CN113667022B - Fusion protein and application thereof - Google Patents

Fusion protein and application thereof Download PDF

Info

Publication number
CN113667022B
CN113667022B CN202110984130.3A CN202110984130A CN113667022B CN 113667022 B CN113667022 B CN 113667022B CN 202110984130 A CN202110984130 A CN 202110984130A CN 113667022 B CN113667022 B CN 113667022B
Authority
CN
China
Prior art keywords
hepatitis
protein
ala
gly
amino acid
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CN202110984130.3A
Other languages
Chinese (zh)
Other versions
CN113667022A (en
Inventor
王蕾
欧卫军
朱益丹
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
NANTONG EGENS BIOTECHNOLOGY CO Ltd
Original Assignee
NANTONG EGENS BIOTECHNOLOGY CO Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by NANTONG EGENS BIOTECHNOLOGY CO Ltd filed Critical NANTONG EGENS BIOTECHNOLOGY CO Ltd
Priority to CN202110984130.3A priority Critical patent/CN113667022B/en
Publication of CN113667022A publication Critical patent/CN113667022A/en
Application granted granted Critical
Publication of CN113667022B publication Critical patent/CN113667022B/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
    • C12N15/70—Vectors or expression systems specially adapted for E. coli
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/576—Immunoassay; Biospecific binding assay; Materials therefor for hepatitis
    • G01N33/5767—Immunoassay; Biospecific binding assay; Materials therefor for hepatitis non-A, non-B hepatitis
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6854—Immunoglobulins
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/20—Fusion polypeptide containing a tag with affinity for a non-protein ligand
    • C07K2319/24—Fusion polypeptide containing a tag with affinity for a non-protein ligand containing a MBP (maltose binding protein)-tag
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/50—Fusion polypeptide containing protease site
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2770/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses positive-sense
    • C12N2770/00011—Details
    • C12N2770/24011—Flaviviridae
    • C12N2770/24211—Hepacivirus, e.g. hepatitis C virus, hepatitis G virus
    • C12N2770/24222—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2469/00—Immunoassays for the detection of microorganisms
    • G01N2469/20—Detection of antibodies in sample from host which are directed against antigens from microorganisms

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Biomedical Technology (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Biotechnology (AREA)
  • Hematology (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Urology & Nephrology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Microbiology (AREA)
  • Cell Biology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Food Science & Technology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Analytical Chemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • General Engineering & Computer Science (AREA)
  • Wood Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Plant Pathology (AREA)
  • Virology (AREA)
  • Communicable Diseases (AREA)
  • Peptides Or Proteins (AREA)

Abstract

The invention provides any one of the following products: (B1) A fusion protein comprises hepatitis C virus core protein and hepatitis C virus nonstructural protein NS 3; (B2) a nucleic acid molecule encoding said fusion protein; (B3) an expression cassette comprising the nucleic acid molecule of (B2); (B4) A recombinant vector comprising the nucleic acid molecule of (B2) or a recombinant vector comprising the expression cassette of (B3); (B5) A recombinant microorganism comprising the nucleic acid molecule of (B2), a recombinant microorganism comprising the expression cassette of (B3), or a recombinant microorganism comprising the recombinant vector of B4). The fusion protein can be combined with antibodies in serum of a patient with hepatitis C.

