CN113621714A - Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof - Google Patents
Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof Download PDFInfo
- Publication number
- CN113621714A CN113621714A CN202111060275.0A CN202111060275A CN113621714A CN 113621714 A CN113621714 A CN 113621714A CN 202111060275 A CN202111060275 A CN 202111060275A CN 113621714 A CN113621714 A CN 113621714A
- Authority
- CN
- China
- Prior art keywords
- molecular marker
- penaeus japonicus
- low
- low temperature
- temperature
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Granted
Links
- 241001124325 Marsupenaeus japonicus Species 0.000 title claims abstract description 61
- 239000003147 molecular marker Substances 0.000 title claims abstract description 47
- 230000003321 amplification Effects 0.000 claims abstract description 22
- 238000003199 nucleic acid amplification method Methods 0.000 claims abstract description 22
- 238000003780 insertion Methods 0.000 claims abstract description 10
- 230000037431 insertion Effects 0.000 claims abstract description 10
- 239000002773 nucleotide Substances 0.000 claims abstract description 10
- 125000003729 nucleotide group Chemical group 0.000 claims abstract description 10
- 238000012163 sequencing technique Methods 0.000 claims description 31
- 238000012408 PCR amplification Methods 0.000 claims description 13
- 230000035772 mutation Effects 0.000 claims description 9
- 108090000623 proteins and genes Proteins 0.000 claims description 8
- 238000012216 screening Methods 0.000 claims description 7
- 238000004458 analytical method Methods 0.000 claims description 6
- 230000002068 genetic effect Effects 0.000 claims description 5
- 238000000137 annealing Methods 0.000 claims description 4
- 238000010276 construction Methods 0.000 claims description 4
- 238000004925 denaturation Methods 0.000 claims description 3
- 230000036425 denaturation Effects 0.000 claims description 3
- 238000012257 pre-denaturation Methods 0.000 claims description 3
- 230000002194 synthesizing effect Effects 0.000 claims description 2
- 238000009395 breeding Methods 0.000 abstract description 18
- 230000001488 breeding effect Effects 0.000 abstract description 18
- 239000003550 marker Substances 0.000 abstract description 7
- 238000000034 method Methods 0.000 abstract description 6
- 230000009286 beneficial effect Effects 0.000 abstract description 4
- 108020004414 DNA Proteins 0.000 description 24
- 241000238557 Decapoda Species 0.000 description 14
- 239000000047 product Substances 0.000 description 12
- 238000001179 sorption measurement Methods 0.000 description 9
- XLYOFNOQVPJJNP-UHFFFAOYSA-N water Substances O XLYOFNOQVPJJNP-UHFFFAOYSA-N 0.000 description 7
- 238000001914 filtration Methods 0.000 description 6
- 238000002156 mixing Methods 0.000 description 6
- 239000000243 solution Substances 0.000 description 6
- 238000011161 development Methods 0.000 description 5
- 239000007788 liquid Substances 0.000 description 5
- 239000002699 waste material Substances 0.000 description 5
- 239000012634 fragment Substances 0.000 description 4
- 238000000246 agarose gel electrophoresis Methods 0.000 description 3
- 230000000875 corresponding effect Effects 0.000 description 3
- 238000001514 detection method Methods 0.000 description 3
- 108090000790 Enzymes Proteins 0.000 description 2
- 102000004190 Enzymes Human genes 0.000 description 2
- 108091092584 GDNA Proteins 0.000 description 2
- 241001465754 Metazoa Species 0.000 description 2
- 239000000872 buffer Substances 0.000 description 2
- 239000007853 buffer solution Substances 0.000 description 2
- 238000013461 design Methods 0.000 description 2
- 238000001962 electrophoresis Methods 0.000 description 2
- 238000002474 experimental method Methods 0.000 description 2
- 238000011160 research Methods 0.000 description 2
- 239000013535 sea water Substances 0.000 description 2
- 238000012360 testing method Methods 0.000 description 2
- 108700028369 Alleles Proteins 0.000 description 1
- 108010067770 Endopeptidase K Proteins 0.000 description 1
