CN102305862A

CN102305862A - Method for detecting hepatitis C virus antibody in serum

Info

Publication number: CN102305862A
Application number: CN201110136511A
Authority: CN
Inventors: 方辉
Original assignee: Individual
Current assignee: Individual
Priority date: 2011-05-25
Filing date: 2011-05-25
Publication date: 2012-01-04

Abstract

The invention belongs to the field of biotechnology and in particular relates to a method for detecting hepatitis C virus (HCV) antibody in serum, which comprises the following steps of: constructing an HCV gene and reporter gene recombinant plasmid provided with tagged protein gene, introducing the recombinant plasmid into a mammal cell line for expression, purifying fusion protein by using the tagged protein antibody, incubating the fusion protein and the serum, capturing an antigen-antibody complex by using immunomagnetic beads, and adding a reporter gene substrate to detect reporter gene activation level so as to reflect the content of the HCV antibody.

Description

A kind of method that detects hepatitis C virus antibody in the serum

Technical field

The invention belongs to biological technical field, relate in particular to a kind of method that detects hepatitis C virus antibody in the serum.

Background technology

Hepatitis C is caused by hepatitis C virus, than the even more serious a kind of communicable disease of hepatitis B, is converted into cirrhosis and liver cancer easily.The detection method of diagnosis hepatitis C mainly contains two kinds: a kind of is to utilize the pcr amplification method to detect hepatitis C virus RNA, and another is to detect hepatitis C virus antibody.

The at present clinical enzyme-linked immunoassay method that adopts detects hepatitis C virus antibody more; At first utilize the anti-human IgG antibody who is coated in the detection plate hole to catch hepatitis C virus antibody; Utilize bacterium, yeast or insect cell line to come express recombinant antigen; Enzymes such as antigen and HRP is crosslinked; Utilize between antigen and the hepatitis C virus antibody behind the HRP mark and produce the specificity compatible reaction, detect and reflect antibody horizontal through the HRP Color Appearance System.But this class methods sensitivity and specificity are all not high, only can be applied to the qualitative detection of hepatitis C virus antibody simultaneously yet, can't reflect the situation of change of hepatitis C virus antibody with the course of disease, well the diagnosis and treatment work of direct clinical.

Summary of the invention

The invention discloses a kind of method that detects hepatitis C virus antibody in the serum, this method also is applicable to hepatitis C virus detection of antibodies in other liquid such as blood plasma, the cell pyrolysis liquid simultaneously.

For realizing the object of the invention, the present invention adopts following technical scheme to detect hepatitis C virus antibody in the serum.

Hepatitis C virus gene that step 1. obtains the clone and reporter gene fragment subclone are to the multiple clone site place of the carrier for expression of eukaryon that has the label protein gene.

Step 2. is transfected into mammalian cell strain with recombinant plasmid and expresses, and utilizes the label protein antibody purification to obtain the fusion of reporter gene albumen and antigen.

Fusion and test serum normal temperature or 37 ℃ of step 3. after with purifying were hatched 1 hour, added protein A/G immunomagnetic beads normal temperature and hatched 1 hour.

Step 4. is utilized the compound of magnetic force absorption capture antigen, antibody and protein A/G, adds the reporter gene substrate and reacts, and the activation level of examining report gene reflects antibody content.

Wherein, said viral gene can be full-length gene, also can be portion gene fragment or mosaic gene fragment, also the genetic fragment after the optimization that can obtain for the artificial evolution.

Reporter gene described in the such scheme is to be no more than 3 the luciferase or the concatermer of fluorescin or beta-lactamase gene, can be separated by the small peptide of Gly and Ser between per two genes.

The gene of label protein described in the such scheme is meant and comprises the corresponding genetic fragment of label protein commonly used such as His, FLAG, V5, Myc, MBP, GST.

Be transfected into mammalian cell strain described in the above-mentioned steps 2 and carry out expressing fusion protein, can choose transient transfection and express, also can realize Expression of Fusion Protein through the method that resistance screening is set up the stably express strain.