Description

Fusion protein and application thereof
Technical Field
The invention relates to the field of biological medicine, in particular to a fusion protein and application thereof.
Background
Viral hepatitis C, abbreviated as hepatitis C and hepatitis C, is a viral hepatitis caused by Hepatitis C Virus (HCV) infection, and is mainly transmitted through blood transfusion, needling, drug absorption and the like, and according to the statistics of world health organization, the global infection rate of HCV is about 3%, about 1.8 hundred million people are estimated to be infected with HCV, and about 3.5 thousand new hepatitis C cases are generated each year. Hepatitis C is a global epidemic, can cause chronic inflammatory necrosis and fibrosis of liver, and part of patients can develop liver cirrhosis and even liver cancer. Mortality associated with HCV infection (liver failure and death from hepatocellular carcinoma) will continue to increase in the next 20 years, with significant health and life hazards to patients, and serious social and public health problems have been established. The host may produce antibodies to only one antigen or to multiple antigens at different stages of HCV infection and under different physiological conditions. Therefore, the detection rate can be improved by including a plurality of antigens in the anti-HCV detection reagent. In addition, the HCV recombinant antigen is taken as a main component of an HCV antibody diagnostic reagent, and plays a decisive role in the quality and cost of an HCV antibody detection kit.
Disclosure of Invention
The invention solves the technical problem of how to detect the hepatitis C.
The invention provides any one of the following products:
(B1) A fusion protein comprises hepatitis C virus core protein and hepatitis C virus nonstructural protein NS 3;
(B2) A nucleic acid molecule encoding the fusion protein;
(B3) An expression cassette comprising the nucleic acid molecule of (B2);
(B4) A recombinant vector comprising the nucleic acid molecule of (B2) or a recombinant vector comprising the expression cassette of (B3);
(B5) A recombinant microorganism comprising the nucleic acid molecule of (B2), a recombinant microorganism comprising the expression cassette of (B3), or a recombinant microorganism comprising the recombinant vector of B4).
Alternatively, the hepatitis C virus core protein and the hepatitis C virus nonstructural protein NS3 are linked by a linker peptide.
Optionally, the amino acid sequence of the fusion protein is composed of the amino acid sequence of the hepatitis C virus core protein, the amino acid sequence of the connecting peptide and the amino acid sequence of the hepatitis C virus nonstructural protein NS3 in sequence from the N end to the C end;
or alternatively, the first and second heat exchangers may be,
the amino acid sequence of the fusion protein sequentially comprises the amino acid sequence of a tag protein, methionine, the amino acid sequence of the hepatitis C virus core protein, the amino acid sequence of a connecting peptide and the amino acid sequence of hepatitis C virus nonstructural protein NS3 from the N end to the C end.
Optionally, the amino acid sequence of the hepatitis C virus core protein is SEQ ID No.2 at positions 2-172; the nucleotide sequence of the coding DNA molecule is SEQ ID No.1 (5 '-3') at positions 4-516;
the amino acid sequence of the hepatitis C virus nonstructural protein NS3 is the 182 th-555 th site of SEQ ID.No.2; the nucleotide sequence of the coding DNA molecule is the 544 th to 1665 th positions of SEQ ID No.1 (5 '-3');
the amino acid sequence of the connecting peptide is 173-181 of SEQ ID No. 2; the nucleotide sequence of the coding DNA molecule is SEQ ID No.1 (5 '-3') from 517 to 543;
the tag protein is MBP tag.
Application of fusion protein in detecting hepatitis C; optionally, the sample to be tested is serum.
The technical scheme of the invention has the following advantages:
1. the antigen prepared by the method can be combined with antibodies in serum of a patient with hepatitis C.
The HCV Core/NS3 recombinant fusion protein is expressed by using a pMAL-C2 vector, the vector carries an MBP tag, the MBP tag is expressed at the N end of a target protein in a fusion way, and a TEV enzyme cutting site is connected behind the MBP tag through PCR, so that the MBP tag can be conveniently cut off after the expression. After successful construction, expression of the purified protein of interest is expressed. Attempts to cleave the MBP tag after expression, but the protein is unstable and easy to precipitate after cleavage of the tag, the presence of the MBP tag increases the solubility of the protein. Thus, colloidal gold labeling and detection were performed with the labeled protein, and it was found that the presence of the MBP label did not affect the sensitivity and specificity of the detection reagent. In general, one skilled in the art will cleave the MBP tag, and the present invention surprisingly found that the protein is more stable without cleavage and does not affect the sensitivity and specificity of the detection reagent.
Note that: MBP (maltose binding protein) tag protein is 40kDa in size and is encoded by the malE gene of E.coli K12.
2. The invention provides a kit for specifically detecting hepatitis C, wherein fusion protein is used as an antigen, and the kit can sensitively and specifically detect the hepatitis C.
Drawings
In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings that are needed in the description of the embodiments or the prior art will be briefly described, and it is obvious that the drawings in the description below are some embodiments of the present invention, and other drawings can be obtained according to the drawings without inventive effort for a person skilled in the art.