- LFQSCWFLJHTTHZ-UHFFFAOYSA-N Ethanol Chemical compound CCO LFQSCWFLJHTTHZ-UHFFFAOYSA-N 0.000 description 1
- 206010071602 Genetic polymorphism Diseases 0.000 description 1
- 241000238553 Litopenaeus vannamei Species 0.000 description 1
- 241000927586 Marsupenaeus Species 0.000 description 1
- 206010057040 Temperature intolerance Diseases 0.000 description 1
- 238000003556 assay Methods 0.000 description 1
- QVGXLLKOCUKJST-UHFFFAOYSA-N atomic oxygen Chemical compound [O] QVGXLLKOCUKJST-UHFFFAOYSA-N 0.000 description 1
- 238000003766 bioinformatics method Methods 0.000 description 1
- 230000015572 biosynthetic process Effects 0.000 description 1
- 238000004364 calculation method Methods 0.000 description 1
- 238000006243 chemical reaction Methods 0.000 description 1
- 239000003153 chemical reaction reagent Substances 0.000 description 1
- 230000002596 correlated effect Effects 0.000 description 1
- 238000012217 deletion Methods 0.000 description 1
- 230000037430 deletion Effects 0.000 description 1
- 238000007865 diluting Methods 0.000 description 1
- 239000000539 dimer Substances 0.000 description 1
- 239000012154 double-distilled water Substances 0.000 description 1
- 230000000694 effects Effects 0.000 description 1
- 238000000605 extraction Methods 0.000 description 1
- 239000000463 material Substances 0.000 description 1
- 235000013372 meat Nutrition 0.000 description 1
- 238000012986 modification Methods 0.000 description 1
- 230000004048 modification Effects 0.000 description 1
- 229910052760 oxygen Inorganic materials 0.000 description 1
- 239000001301 oxygen Substances 0.000 description 1
- 239000002244 precipitate Substances 0.000 description 1
- 238000002360 preparation method Methods 0.000 description 1
- 102000004169 proteins and genes Human genes 0.000 description 1
- 238000000746 purification Methods 0.000 description 1
- 238000003908 quality control method Methods 0.000 description 1
- 239000011541 reaction mixture Substances 0.000 description 1
- 239000012487 rinsing solution Substances 0.000 description 1
- 238000006467 substitution reaction Methods 0.000 description 1
- 238000011144 upstream manufacturing Methods 0.000 description 1
- 238000012795 verification Methods 0.000 description 1
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6844—Nucleic acid amplification reactions
- C12Q1/6858—Allele-specific amplification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/124—Animal traits, i.e. production traits, including athletic performance or the like
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A40/00—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production
- Y02A40/80—Adaptation technologies in agriculture, forestry, livestock or agroalimentary production in fisheries management
- Y02A40/81—Aquaculture, e.g. of fish
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Analytical Chemistry (AREA)
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Immunology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention provides a low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof. The nucleotide sequence of the molecular marker A257 is shown as SEQ ID No.1, and is an Indel marker, and the low-temperature tolerant genotype is an AA homozygous insertion genotype. The nucleotide sequence of the amplification primer of the molecular marker A257 is shown as SEQ ID No.2 and SEQ ID No. 3. The molecular marker A257 provided by the invention can not be limited by the growth stage of the penaeus japonicus, obviously quickens the breeding process of the penaeus japonicus and quickly breeds a new penaeus japonicus species with excellent low temperature tolerance character, and the molecular marker A257 and the amplification primer thereof are used for detecting the low temperature tolerance character of the penaeus japonicus, so that the molecular marker A257 is accurate and reliable, the operation is simple, the molecular marker is beneficial to the healthy breeding of the penaeus japonicus, and the molecular marker has wide application prospect.