The method that adds protein A/G immunomagnetic beads capture antigen antibody complex described in the above-mentioned steps 3,4 only is directed to antibody to be measured and belongs to IgA, IgG antibody-like, and other antibody-likes then need take additive method to catch.

Adding the reporter gene substrate described in the above-mentioned steps 4 is to luciferase or beta-lactamase; For selected reporter gene when being fluorescin; The fluorescence signal that then can detect afterwards with the optical excitation of specific wavelength in the transmitted wave strong point comes qualitative, quantitative to measure the content of fluorescin, reflects the antibody horizontal in to be measured.

The detection by quantitative of antibody described in the such scheme be meant with concentration known and in gradient the dilution antibody as reference material; Come the activation level of examining report gene; And obtain the dose-effect curve between antibody concentration and the reporter gene activation amount, thereby realize the detection by quantitative of antibody concentration or content.

Hepatitis C virus antibody detection method susceptibility provided by the invention and specificity are high; Have high-throughout characteristics; Can realize simultaneously the detection by quantitative of hepatitis C virus antibody, also can be widely used in the production exploitation and the clinic diagnosis of all kinds of antibody assay kits of other infectious diseases and autoimmunity relevant disease.

Description of drawings

Fig. 1 shows the synoptic diagram of the expression plasmid that contains label protein, reporter gene, antigen gene.

Fig. 2 shows the linear dosage effect between reporter gene activation level and hepatitis C virus antibody.

Embodiment

The embodiment of the invention discloses hepatitis C virus detection of antibodies method in a kind of serum.Those skilled in the art can use for reference this paper content, suitably improve technological parameter and realize.

Embodiment 1.The hepatitis C virus core antibody is an example in the serum to detect, and formulates following technical scheme.

Step 1. construction of recombinant plasmid: design and synthesize primer to (upstream primer: 5 ' AGCACAAATCCTAAACCTC 3 ' according to hepatitis C virus cAg sequence (Genbank #AF177036.1); Downstream primer: 5 ' AGCGGAGACCGGGGTGG 3 '); Viral RNA from third hepatopath's whole blood, to extract is a template, amplifies hepatitis C virus cAg gene (HCV core) and be cloned into the T carrier to carry out sequence verification.With pGluc-basic (NEB product) plasmid is template pcr amplification Gaussia luciferase (Gluc) genetic fragment; Simultaneously add the corresponding nucleotide sequence of FLAG albumen in primer 5 ' terminal manual work; The FLAG-Gluc that amplification obtains is cloned in the pcDNA3.1 carrier; Utilize the Restriction Enzyme cutting method from the T carrier, the hepatitis B virus core antigen gene also to be cloned in the pcDNA3.1 carrier simultaneously, note guaranteeing to read the correct of frame.Like this, obtain the recombinant expression plasmid of FLAG-Gluc-HCV core, as shown in Figure 1.

Step 2. Expression of Fusion Protein purifying: other recombinant plasmid of 10ug transfection level is imported 1X10 with lipofectamine (Lipofectamine 2000) ⁷Among eukaryotic such as the HEK293T, collecting cell and carry out cracking after 24-48 hour is with the FLAG-Gluc-HCV core fusion in the FLAG antibody affinity chromatography purifying cells lysate.

Fusion and 50 ul test serum incubated at room 30 mins of step 3. after with 100 ng purifying; Add 10 ul protein A/G immunomagnetic beads (Pierce biotechnology) incubated at room, 30 min; The back is with damping fluid (50 mM Tris; PH 7.5; 100 mM NaCl, 5 mM MgCl2,1% Triton X-100) wash 3 times; The back is washed 3 times with the PBS damping fluid, utilizes magnetic force absorption capture antigen antibody complex therebetween.

Step 4. adds 50 ul, 100 nM Coelenterazine in above-mentioned compound after, utilize Chemiluminescence Apparatus to detect its luminous intensity.

Dosage effect between embodiment 2. antibody and reporter gene activation level: use the HCV antibody (Abcam product) of gradient dilution and Flag antibody comes the examining report gene by the scheme among the embodiment 1 activation level respectively; The result as shown in Figure 2; There is linear dosage effect between prompting reporter gene activation level and the antibody amount, can be used for carrying out the detection by quantitative of antibody with this.