FIG. 1 shows the result of agarose gel electrophoresis in example 1; marker is marked M in the figure, and amplified HCV Core/NS3 genes are marked 1 and 2;
FIG. 2 shows the result of SDS-PAGE of the protein detected in example 1; reference numerals 1-5 are five parallel samples;
FIG. 3 is a result of detection of a part of negative samples in example 3;
FIG. 4 results of partial positive specimen detection in example 3;
FIG. 5 is a schematic diagram of a colloidal gold test strip for detecting a Hepatitis C Virus (HCV) antibody according to example 2 of the present invention;
the device comprises a 1-substrate, a 2-sample loading pad, a 3-colloidal gold adsorption pad, a 4-bearing film, a 5-water absorption pad, a 6-protection film, a T-detection line T and a C-quality control line C.
Detailed Description
EXAMPLE 1 acquisition of HCV Core/NS3 fusion proteins
1.1 biological company synthesizes HCV Core/NS3 gene sequence with nucleotide sequence shown as SEQ ID NO.2, wherein, the 1 st to 172 th positions are HCV Core gene sequence, the 183 st to 555 th positions are NS3 gene sequence, and the 173 st to 182 th positions are linker gene sequence. The amino acid sequence of the protein encoded by the HCV Core/NS3 gene is shown as SEQ ID NO. 1.
1.2 primer sequences: an upstream primer ccggaattcatgagcaccaatccgaaa (SEQ ID NO. 3) and a downstream primer: cccaagcttttagcattcctccatttcatc (SEQ ID NO. 4) SEQ ID NO.1 was amplified, and the cleavage site EcoR I/Hind III was added, and the PCR system was as follows:
template 1ul, 5 'end primer 1ul, 3' end primer 1ul, dNTP 4ul, mg 2+ buffer 5ul、Mg 2+ 4ul, taq 1ul, water make up to 50ul.
The PCR amplification procedure was:
1.3 recovery of PCR products by agarose gel electrophoresis. The agarose gel electrophoresis results are shown in FIG. 1.
1.4 enzyme digestion
PCR product obtained by cleavage of 1.3 and pMAl-C 2 The carrier and enzyme digestion system are as follows:
1.5 purification
The agarose blocks containing the target DNA are rapidly cut off by a clean blade under the conditions of agarose voltage of 0.8 percent, constant voltage of 220V and electrophoresis for 15min, added into a 1.5ml centrifuge tube, and the weight of the cut agarose blocks is weighed by an electronic balance for purification.
Purification (Omega: plasmid Mini Kit I) was performed as follows:
(1) Adding corresponding amount of Buffer I into the gel block according to the calculation of 1 mg=1 ul, mixing, and placing into a water bath kettle with the temperature of 56 ℃ to completely melt the agarose block;
(2) Transferring the solution into Spin Column, centrifuging at 10000rpm for 1min, and discarding the filtrate;
(3) Adding 300ul Binding Buffer, and centrifuging at 10000rpm for 1min;
(4) Adding 700ul of SPW Buffer, and centrifuging at 10000rpm for 1min;
(5) Repeating the step 4 for 2min at 12000 rpm;
(6) Add 65℃pre-heated solution Buffer 50ul, rest 2min, centrifuge at 12000rpm for 2min.
1.6 ligation and transformation
The enzyme-digested HCV NS3 gene and pMAl-C are treated 2 The framework carrier is connected, and the connection system is as follows:
transformation of E.coli: (1) the ligation product was added to E.coli DH5a competence, mixed well and ice-bathed for 30min. (2) And (5) carrying out heat shock conversion for 90s in a water bath at 42 ℃, immediately putting back on ice, and standing for 3min. (3) 600ul of LB medium was added to the centrifuge tube, and the culture was shaken at 37C170rpm for 1 hour.
(4) Centrifuging at 3000rpm for 10min, sucking supernatant, mixing with blowing, spreading on solid LB plate containing Amp resistance, standing in 37 deg.C incubator for 30min, and standing for bacteria liquid absorption.
Monoclonal culture and plasmid extraction were chosen and the extracted plasmid was sent to company for sequencing with correct results.
1.7 prokaryotic expression
(1) Taking 50ul of escherichia coli BL21 competent, ice-bathing, adding 2ul of plasmid, ice-bathing for 30min;
(2) heat-shocking at 42 deg.C for 90s, ice-bathing for 3min, adding 600ul LB liquid medium, and shaking culturing at 37 deg.C at 180rpm for 1 hr.
(3) Centrifuging at 10000rpm for 1min, sucking the supernatant, leaving about 100ul, uniformly mixing and coating on an Amp-resistant LB plate, standing at 37 ℃ for 30min, and culturing overnight in an inverted manner.
1.8 expression and cell treatment
(1) Colonies were picked from the Amp-resistant plates of 1.7 and transferred to Amp-resistant liquid medium for overnight incubation at 37℃with shaking at 180 rpm.
(2) Transferring the overnight cultured bacterial liquid into liquid culture medium containing Amp resistance, shake culturing at 37deg.C and 220rpm for 4 hr, OD 600 At=0.8, the temperature was reduced to 16 ℃, cultured with shaking at 180rpm for 1h, IPTG (1 mM final concentration) was added, and cultured overnight.
(3) Centrifuging at 8000rpm for 10min, collecting thallus, adding 50ml PBS/L for resuspension, adjusting pressure of high pressure crusher to 800bar, crushing for 3 times, centrifuging at 12000rpm for 40min, collecting supernatant, and collecting supernatant after thallus crushing.
1.9 MBP column purification
(1) Dripping the preservation solution in the MBP column, adding 10ml of water to wash the MBP column, and repeating for 2 times;
(2) Adding 10ml of MBP balance liquid to balance the column, and repeating twice;
(3) Adding the supernatant obtained after the thallus in 1.8 is crushed into an MBP column;
