro
85 90 95
Pro Arg Lys Gly Tyr Lys Asp Gly Asn Glu Tyr Ile Val Val Glu Lys
100 105 110
Lys Lys Lys Ser Ile Asn Gln Asn Asn Ala Asp Ile Gln Val Val Asn
115 120 125
Ala Ile Ser Ser Leu Thr Tyr Pro Gly Ala Leu Val Lys Ala Asn Ser
130 135 140
Glu Leu Val Glu Asn Gln Pro Asp Val Leu Pro Val Lys Arg Asp Ser
145 150 155 160
Leu Thr Leu Ser Ile Asp Leu Pro Gly Met Thr Asn Gln Asp Asn Lys
165 170 175
Ile Val Val Lys Asn Ala Thr Lys Ser Asn Val Asn Asn Ala Val Asn
180 185 190
Thr Leu Val Glu Arg Trp Asn Glu Lys Tyr Ala Gln Ala Tyr Pro Asn
195 200 205
Val Ser Ala Lys Ile Asp Tyr Asp Asp Glu Met Ala Tyr Ser Glu Ser
210 215 220
Gln Leu Ile Ala Lys Phe Gly Thr Ala Phe Lys Ala Val Asn Asn Ser
225 230 235 240
Leu Asn Val Asn Phe Gly Ala Ile Ser Glu Gly Lys Met Gln Glu Glu
245 250 255
Val Ile Ser Phe Lys Gln Ile Tyr Tyr Asn Val Asn Val Asn Glu Pro
260 265 270
Thr Arg Pro Ser Arg Phe Phe Gly Lys Ala Val Thr Lys Glu Gln Leu
275 280 285
Gln Ala Leu Gly Val Asn Ala Glu Asn Pro Pro Ala Tyr Ile Ser Ser
290 295 300
Val Ala Tyr Gly Arg Gln Val Tyr Leu Lys Leu Ser Thr Asn Ser His
305 310 315 320
Ser Thr Lys Val Lys Ala Ala Phe Asp Ala Ala Val Ser Gly Lys Ser
325 330 335
Val Ser Gly Asp Val Glu Leu Thr Asn Ile Ile Lys Asn Ser Ser Phe
340 345 350
Lys Ala Val Ile Tyr Gly Gly Ser Ala Lys Asp Glu Val Gln Ile Ile
355 360 365
Asp Gly Asn Leu Gly Asp Leu Arg Asp Ile Leu Lys Lys Gly Ala Thr
370 375 380
Phe Asn Arg Glu Thr Pro Gly Val Pro Ile Ala Tyr Thr Thr Asn Phe
385 390 395 400
Leu Lys Asp Asn Glu Leu Ala Val Ile Lys Asn Asn Ser Glu Tyr Ile
405 410 415
Glu Thr Thr Ser Lys Ala Tyr Thr Asp Gly Lys Ile Asn Ile Asp His
420 425 430
Ser Gly Gly Tyr Val Ala Gln Phe Asn Ile Ser Trp Asp Glu Val Asn
435 440 445
Tyr Asp Pro Glu Gly Asn Glu Ile Val Gln His Lys Asn Trp Ser Glu
450 455 460
Asn Asn Lys Ser Lys Leu Ala His Phe Thr Ser Ser Ile Tyr Leu Pro
465 470 475 480
Gly Asn Ala Arg Asn Ile Asn Val Tyr Ala Lys Glu Cys Thr Gly Leu
485 490 495
Ala Trp Glu Trp Trp Arg Thr Val Ile Asp Asp Arg Asn Leu Pro Leu
500 505 510
Val Lys Asn Arg Asn Ile Ser Ile Trp Gly Thr Thr Leu Tyr Pro Lys
515 520 525
Tyr Ser Asn Lys Leu Gln Val Asp Asn Pro Ile Glu
530 535 540
<210> 5
<211> 28
<212> PRT
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 5
Met Lys Lys Ile Met Leu Val Phe Ile Thr Leu Ile Leu Val Ser Leu
1 5 10 15
Pro Ile Ala Gln Gln Thr Glu Ala Lys Asp Ala Ser
20 25
<210> 6
<211> 84
<212> DNA
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 6
atgaaaaaaa taatgctagt ttttattaca cttatattag ttagtctacc aattgcgcaa 60
caaactgaag caaaggatgc atcg 86
<210> 7
<211> 84
<212> DNA
<213> Chicken (Gallus Gallus)
<400> 7
gatgaagtga gcggcctgga gcagctggag agcattatca acttcgaaaa actgaccgag 60
tggaccagca gcaatgtgat ggaa 84
<210> 8
<211> 28
<212> PRT
<213> Chicken (Gallus Gallus)
<400> 8
Asp Glu Val Ser Gly Leu Glu Gln Leu Glu Ser Ile Ile Asn Phe Glu
1 5 10 15
Lys Leu Thr Glu Trp Thr Ser Ser Asn Val Met Glu
20 25
<210> 9
<211> 8
<212> PRT
<213> Chicken (Gallus Gallus)
<400> 9
Ser Ile Ile Asn Phe Glu Lys Leu
1 5
<210> 10
<211> 24
<212> DNA
<213> Chicken (Gallus Gallus)
<400> 10
agcatcatca acttcgagaa actg 24
<210> 11
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 11
ccgaaatata gtaataaact gcag 24
<210> 12
<211> 24
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 12
ctgcaggtag ataatccaat cgaa 24
<210> 13
<211> 10
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 13
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
1 5 10
<210> 14
<211> 28
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 14