< 110>Fang Hui

< 120>a kind of method that detects hepatitis C virus antibody in the serum

<160>3

<210>1

<211>8

<212>PRT

< 213>artificial sequence

<400>1

AspTyrLysAspAspAspAspLys

<210>2

<211>570

<212>DNA

< 213>artificial sequence

<400>2

agcacaaatcctaaacctcaaagaaaaaccaaaagaaacaccaaccgtcgcccacaagacgttaagtttccgggcggcggccagatcgttggcggagtatacttgttgccgcgcaggggccccaggttgggtgtgcgcgcgacaaggaagacttcggagcggtcccagccacgtggaaggcgccagcccatccctaaagatcggcgctccactggcaaatcctggggaaaaccaggatacccctggcccctatacgggaatgagggactcggctgggcaggatggctcctgtccccccgaggttcccgtccctcttggggccccaatgacccccggcataggtcgcgcaacgtgggtaaggtcatcgataccctaacgtgcggctttgccgacctcatggggtacatccctgtcgtgggcgccccgctcggcggcgtcgccagagctctcgcgcatggcgtgagagtcctggaggacggggttaattttgcaacagggaacttacccggttgctccttttctatcttcttgctggccctgctgtcctgcatcaccaccccggtctccgct

<210>3

<211>169

<212>PRT

< 213>artificial sequence

<400>3

MetLysProThrGluAsnAsnGluAspPheAsnIleValAlaValAlaSerAsnPheAlaThrThrAspLeuAspAlaAspArgGlyLysLeuProGlyLysLysLeuProLeuGluValLeuLysGluMetGluAlaAsnAlaArgLysAlaGlyCys?ThrArgGlyCysLeuIleCysLeuSerHisIleLysCysThrProLysMetLysLysPheIleProGlyArgCysHisThrTyrGluGlyAspLysGluSerAlaGlnGlyGlyIleGlyGluAlaIleValAspIleProGluIleProGlyPheLysAspLeuGluProMetGluGlnPheIleAlaGlnValAspLeuCysValAspCysThrThrGlyCysLeuLysGlyLeuAlaAsnValGlnCysSerAspLeuLeuLysLysTrpLeuProGlnArgCysAlaThrPheAlaSerLysIleGlnGlyGlnValAspLysIleLysGlyAlaGlyGlyAsp

Claims

1. method that detects hepatitis C virus (HCV) antibody in the serum; Comprise: structure has the hepatitis C virus gene of label protein gene and the recombinant plasmid of reporter gene; Recombinant plasmid is imported mammalian cell strain expresses; Utilize label protein antibody purification fusion; Fusion and serum are hatched; Utilize immunomagnetic beads capture antigen antibody complex, add reporter gene substrate examining report gene activation level reflection hepatitis C virus antibody content.

2. according to the method for claim 1, said label protein is one of label proteins such as His, FLAG, Myc, V5, MBP.

3. according to the method for claim 1, said label protein is the FLAG label protein, and amino acid sequence is shown in SEQ ID NO:1.

4. according to the method for claim 1, said hepatitis C virus gene is the genetic fragment of coding hepatitis C virus structural proteins or non-structural protein, or the chimera of above-mentioned two kinds of genes, or the genetic fragment of said gene after the artificial evolution optimizes.

5. according to the method for claim 1, said hepatitis C virus gene is HCV core, E1, E2, NS2, NS3, NS4, one of NS5.

6. according to the method for claim 1, said hepatitis C virus gene is HCV core, and nucleotide sequence is shown in SEQ ID NO:2.

7. according to the method for claim 1, said reporter gene is one of luciferase, fluorescin, beta-lactamase.

8. according to the method for claim 1, said reporter gene is luciferase Gaussia Luciferase, and nucleotide sequence is shown in SEQ ID NO:3.

9. according to the method for claim 1, said fusion is meant the fusion that hepatitis C virus albumen and reporter gene albumen are formed.

10. according to the method for claim 1, said immunomagnetic beads is meant protein A or G magnetic bead.

11. according to claim 1,7 method, said reporter gene substrate is Coelenterazine.