(4) Washing the mixed protein twice by using 10ml of balance liquid to fill the column;
(5) The protein was eluted with 4ml of eluent and collected.
1.10 SDS-PAGE detection protein
24ul of purified protein (i.e. HCV Core/NS3 fusion protein) was taken in a 1.5ml centrifuge tube, 6ul of 5 XSDS loading buffer was proportionally added, and after mixing, boiled in boiling water for 10min. The treated sample was loaded in 10 ul. Connecting the electrophoresis device with a power supply for 120V and 120min.
Removing gel from electrophoresis device, placing in coomassie blue staining solution, heating in a microwave oven for 3min, transferring into decolorizing solution, heating in the microwave oven until the background is clear, and observing and recording the result, see fig. 2.
1.11 Secondary purification of proteins
Purification was performed using the GE company Dextrin Sepharose High Performance (Lot: 10288766) kit according to the instructions. Thus obtaining the purified HCV Core/NS3 fusion protein.
Example 2 preparation of colloidal gold test strip
As shown in FIG. 5, a sample loading pad 2, a colloidal gold adsorption pad 3, a carrying film 4 and a water absorption pad 5 are overlapped and connected on a substrate 1 in sequence;
the colloidal gold adsorption pad 3 is coated with a colloidal gold-labeled HCV Core/NS3 fusion protein and a colloidal gold-labeled rabbit IgG.
The bearing film 4 is provided with a detection line T and a quality control line C which are spaced apart, the detection line is arranged on one side close to the colloidal gold adsorption pad 3, and the quality control line C is arranged on one side close to the water absorption pad 5; and the detection line T is coated with HCV Core/NS3 fusion protein, and the quality control line C is coated with goat rabbit IgG. The distance between the detection line T and the quality control line C is 4-6mm, and in this embodiment, the distance is selected to be 4mm.
Further, the sample loading pad 2 and the water absorbing pad 5 are provided with a protective film 6.
The preparation method of the colloidal gold test strip comprises the following steps:
1. preparation of the carrier film:
(1) Selecting a nitrocellulose membrane with a pore diameter of 3-10 μm, and cutting the membrane into a specification with a width of 2.0cm and a length of 30.5cm according to requirements for later use.
(2) Preparing a fusion protein for detection line coating by using a Tris-HCL buffer solution of 0.1. 0.1M, pH 8.0.0, wherein the concentration of the fusion protein is 0.3-2mg/ml, and 1mg/ml in the embodiment; the goat anti-rabbit IgG used for the quality control line coating is prepared by using a sodium chloride buffer solution with the mass percent of 0.85% so that the concentration of the antibody is 0.5-3mg/ml, and in the embodiment, 2mg/ml.
(3) Selecting an antibody coating surface of a nitrocellulose membrane and marking, coating an antibody (antigen) solution of a detection line to be coated and a quality control line on a membrane in parallel and uniformly, wherein the distance between the detection line and the quality control line is as follows: 4.0mm, and drying the nitrocellulose membrane at a constant temperature of 2-30 ℃ for standby.
(4) Preparing a closed treatment soaking solution, and adding purified water with actual production into a liquid preparation tank; respectively weighing buffer solution, sugar, sealing protein and preservative, directly adding the above components into a liquid preparation tank, stirring until the components are completely dissolved, adding purified water to a certain volume to a required volume, and fully and uniformly stirring for at least 10 minutes for later use; the prepared sealing treatment soaking solution contains 0.1Mol buffer solution, 0.5% of sugar, 1% of sealing protein and 0.05% of preservative, wherein the buffer solution is phosphate buffer solution, the sugar is sucrose, the preservative is merthiolate, and the sealing protein is bovine serum albumin.
(5) Placing the films coated with the detection line and the quality control line in a treatment tank, adding the prepared sealing treatment soaking liquid in the step (4), ensuring that each film is completely immersed in the sealing treatment soaking liquid in the step (4) for 30 minutes, ensuring that the films do not move and overlap, taking the films out of the treatment tank after 30 minutes, and pouring out the sealing treatment soaking liquid in the step (4); the membrane was then placed on gauze with forceps and dried slightly to give the carrier membrane.
(6) Drying the veneer: the white paper in the middle of the cutting line on the double-sided adhesive tape of the adhesive tape is torn off, the bearing film after the sealing treatment is just placed in the blank position in the center of the adhesive tape by using tweezers, the right side of the adhesive tape is flush with the right side of the film, errors in the production process are avoided, the color development position is ensured to be relatively accurate, one end of all top quality control lines is attached during the sticking, after the film is attached to the adhesive tape, the film surface is smoothed by the double-sided adhesive tape, air bubbles are avoided, the indoor temperature is controlled to be 18-28 ℃, the relative humidity is less than or equal to 40%, and the air circulation between the drying room is ensured, and the air of the dehumidifier can not be directly blown onto the film surface. Drying for more than or equal to 4 hours for later use.
2. Preparation of colloidal gold adsorption pad