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Ser Ile Ile Asn Phe Glu
1 5 10 15
Lys Leu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
20 25
<210> 15
<211> 48
<212> PRT
<213> Artificial Sequence (Artificial Sequence)
<400> 15
Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser Asp Glu Val Ser Gly Leu
1 5 10 15
Glu Gln Leu Glu Ser Ile Ile Asn Phe Glu Lys Leu Thr Glu Trp Thr
20 25 30
Ser Ser Asn Val Met Glu Gly Gly Gly Gly Ser Gly Gly Gly Gly Ser
35 40 45
<210> 16
<211> 27
<212> PRT
<213> Human papilloma virus (Human papillomavir)
<400> 16
Gly Asp Thr Pro Thr Leu His Glu Tyr Met Leu Asp Leu Gln Pro Glu
1 5 10 15
Thr Thr Asp Leu Tyr Cys Tyr Glu Gln Leu Asn
20 25
<210> 17
<211> 81
<212> DNA
<213> Human papilloma virus (Human papillomavir)
<400> 17
ggtgataccc cgaccctgca tgagtatatg ctggatctgc agccggaaac caccgacctg 60
tattgctatg agcagctgaa c 81
<210> 18
<211> 27
<212> PRT
<213> Intelligent (Homo sapiens)
<400> 18
Ser Ile Ser Ser Cys Leu Gln Gln Leu Ser Leu Leu Met Trp Ile Thr
1 5 10 15
Gln Cys Phe Leu Pro Val Phe Leu Ala Gln Pro
20 25
<210> 19
<211> 81
<212> DNA
<213> Intelligent (Homo sapiens)
<400> 19
agcattagca gctgcctgca gcagctgagc ctgctgatgt ggattaccca gtgctttctg 60
ccggtgtttc tggcacagcc g 81
<210> 20
<211> 252
<212> PRT
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 20
Thr Glu Ala Lys Asp Ala Ser Ala Phe Asn Lys Glu Asn Ser Ile Ser
1 5 10 15
Ser Met Ala Pro Pro Ala Ser Pro Pro Ala Ser Pro Lys Thr Pro Ile
20 25 30
Glu Lys Lys His Ala Asp Glu Ile Asp Lys Tyr Ile Gln Gly Leu Asp
35 40 45
Tyr Asn Lys Asn Asn Val Leu Val Tyr His Gly Asp Ala Val Thr Asn
50 55 60
Val Pro Pro Arg Lys Gly Tyr Lys Asp Gly Asn Glu Tyr Ile Val Val
65 70 75 80
Glu Lys Lys Lys Lys Ser Ile Asn Gln Asn Asn Ala Asp Ile Gln Val
85 90 95
Val Asn Ala Ile Ser Ser Leu Thr Tyr Pro Gly Ala Leu Val Lys Ala
100 105 110
Asn Ser Glu Leu Val Glu Asn Gln Pro Asp Val Leu Pro Val Lys Arg
115 120 125
Asp Ser Leu Thr Leu Ser Ile Asp Leu Pro Gly Met Thr Asn Gln Asp
130 135 140
Asn Lys Ile Val Val Lys Asn Ala Thr Lys Ser Asn Val Asn Asn Ala
145 150 155 160
Val Asn Thr Leu Val Glu Arg Trp Asn Glu Lys Tyr Ala Gln Ala Tyr
165 170 175
Pro Asn Val Ser Ala Lys Ile Asp Tyr Asp Asp Glu Met Ala Tyr Ser
180 185 190
Glu Ser Gln Leu Ile Ala Lys Phe Gly Thr Ala Phe Lys Ala Val Asn
195 200 205
Asn Ser Leu Asn Val Asn Phe Gly Ala Ile Ser Glu Gly Lys Met Gln
210 215 220
Glu Glu Val Ile Ser Phe Lys Gln Ile Tyr Tyr Asn Val Asn Val Asn
225 230 235 240
Glu Pro Thr Arg Pro Ser Pro Lys Tyr Ser Asn Lys
245 250
<210> 21
<211> 756
<212> DNA
<213> Listeria monocytogenes (Listeria monocytogenes)
<400> 21
actgaagcaa aggatgcatc tgcattcaat aaagaaaatt caatttcatc catggcacca 60
ccagcatctc cgcctgcaag tcctaagacg ccaatcgaaa agaaacacgc ggatgaaatc 120
gataagtata tacaaggatt ggattacaat aaaaacaatg tattagtata ccacggagat 180
gcagtgacaa atgtgccgcc aagaaaaggt tacaaagatg gaaatgaata tattgttgtg 240
gagaaaaaga agaaatccat caatcaaaat aatgcagaca ttcaagttgt gaatgcaatt 300
tcgagcctaa cctatccagg tgctctcgta aaagcgaatt cggaattagt agaaaatcaa 360
ccagatgttc tccctgtaaa acgtgattca ttaacactca gcattgattt gccaggtatg 420
actaatcaag acaataaaat cgttgtaaaa aatgccacta aatcaaacgt taacaacgca 480
gtaaatacat tagtggaaag atggaatgaa aaatatgctc aagcttatcc aaatgtaagt 540
gcaaaaattg attatgatga cgaaatggct tacagtgaat cacaattaat tgcgaaattt 600
ggtacagcat ttaaagctgt aaataatagc ttgaatgtaa acttcggcgc aatcagtgaa 660
gggaaaatgc aagaagaagt cattagtttt aaacaaattt actataacgt gaatgttaat 720
gaacctacaa gaccttcccc gaaatatagt aataaa 756