Description
Technical Field
The invention belongs to the field of molecular marker assisted breeding of aquatic animals, and particularly relates to a low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof.
Background
Japanese prawn (Marsupenaeus japonicus) Originally called Japanese prawn, belonging to the order of ten-foot, the family of prawns, the genus of marsupenaeus, distributed in the sea areas of India-Western Pacific tropical zone, African east coast, Malaysia, Japan, Korea, China southeast coast and the like, is one of the main prawn breeding varieties in China, and the Japanese prawn grows rapidly, is resistant to dew, bright in color and high in economic value, is popular with water product markets and breeders, and is bred in provinces and cities from south China to northern coast, and forms a certain scale. The improved breeding has great significance for the breeding industry of the penaeus vannamei boone. Low temperature resistance is an important stress resistance character of the penaeus japonicus. On one hand, because the penaeus japonicus has higher market demand, the penaeus japonicus is mainly cultured in northern water areas in China, including northern provinces of seawater areas such as Shandong, Hebei, Jiangsu and the like, and low temperature resistance becomes an important stress resistance character pursued by the penaeus japonicus culture industry in northern China; on the other hand, in the spring festival of China, the market price of fresh and alive Japanese prawns is more than 3 times of that of ordinary seasons, farmers in northern areas and other places often risk to bring the time to market to winter, the cultured prawns are usually killed in a large scale due to sudden drop of water temperature caused by cold tide in winter, and the breeding of low-temperature-resistant varieties is also an urgent need of the Japanese prawn breeding industry.
The molecular marker is a genetic marker based on nucleotide sequence variation of genetic materials among individuals, and is a direct reflection of DNA level genetic polymorphism. The molecular marker has remarkable advantages: most molecular markers are co-dominant, and selection of recessive characters is very convenient; the genome variation is extremely abundant, and the number of molecular markers is almost unlimited; the DNA of different tissues at different stages of biological development can be used for marking analysis; the molecular marker detection method is simple and rapid. At present, the research on the development of low temperature resistant molecular markers of penaeus japonicus is less, and the industry lacks markers applicable to molecular marker assisted breeding. Therefore, the development of molecular markers related to low-temperature resistance is of great significance to the healthy culture and the accelerated breeding process of the penaeus japonicus.
Disclosure of Invention
The invention provides a low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof. The molecular marker A257 of the invention can be used for screening low-temperature tolerant breeds of the penaeus japonicus, has high identification efficiency and accuracy, and is beneficial to the cultivation of the low-temperature tolerant state of the penaeus japonicus and the development of the breeding industry.
In order to realize the purpose of the invention, the invention adopts the following technical scheme to realize:
the invention provides a low-temperature-resistant molecular marker A257 of Penaeus japonicus, wherein the nucleotide sequence of the molecular marker A257 is shown in SEQ ID No. 1.
Further, the 510 th base of the molecular marker A257 is A.
Further, the low-temperature tolerance genotype of the molecular marker A257 is an AA homozygous insertion genotype.
The invention also provides an amplification primer of the molecular marker A257, and the nucleotide sequence of the amplification primer is shown as SEQ ID No.2 and SEQ ID No. 3.
The invention also provides application of the molecular marker A257 or the amplification primer in screening low-temperature resistant breeds of Penaeus japonicus.
Further, the screening steps of the low temperature resistant variety of the penaeus japonicus comprise:
(1) synthesizing an amplification primer with a nucleotide sequence shown as SEQ ID No.2 and SEQ ID No. 3;
(2) extracting the genomic DNA of the penaeus japonicus to be detected;
(3) performing PCR amplification on the extracted genome DNA by using an amplification primer, and sequencing an amplification product;
(4) if the sequencing result shows that the gene is homozygous and insertional mutated, the penaeus japonicus is a low temperature resistant variety.