(1) Preparing a colloidal gold complex solution: adding the purified water with the actual production amount to the liquid preparation tank; trehalose, bovine serum albumin, trisodium citrate, polyethylene glycol and NaN were weighed with an electronic analytical balance 3 Directly adding into a liquid preparation tank, stirring until completely dissolving, adding purified water to a desired volume, stirring thoroughly and uniformly for more than 30 minutes to obtain colloidal gold complex solution containing trehalose 5% by mass, bovine serum albumin 2% by mass, trisodium citrate 0.5% by mass, polyethylene glycol 0.05% by mass and NaN 0.05% by mass 3 。
(2) The colloidal gold with the required marking amount is measured by a measuring cylinder, the adjustment is carried out according to the pH value of 7.0-7.3, namely, 0.2mol/L potassium carbonate solution is added according to the volume percentage of 0.50 percent, the fusion protein is taken after stirring for 15 minutes on a magnetic stirrer, the fusion protein is diluted by double distilled water, the colloidal gold is marked according to the volume percentage of 10ug/ml (namely, after the colloidal gold is added into the dilution of the fusion protein, the final concentration of the fusion protein is 10 ug/ml), the fusion protein is added into the colloidal gold, the stirring is carried out for 30 minutes on the magnetic stirrer, the stabilizer polyethylene glycol with the volume percentage of 0.5 per mill is added, the centrifugation is carried out after the stirring for 30 minutes, the precipitate is collected, the compound solution of the colloidal gold is redissolved according to the volume percentage of 3 percent, and the compound solution of the colloidal gold-fusion protein is stirred on the magnetic stirrer until the compound solution is uniformly mixed, and the compound solution of the colloidal gold with the volume percentage of 3 percent is obtained for standby.
(3) Measuring colloidal gold with a measuring cylinder, adjusting according to pH7.0-7.3, namely adding 0.2mol/L potassium carbonate solution according to the volume percentage of 0.50%, stirring on a magnetic stirrer for 15 minutes, taking rabbit IgG, diluting the rabbit IgG with double distilled water, marking the colloidal gold according to 20ug/ml, adding the rabbit IgG into the colloidal gold, stirring on the magnetic stirrer for 30 minutes, adding 0.5 per mill of stabilizer polyethylene glycol according to the volume percentage, centrifuging after stirring for 30 minutes, collecting precipitate, re-dissolving the precipitate according to the volume percentage of 3%, stirring on the magnetic stirrer until the mixture is uniform, and obtaining the colloidal gold-rabbit IgG conjugate complex solution with the volume percentage of 3% for standby.
(4) Taking the complex solution of the colloidal gold-fusion protein conjugate and the complex solution of the colloidal gold-rabbit IgG antibody conjugate, which are 3 percent by volume, in the (2) and the (3), re-dissolving the complex solution of the colloidal gold according to 50 percent by volume, uniformly mixing the complex solution of the colloidal gold-fusion protein conjugate and the complex solution of the colloidal gold-rabbit IgG antibody, and mixing the complex solution of the colloidal gold-fusion protein conjugate and the complex solution of the colloidal gold-rabbit IgG antibody on a magnetic stirrer according to 50 mu L/cm 2 Pouring the gel gold adsorption pad on the prepared gel gold adsorption pad, placing the gel gold adsorption pad in a drying chamber, airing for more than or equal to 4 hours, controlling the temperature of the drying chamber to be 18-28 ℃ and the relative humidity to be less than or equal to 40%, ensuring that air is smooth and air flow cannot be directly blown on the gel gold adsorption pad, placing the dried gel gold adsorption pad into an aluminum foil bag filled with a drying agent, sealing and preserving, and marking the gel gold adsorption pad for later use.
Note that: the colloidal gold is cast, and the width of the cast colloidal gold can be cut freely, so that the color development of the product can be conveniently adjusted.
3. Assembling and cutting:
(1) Cutting a test strip colloidal gold adsorption pad into strips with the width of 0.5cm and the length of 0.5cm multiplied by 30cm, pasting the test strip colloidal gold adsorption pad on the transparent substrate close to one side of a detection line, keeping the test strip colloidal gold adsorption pad lapped with the carrier film for about 1mm, compounding the test strip water adsorption pad on the transparent substrate close to one side of a quality control line and lapped with the carrier film for about 1mm, compounding the test strip sample loading pad on one end of the test strip colloidal gold adsorption pad far from the carrier film and lapped with the test strip colloidal gold adsorption pad for about 1mm, and marking for standby;
(2) And cutting the assembled standby substrate into strip test paper for standby.
Example 3 detection of hepatitis C Using colloidal gold test strip
1000 negative samples (from Henan province disease prevention control center, chinese people's liberation army third 0 second hospital and Subei people hospital) were taken, and the test results were tested by using the colloidal gold test paper prepared in example 2, and the negative coincidence rate was more than 95%, and the test results of the partial negative samples were shown in FIG. 3.
100 parts of positive specimens (from Henan province disease prevention and control center, chinese people's liberation army third 0 second hospital and Subei people hospital) were taken and tested by using the colloidal gold test paper prepared in example 2. The positive detection rate is greater than 96%, and the detection result of partial positive specimens is shown in FIG. 4.