Claims (16)

1. A method of detecting the amount of a foreign protein expressed by a non-integrated attenuated listeria comprising the steps of:
(1) mixing the listeria monocytogenes and a protein precipitator to obtain a mixed solution; uniformly mixing the mixed solution and precipitating;
(2) collecting the foreign protein precipitate in the precipitate;
(3) dissolving the exogenous protein precipitate by a protein loading buffer solution to obtain an exogenous protein dissolving solution;
(4) after the exogenous protein dissolving solution is denatured, spotting on a spotting membrane, and air-drying; adding sealing liquid for sealing;
(5) incubating the sample application membrane with a substance capable of reacting with the foreign protein and having a detection label;
(6) dripping a developing solution on the incubated sample application membrane, and developing by a developing device;
(7) detecting the amount of the foreign protein expressed by the non-integrated attenuated listeria through a development result;
wherein said non-integrated attenuated listeria comprises a recombinant nucleic acid molecule encoding an open reading frame for a recombinant polypeptide comprising a heterologous antigen fused to a listeriolysin LLO polypeptide derived therefrom, said recombinant nucleic acid molecule further comprising a first promoter sequence; wherein
The derived listeriolysin LLO polypeptide is a polypeptide shown as SEQ ID NO. 4.
2. The method of claim 1, wherein the heterologous antigen is selected from a tumor antigen or a non-tumor antigen.
3. The method of claim 2, wherein the non-tumor antigen is selected from OVA or a fragment having OVA function.
4. The method of claim 1, wherein said recombinant nucleic acid molecule further comprises a linker sequence linking the nucleotide sequence encoding said derived listeriolysin LLO polypeptide and the nucleotide sequence encoding said heterologous antigen.
5. The method of claim 4, wherein the heterologous antigen is selected from a tumor antigen or a non-tumor antigen.
6. The method of claim 4, wherein the linker sequence comprises a nucleotide sequence encoding the sequence set forth in SEQ ID NO 16.
7. The method of claim 6, wherein the linker sequence comprises one, two, or more repeats of the sequence set forth in SEQ ID NO 16.
8. The method of claim 4, wherein the amino acid sequence encoded by the linker sequence comprising said heterologous antigen linked to the nucleotide sequence of said derived Listeriolysin LLO polypeptide is set forth in SEQ ID NO 14 or SEQ ID NO 15.
9. The method of claim 6, wherein the amino acid sequence encoded by the linker sequence comprising said heterologous antigen linked to the nucleotide sequence of said derived Listeriolysin LLO polypeptide is set forth in SEQ ID NO 14 or SEQ ID NO 15.
10. The method of any one of claims 1 to 9, wherein the first promoter sequence is selected from a sequence encoding the Phly gene.
11. The method of claim 10, wherein the recombinant nucleic acid molecule further comprises a tag sequence or a gene encoding a metabolite for detection.
12. The method of claim 11, wherein the metabolite is selected from a secondary metabolite.
13. The method of any one of claims 1-12, wherein the protein precipitating agent is selected from a TCA/acetone solution.
14. The method according to any one of claims 1 to 12, wherein after the foreign protein precipitate is obtained, before the foreign protein precipitate is dissolved, impurity components in the foreign protein precipitate are removed.
15. The method of claim 14, wherein the impurity component is selected from TCA and/or acetone.
16. A method of screening for non-integrated attenuated listeria comprising comparing the amount of a foreign protein expressed by a non-integrated attenuated listeria detected by the method of any one of claims 1-15, and screening for non-integrated attenuated listeria having a higher level of expression of the foreign protein.
CN201810597069.5A 2018-06-11 2018-06-11 Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein Active CN110579608B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN201810597069.5A CN110579608B (en) 2018-06-11 2018-06-11 Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN201810597069.5A CN110579608B (en) 2018-06-11 2018-06-11 Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein

Publications (2)

Publication Number Publication Date
CN110579608A CN110579608A (en) 2019-12-17
CN110579608B true CN110579608B (en) 2022-07-08

Family

ID=68809358

Family Applications (1)

Application Number Title Priority Date Filing Date
CN201810597069.5A Active CN110579608B (en) 2018-06-11 2018-06-11 Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein

Country Status (1)

Country Link
CN (1) CN110579608B (en)

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN113684214B (en) * 2020-05-18 2023-05-05 苏州若泰医药科技有限公司 Preparation and application of tumor vaccine based on attenuated listeria

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0743366A1 (en) * 1995-05-18 1996-11-20 MERCK PATENT GmbH Determination of Listeria using recombinant bacteriophages
CN1838950A (en) * 2003-06-23 2006-09-27 神经化学（国际）有限公司 Methods for treating protein aggregation disorders
CN102174485A (en) * 2011-02-18 2011-09-07 中国人民解放军南京军区南京总医院 Aspergillus immunodominance antigen and application thereof
CN104928317A (en) * 2015-06-09 2015-09-23 昆明理工大学 Plant expression vector with nicotiana tabacum gibberellins synthesis transcription regulation factor gene, and application of plant expression vector
CN107206060A (en) * 2014-12-19 2017-09-26 阿德瓦希斯公司 The combination of vaccine and anti-OX40 or anti-GITR antibody based on Listeria