Further, an AA gene homozygous insertion mutation appears in the sequencing result in the step (4), namely, the 510 th base of the molecular marker A257 is A, so that the penaeus japonicus is a low temperature resistant variety.
Further, the PCR amplification conditions are as follows: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 30s, and repeating for 32 cycles; the circulation extends for 72 ℃ for 7 min.
The invention also provides application of the molecular marker A257 or the amplification primer in genetic diversity analysis, germplasm identification and genetic map construction of the Japanese prawn.
Compared with the prior art, the invention has the following advantages and beneficial effects:
1. the low-temperature-resistant molecular marker A257 of the penaeus japonicus provided by the invention can not be limited by the growth stage of the penaeus japonicus, and can be used for breeding early-stage young penaeus japonicus and parents of the penaeus japonicus, so that the breeding process of the penaeus japonicus is obviously accelerated, and a new penaeus japonicus variety with excellent low-temperature tolerance is rapidly bred. 2. The molecular marker A257 and the amplification product thereof provided by the invention are used for detecting the low temperature resistant characters of the penaeus japonicus, the method is accurate and reliable, the operation is simple, the characters meeting the requirements can be effectively and quickly screened, the short-time and low-cost breeding of the low temperature resistant penaeus japonicus variety can be realized in an early stage, the number of the excellent quality penaeus japonicus is increased, the breeding rate and the breeding period of the penaeus japonicus are improved, the yield of the penaeus japonicus is further improved, and the healthy breeding of the penaeus japonicus is promoted, so that the molecular marker A257 and the amplification product thereof have wide application prospects.
Drawings
FIG. 1: according to the invention, two groups of corresponding position sequencing result difference peak maps of the low-temperature tolerant group and the low-temperature intolerant group are obtained.
Detailed Description
The technical solution of the present invention will be described in further detail with reference to specific examples.
The penaeus japonicus used in the invention is from the experimental base of Retzhei treasure Co., Ltd. 300 Japanese prawns with the weight of 10 +/-3 g are placed in 4 culture ponds (500 cm multiplied by 300 cm multiplied by 150 cm) for temporary culture for 7d, the water temperature is kept at 28 +/-1 ℃ during the temporary culture, water is added to the pond to reach 20 cm, the pH value is 8.2 +/-0.5, oxygen is continuously supplied, fresh seawater is replaced at 8 o 'clock in the morning, fresh clam meat is fed at 5 o' clock in the afternoon, and the feeding amount is about 10% of the weight of the prawns. And 7d, selecting the penaeus japonicus with good activity and complete body surface for subsequent experiments.
The low-temperature tolerance test is carried out on 300-tailed Japanese prawns under the stress condition of 10 +/-0.5 ℃, the individual tolerance time is counted, 20-tailed prawns which die first are taken as a low-temperature sensitive group (UT), and 20-tailed prawns which survive last are taken as a low-temperature tolerant group (T). Genomic DNAs of Penaeus japonicus in the low-temperature intolerant group and the low-temperature tolerant group were extracted using a Tiangen marine animal tissue genome extraction kit (TIANGEN, Tiangen Biochemical technology Co., Ltd.).