It is apparent that the above examples are given by way of illustration only and are not limiting of the embodiments. Other variations or modifications of the above teachings will be apparent to those of ordinary skill in the art. It is not necessary here nor is it exhaustive of all embodiments. While still being apparent from variations or modifications that may be made by those skilled in the art are within the scope of the invention.
Sequence listing
<110> Nantong Yishi Biotechnology Co., ltd
<120> a fusion protein and use thereof
<160> 4
<170> SIPOSequenceListing 1.0
<210> 1
<211> 555
<212> PRT
<213> artificial sequence
<400> 1
Met Ser Thr Ala Pro Leu Pro Gly Ala Leu Thr Leu Ala Ala Thr Ala
1 5 10 15
Ala Ala Pro Gly Ala Val Leu Pro Pro Gly Gly Gly Gly Ile Val Gly
20 25 30
Gly Val Thr Leu Leu Pro Ala Ala Gly Pro Ala Leu Gly Val Ala Ala
35 40 45
Thr Ala Leu Thr Ser Gly Ala Ser Gly Pro Ala Gly Ala Ala Gly Pro
50 55 60
Ile Pro Leu Ala Ala Ala Pro Gly Gly Ala Thr Thr Ala Gly Pro Gly
65 70 75 80
Thr Pro Thr Pro Leu Thr Gly Ala Gly Gly Met Gly Thr Ala Gly Thr
85 90 95
Leu Leu Ser Pro Ala Gly Ser Ala Pro Ser Thr Gly Pro Thr Ala Pro
100 105 110
Ala Ala Ala Ser Ala Ala Leu Gly Leu Val Ile Ala Thr Leu Thr Cys
115 120 125
Gly Pro Ala Ala Leu Met Gly Thr Ile Pro Leu Val Gly Ala Pro Leu
130 135 140
Gly Gly Ala Ala Ala Ala Leu Ala His Gly Val Ala Val Leu Gly Ala
145 150 155 160
Gly Ala His Thr Ala Ser Ser Ser Val Pro Gly Ala Gly Gly Gly Gly
165 170 175
Ser Gly Gly Gly Gly Ser Leu Gly Ile Gly Thr Val Leu Ala Gly Ala
180 185 190
Gly Thr Ala Gly Val Ala Leu Val Val Leu Ala Val Thr Val Pro His
195 200 205
His Ala Ile Gly Gly Val Ala Leu Thr Ala Ala Gly Gly Ile Pro Pro
210 215 220
Thr Gly Leu Ala Ile Pro Leu Gly Thr Ile Leu Gly Gly Ala His Leu
225 230 235 240
Ile Pro Cys His Ser Leu Leu Leu Cys Ala Gly Leu Ala Ala Ala Leu
245 250 255
Ser Ala Leu Gly Leu Ala Ala Val Ala Thr Thr Ala Gly Leu Ala Val
260 265 270
Ser Val Ile Pro Thr Ser Gly Ala Val Val Val Val Ala Thr Ala Ala
275 280 285
Leu Met Thr Gly Thr Thr Gly Ala Pro Ala Ser Val Ile Ala Cys Ala
290 295 300
Thr Cys Val Thr Gly Thr Val Ala Pro Ser Leu Ala Pro Thr Pro Thr
305 310 315 320
Ile Gly Thr Thr Thr Met Pro Gly Ala Ala Val Ser Ala Ser Gly Ala
325 330 335
Ala Gly Ala Thr Gly Ala Gly Ala Gly Gly Ile Thr Ala Pro Val Thr
340 345 350
Pro Gly Gly Ala Pro Ser Gly Met Pro Ala Ser Ser Val Leu Cys Gly
355 360 365
Cys Thr Ala Ala Gly Cys Ala Thr Thr Gly Leu Thr Pro Ala Gly Thr
370 375 380
Ser Val Ala Leu Ala Ala Thr Leu Ala Thr Pro Gly Leu Pro Val Cys
385 390 395 400
Gly Ala His Leu Gly Pro Thr Gly Ser Val Pro Thr Gly Leu Thr His
405 410 415
Ile Ala Ala His Pro Leu Ser Gly Thr Leu Gly Ala Gly Ala Ala Pro
420 425 430
Pro Thr Leu Val Ala Thr Gly Ala Thr Val Cys Ala Ala Ala Gly Thr
435 440 445
Ala Gly Met Thr Leu Cys Leu Ile Ala Leu Leu Pro Thr Leu His Gly
450 455 460
Pro Thr Pro Leu Leu Thr Ala Leu Gly Ala Val Gly Ala Gly Val Thr
465 470 475 480
Leu Thr His Pro Leu Thr Leu Thr Ile Met Ala Cys Met Ser Ala Ala
485 490 495
Leu Gly Val Val Thr Ser Thr Thr Val Leu Val Gly Gly Val Leu Ala
500 505 510
Ala Leu Ala Ala Thr Cys Leu Thr Thr Gly Ser Val Val Ile Val Gly
515 520 525
Ala Ile Ile Leu Ser Gly Leu Pro Ala Val Ile Pro Ala Ala Ala Val
530 535 540
Leu Thr Ala Gly Pro Ala Gly Met Gly Gly Cys
545 550 555
<210> 2
<211> 1668
<212> DNA
<213> artificial sequence
<400> 2
atgagcacca atccgaaacc gcagcgcaaa accaaacgta ataccaatcg ccgcccgcag 60
gatgtgaaat ttccgggtgg tggccagatt gtgggtggtg tttatctgct gccgcgtcgt 120
ggcccgcgtc tgggtgtgcg tgcaacacgt aaaaccagtg aacgtagcca gccgcgtggc 180
cgtcgtcagc ctattccgaa agcacgtcgt ccggaaggcc gcacctgggc acaacctggt 240
tatccgtggc cgctgtatgg taatgaaggt atgggttggg caggttggct gctgagtccg 300
cgtggcagcc gtcctagctg gggtcctacc gatccgcgtc gtcgcagccg taatctgggt 360
aaagtgattg ataccctgac ctgtggcttt gccgatctga tgggctatat tccgctggtt 420
ggcgccccgc tgggcggtgc agcacgtgca ttagcccacg gtgttcgcgt gctggaagat 480
ggcgcacatt ggaatagcag cagtgtgccg ggcgatggcg gcggtggtag tggtggtggt 540
ggctcactgg gtattggtac agtgctggat caggcagaaa ccgcaggcgt tcgtctggtg 600
gttctggcag tgaccgtgcc gcatcataat attgaagaag ttgccctgac caatgatggt 660
gaaattccgt tttatggtaa ggcaattccg ctggaaacca ttaaaggcgg tcgccatctg 720
attttttgtc atagtaaaaa gaagtgcgac gagctggcag cacgcctgag cgctctgggt 780
ctgaatgcag ttgcctatta tcgtggcctg gatgttagcg tgattccgac cagcggtgat 840
gtggtggtgg ttgccaccga tgcactgatg accggctata ccggcgattt tgatagcgtg 900
attgattgta atacctgcgt gacccagacc gtggatttta gtctggaccc tacctttacc 960
attgaaacca ccaccatgcc gcaggatgcc gtgagccgca gccagagacg cggtagaacc 1020
ggccgtggtc gtggcggtat ttatcgtttt gttacccctg gtgaacgtcc gagtggcatg 1080
tttgatagta gtgttctgtg tgaatgctac gatgcaggtt gtgcctggta tgaactgacc 1140
ccggcagaaa ccagcgtgcg tctgcgtgca tatctgaata cccctggtct gccggtttgt 1200
caggatcatc tggaattttg ggaaagtgtg tttaccggcc tgacccatat tgatgcccat 1260
tttctgagtc agaccaaaca ggccggcgat aattttccgt atctggttgc atatcaggcc 1320
accgtttgtg cacgtgcaca gtgggatcag atgtggaaat gcctgattcg tctgaaaccg 1380
accctgcatg gtccgacccc gctgttatat cgtctgggcg cagtgcagaa tgaagtgacc 1440
ctgacccatc cgaaaaccaa atatattatg gcatgcatga gcgccgatct ggaagtggtg 1500
accagcacct gggtgctggt tggcggtgtg ctggcagcac tggccgcata ttgcctgacc 1560
accggtagcg ttgtgattgt gggtcgtatt attctgagcg gcaaaccggc agttattccg 1620
gatcgtgatg ttctgtatcg tgaatttgat gaaatggagg aatgctaa 1668
<210> 3
<211> 27
<212> DNA
<213> artificial sequence
<400> 3
ccggaattca tgagcaccaa tccgaaa 27
<210> 4
<211> 30
<212> DNA
<213> artificial sequence
<400> 4
cccaagcttt tagcattcct ccatttcatc 30