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP0743366A1 (en) * 1995-05-18 1996-11-20 MERCK PATENT GmbH Determination of Listeria using recombinant bacteriophages
CN1838950A (en) * 2003-06-23 2006-09-27 神经化学（国际）有限公司 Methods for treating protein aggregation disorders
CN102174485A (en) * 2011-02-18 2011-09-07 中国人民解放军南京军区南京总医院 Aspergillus immunodominance antigen and application thereof
CN107206060A (en) * 2014-12-19 2017-09-26 阿德瓦希斯公司 The combination of vaccine and anti-OX40 or anti-GITR antibody based on Listeria
CN107427565A (en) * 2014-12-19 2017-12-01 宾夕法尼亚大学理事会 Use the combination treatment of recombinant listeria bacterium bacterial strain
CN104928317A (en) * 2015-06-09 2015-09-23 昆明理工大学 Plant expression vector with nicotiana tabacum gibberellins synthesis transcription regulation factor gene, and application of plant expression vector

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
减毒李斯特菌载体运送HPV16E7基因重组疫苗的构建及其生物学特性;贾艳艳 等;《生物工程学报》;20160525;第32卷(第5期);第683-692页 *

Also Published As

Publication number Publication date
CN110579608A (en) 2019-12-17

Similar Documents

Publication Publication Date Title
CN102666575B (en) Mycobacterial vaccines
KR20190082850A (en) Immunogen compositions targeting repeated cancer mutations and methods of using the same
Lizier et al. Comparison of expression vectors in Lactobacillus reuteri strains
CN108350411B (en) Oral tumor vaccine
US11590215B2 (en) Process for the production of a DNA vaccine for cancer immunotherapy
WO2021115379A1 (en) Method for construction of attenuated listeria monocytogenes and uses thereof
CN114107228B (en) Construction of attenuated African swine fever virus strain with twelve genes deleted and application of attenuated African swine fever virus strain as vaccine
Meng et al. Oral vaccination with attenuated Salmonella enterica strains encoding T-cell epitopes from tumor antigen NY-ESO-1 induces specific cytotoxic T-lymphocyte responses
CN110408634B (en) Non-integrated listeria vaccine and anti-tumor immune response method
CN113350495A (en) Streptococcus suis-haemophilus parasuis disease-porcine infectious pleuropneumonia triple subunit vaccine and preparation method thereof
CN111107872A (en) Vaccinia virus mutants useful for cancer immunotherapy
JP6213969B2 (en) Immunogenic polypeptide surface expression bifidobacteria
CN110579608B (en) Method for screening non-integrated attenuated Listeria strain with high-expression foreign protein
CN114015660A (en) Construction of ten-gene-deleted attenuated African swine fever virus strain and application of ten-gene-deleted attenuated African swine fever virus strain as vaccine
US20140271689A1 (en) Therapeutic Cancer Vaccine Targeted to HAAH (Aspartyl-[Asparaginyl]-beta-Hydroxylase)
EP1348036A2 (en) Protection against mycobacterial infections
CN107267430B (en) Recombinant bacterium of Brucella 104M vaccine strain with Omp25 gene knocked out and application
CN111349645B (en) Method for improving safety of non-integrated attenuated listeria vaccine
CN109735477B (en) Preparation and application of three-gene deletion attenuated mutant strain of Listeria monocytogenes
KR102016919B1 (en) Novel Salmonella specific bacteriophage SC1 and antibacterial composition comprising the same
CN111978380A (en) Wild type clostridium emphysema cytotoxin A as well as preparation method, application and vaccine thereof
CN116669759A (en) Novel coronavirus vaccine based on attenuated salmonella controllable secretory expression and preparation method and application thereof
CN107267431B (en) Recombinant bacterium of Brucella 104M vaccine strain with VirB2 gene knocked out and application
CN118108815B (en) Mycobacterium tuberculosis multi-immunogen antigen, mRNA encoding same and application thereof
CN113684214B (en) Preparation and application of tumor vaccine based on attenuated listeria

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant
PE01 Entry into force of the registration of the contract for pledge of patent right
PE01 Entry into force of the registration of the contract for pledge of patent right

Denomination of invention: A method for screening non integrated attenuated Listeria strains with high expression of exogenous proteins

Granted publication date: 20220708

Pledgee: China Construction Bank Suzhou Industrial Park sub branch

Pledgor: SUZHOU ROYALTECH MED Co.,Ltd.

Registration number: Y2024980022288