Example 1
Screening of low temperature-resistant related candidate molecular markers
1. Sequencing data filtering and alignment
Genomic DNA of Penaeus japonicus was extracted, and 20 individuals were used in each of the low-temperature-tolerant group and the intolerant group. The genomic DNA of the penaeus japonicus is extracted by using a centrifugal adsorption column which can be specifically combined with the DNA and a unique buffer solution system. First, approximately 30 mg of tissue sample was placed into a 1.5 mL sterile enzyme centrifuge tube, 200. mu.L of GA buffer and 20. mu.L of Proteinase K solution were added, vortexed, and incubated at 56 ℃ until the tissue was completely lysed. Then 200 μ L GB buffer solution is added, fully inverted and mixed evenly, placed at 70 ℃ for 10min, the solution becomes clear, cut short and centrifuged to remove the water drops on the inner wall. Adding 200 μ L anhydrous ethanol, mixing thoroughly, centrifuging briefly, adding the obtained solution and flocculent precipitate into adsorption column CB3 (adsorption column is put into collecting tube), centrifuging at 12000 rpm for 30s, discarding waste liquid, and returning adsorption column CB3 to collecting tube. Add 500. mu.L of buffer GD to adsorption column CB3, centrifuge at 12000 rpm for 30s, discard waste, place adsorption column CB3 in the collection tube. 600. mu.L of the rinsing solution PW was added to the adsorption column CB3, and centrifuged at 12000 rpm for 30s, and the waste liquid was discarded, and the adsorption column CB3 was put into the collection tube. Discard the waste liquid (repeat once), add 700. mu.L of rinsing liquid PW, centrifuge at 12000 rpm for 30s, and discard the waste liquid. The reaction mixture was then air-separated at 12000 rpm for 2min to completely remove the residual reagents. The adsorption column CB3 was placed in a clean centrifuge tube, 40. mu.L of water was added to the center of the column, and the column was allowed to stand at room temperature for 15min, centrifuged at 12000 rpm for 2min, and the DNA was eluted. The concentration and purity of the DNA were determined by Nanodrop.
Respectively randomly breaking single DNA samples including low-temperature tolerant groups and low-temperature intolerant groups into fragments with the length of 350bp by a Covaris crusher, constructing a Library by adopting a TruSeq Library Construction Kit, and completing the preparation of the whole Library by the steps of end repairing, ployA tail adding, sequencing joint adding, purification, PCR amplification and the like of the DNA fragments. The constructed library was sequenced by Illumina HiSeq PE 150.
And strictly filtering sequencing data to obtain high-quality clean data. And (4) counting the output data of the 40 samples, wherein the statistics comprise effective data after sequencing filtration, the number of the compared fragments and the like. The total sequencing data amount is 611.10 Gb, the high-quality clean data amount is 605.67 Gb, and the sequencing data results are shown in Table 1.
Table 1: summary of sequencing data quality
Remarking: t stands for low temperature tolerance and UT stands for low temperature intolerance.
The filtered effective data are compared by Burrows-Wheeler alignment tool (BWA) software, and the comparison result is subjected to SAMTOOLS to remove duplication. The alignment result shows that the alignment rate of all samples is more than 85%, the average sequencing depth is more than 25 x, and the method can be used for subsequent analysis.
2. Marker detection and annotation
INDEL assays were performed using SAMTOOLS software. Detecting polymorphic sites in the population by using a Bayesian model, and obtaining high-quality INDELs through the following filtering and screening:
1) q20 quality control;
2) the INDEL loci are at least 5 bp apart from each other;
3) the support number (depth of coverage) of INDEL is between [ 1/3, 5] times the average depth.
INDEL detection results were then annotated with ANNOVAR. The results are shown in Table 2, and the INDEL results are statistics after filtering according to Depth (DP) greater than 4, deletion rate 0.2, and minimum allele frequency 0.05.
Table 2: INDEL test result statistics
| Grouping | Indel number |
| Upstream of | 27,922 |
| Exon(s) | 87 |
| Intron | 392,013 |
| Shear-connecting body | 224 |
| Downstream | 33,304 |
| Between genes | 1,132,068 |
| Total | 1,585,618 |
3. INDEL differential analysis
Analytical statistics were performed for INDEL-index at each locus in the low temperature tolerant and low temperature intolerant groups as follows:
var _ T = number of individuals with variation (heterozygous mutation 0/1, homozygous mutation 1/1)/number of individuals in the tolerant group;
var _ UT = number of individuals with variation (heterozygous mutation 0/1, homozygous mutation 1/1)/number of individuals in the non-tolerant group.