Claims (5)

1. Any one of the following products:
b1, a fusion protein, which is formed by fusing a hepatitis C virus core protein and a hepatitis C virus nonstructural protein NS3, wherein the amino acid sequence of the hepatitis C virus core protein is SEQ ID No.1 at the 2 nd-172 th site, and the amino acid sequence of the hepatitis C virus nonstructural protein NS3 is SEQ ID No.1 at the 182 th-555 th site;
b2, a nucleic acid molecule encoding the fusion protein of B1;
b3, an expression cassette comprising the nucleic acid molecule of B2;
b4, a recombinant vector comprising a nucleic acid molecule as described in B2, or a recombinant vector comprising an expression cassette as described in B3;
b5, a recombinant microorganism comprising a nucleic acid molecule according to B2, or a recombinant microorganism comprising an expression cassette according to B3, or a recombinant microorganism comprising a recombinant vector according to B4.
2. The product of claim 1, wherein the hepatitis c virus core protein and the hepatitis c virus nonstructural protein NS3 are linked by a linker peptide.
3. The product according to claim 1 or 2, wherein the amino acid sequence of the fusion protein is composed of the amino acid sequence of the hepatitis C virus core protein, the amino acid sequence of the connecting peptide and the amino acid sequence of the hepatitis C virus nonstructural protein NS3 in sequence from the N-terminal to the C-terminal;
or alternatively, the first and second heat exchangers may be,
the amino acid sequence of the fusion protein sequentially comprises the amino acid sequence of a tag protein, methionine, the amino acid sequence of the hepatitis C virus core protein, the amino acid sequence of a connecting peptide and the amino acid sequence of hepatitis C virus nonstructural protein NS3 from the N end to the C end.
4. A product according to claim 3, wherein the nucleotide sequence of the DNA molecule encoding the hepatitis c virus core protein is SEQ ID No.2 5'-3' positions 4-516;
the nucleotide sequence of the 1-coding DNA molecule of the hepatitis C virus nonstructural protein NS3 is the 544 th to 1665 th positions of SEQ ID No.2 from 5 '-3';
the amino acid sequence of the connecting peptide is 173-181 of SEQ ID No. 1; the nucleotide sequence of the coding DNA molecule is the 517-543 th bit of SEQ ID No.2 from 5 '-3';
the tag protein is MBP tag.
5. Use of the fusion protein according to claim 1 in the preparation of a kit for detecting hepatitis c.
CN202110984130.3A 2021-08-25 2021-08-25 Fusion protein and application thereof Active CN113667022B (en)

Priority Applications (1)

Application Number Priority Date Filing Date Title
CN202110984130.3A CN113667022B (en) 2021-08-25 2021-08-25 Fusion protein and application thereof

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CN202110984130.3A CN113667022B (en) 2021-08-25 2021-08-25 Fusion protein and application thereof

Publications (2)

Publication Number Publication Date
CN113667022A CN113667022A (en) 2021-11-19
CN113667022B true CN113667022B (en) 2024-03-22

Family

ID=78546329

Family Applications (1)

Application Number Title Priority Date Filing Date
CN202110984130.3A Active CN113667022B (en) 2021-08-25 2021-08-25 Fusion protein and application thereof

Country Status (1)

Country Link
CN (1) CN113667022B (en)

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102262158A (en) * 2010-05-27 2011-11-30 戴国祯 Direct application of recombinant fusion protein to quick diagnostic detection
CN102305862A (en) * 2011-05-25 2012-01-04 方辉 Method for detecting hepatitis C virus antibody in serum
CN102321179A (en) * 2011-08-10 2012-01-18 杭州培乐生物技术有限公司 Hepatitis C virus recombination protein and gene sequence
CN104697988A (en) * 2015-02-10 2015-06-10 深圳市新产业生物医学工程股份有限公司 Kit for detecting hepatitis c virus antibody as well as detection method and application thereof
CN108530521A (en) * 2018-04-18 2018-09-14 南京京达生物技术有限公司 Recombinate the preparation and application of hepatitis C antigen

Family Cites Families (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6803214B1 (en) * 1999-08-27 2004-10-12 Institut Pasteur Nucleic acids and new polypeptides associated with and/or overlapping with hepatitis C virus core gene products

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102262158A (en) * 2010-05-27 2011-11-30 戴国祯 Direct application of recombinant fusion protein to quick diagnostic detection
CN102305862A (en) * 2011-05-25 2012-01-04 方辉 Method for detecting hepatitis C virus antibody in serum
CN102321179A (en) * 2011-08-10 2012-01-18 杭州培乐生物技术有限公司 Hepatitis C virus recombination protein and gene sequence
CN104697988A (en) * 2015-02-10 2015-06-10 深圳市新产业生物医学工程股份有限公司 Kit for detecting hepatitis c virus antibody as well as detection method and application thereof
CN108530521A (en) * 2018-04-18 2018-09-14 南京京达生物技术有限公司 Recombinate the preparation and application of hepatitis C antigen

Also Published As

Publication number Publication date
CN113667022A (en) 2021-11-19

Similar Documents

Publication Publication Date Title
CN1609617B (en) Composition and method for diagnosing and preventing serious acute respiratory syndrome(SARS)
EP0013828A1 (en) Recombinant DNA, hosts transformed with it and processes for the preparation of polypeptides
KR101630499B1 (en) Viruses associated with Severe Fever with Thrombocytopenia Syndrome and Methods and Kits for diagnosing SFTS using the same
CN103760365B (en) A kind of BAS-ELISA kit detecting CSFV Erns and E2 antigen
CN108912213B (en) Immunogenic polypeptide of enterovirus 71 type VP1 antigen and preparation method and application thereof
CN113667022B (en) Fusion protein and application thereof
CN113640519B (en) Kit for specifically detecting hepatitis C and preparation method thereof
CN106955361A (en) A kind of pharmaceutical composition containing tuberculosis allergen CE
CN109453366B (en) Preparation method and application of anti-tumor protein
KR102100813B1 (en) Fusion protein from hepatitis C virus and diagnosing kit comprising the same
CN112724247A (en) SARS-CoV-2 coronavirus IgA antibody and its application in ELISA detection kit
CN107446949A (en) PLS3 recombinant proteins eukaryon expression plasmid and its construction method and application
CN111607000B (en) Recombinant African swine fever virus p30 subunit soluble fusion protein and preparation method and application thereof
CN116284317A (en) Adiponectin ADP renaturation method with high stability and high reactivity
CN110927374A (en) Colloidal gold test strip for detecting hepatitis E virus IgG antibody and preparation method thereof
CN116203233A (en) Helicobacter pylori CagA antibody detection test paper and application thereof
TW201237170A (en) Method of examining Riemerella anatipestifer and its kit
Baciu et al. Comparison of truncated human angiotensin-converting enzyme 2 (hACE2) expression in pET28a (+) versus pET-SUMO vector and two Escherichia coli strains
CN115166235A (en) African swine fever virus double-antigen sandwich antibody detection kit and preparation method thereof
CN112730829A (en) Colloidal gold test strip for rapidly detecting oyster herpesvirus OsHV-1 and application thereof
CN106397546A (en) O type foot-and-mouth disease virus artificial recombinant antigen and preparation and application thereof
CN113583141A (en) Swine epidemic diarrhea virus Nsp9 protein, fusion protein containing Nsp9 protein, and preparation method and application thereof
CN105664149A (en) Universal vaccine for poly-antigen influenza and preparation method thereof
CN102993283B (en) Antigen protein for mycobacterium tuberculosis and application
CN117924439B (en) Recombinant CagA protein and preparation method and application thereof

Legal Events

Date Code Title Description
PB01 Publication
PB01 Publication
SE01 Entry into force of request for substantive examination
SE01 Entry into force of request for substantive examination
GR01 Patent grant
GR01 Patent grant