The INDEL frequency difference distribution is also calculated, with the following directions: Δ (index) = Var _ UT (low temperature tolerant group) -Var _ T (low temperature intolerant group), filtering out sites with Δ index absolute value less than 0.55, and finally obtaining 51 INDELs of difference between groups, and then verifying these markers.
Second, verification of low temperature resistance related molecular marker
Verifying the candidate molecular markers related to the low-temperature resistance in a low-temperature tolerant group and a low-temperature intolerant group by adopting a PCR product sequencing method:
(1) firstly, designing primers on flanking sequences of marker sites, wherein at least one primer is more than 70 bp away from the marker sites;
(2) carrying out PCR amplification by using the designed primers and respectively taking mixed DNA materials of a low-temperature tolerant group and a low-temperature intolerant group as templates, sequencing the PCR products which are successfully amplified, and selecting the primer which is far away from the marking site by using a sequencing primer;
(3) analyzing the sequencing peak maps by using Bio-edit software, selecting markers with larger difference between the sequencing peak maps of the low-temperature tolerant population and the low-temperature intolerant population at corresponding positions, and continuing to perform PCR amplification and sequencing analysis on the individual DNA templates;
(4) the genotype of each individual was counted from the sequencing results and analyzed by SPSS software whether the markers correlated with the low temperature resistance profile.
The specific operation steps are as follows:
1. DNA mixing pool construction
Mixing 1 mu g of DNA of each individual, preparing DNA mixing pools of a low-temperature resistant group and a low-temperature intolerant group, diluting the DNA mixing pools to 200 ng/mu L of final concentration, and containing 20 individuals in each mixing pool for subsequent experiments.
2. Primer design
The INDEL mutation sites are screened by comparing the genomic sequencing and bioinformatics analysis methods in the two populations, and then the low temperature resistant molecular markers are screened. Primers were designed at both ends of the candidate INDEL sites resistant to low temperature using Primer Premier 5.0 software.
The design criteria for the primers were:
(1) the annealing temperature of the primer is 55-60 ℃;
(2) the formation of stable dimer and hairpin structures between the primers and the primers is avoided as much as possible;
(3) the fragment size is greater than 200 bp.
The designed primer information is shown in Table 3:
table 3: primer information
3. Mixed template PCR amplification and electrophoresis
Mixed gDNA is used as a template, enzyme of Kangji century company is used for PCR amplification, and the reaction program is set as follows: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 30s, and repeating for 32 cycles; the circulation extends for 72 ℃ for 7 min. The PCR system was as follows:
| 2×Matermix | 10 μL |
| forward primer | 0.5 μL |
| Reverse primer | 0.5 μL |
| gDNA | 2 μL |
| ddH2O | 7 μL |
| Total volume | 20 μL |
The obtained PCR amplification product is subjected to agarose gel electrophoresis. Performing first-generation sequencing on the residual products; if the peak map of the sequencing result shows that the A homozygous insertion appears at the position of 510 bases, the penaeus japonicus is a low temperature resistant individual, and if the peak map of the sequencing result does not show that the A homozygous insertion appears at the position of 510 bases, the penaeus japonicus is a low temperature intolerant individual.
Then, the genotype of each individual is counted according to the sequencing result, and the genotype information is introduced into SPSS software for calculationPValue, selectP<0.01Marker, and finally 1 INDEL marker, numbered A257, was selected.
The low temperature tolerant genotype of the molecular marker A257 is an AA gene homozygous insertion type, the nucleotide sequence of the molecular marker is shown in SEQ ID No.1, the 510 th base is A, and the amplification primers for developing the molecular marker are A257-F and A257-R shown in Table 3.
4. Low temperature tolerant and non-tolerant individuals PCR amplification and electrophoresis
Extracting tissue DNA of 40 Penaeus japonicus individuals as a template to carry out PCR, wherein PCR primers are as follows:
A257-F: ATGCAAGCATCTGCACAGG；
A257-R: CCAGGCGTACACTTTAGGAAT。
the PCR system and amplification conditions were the same as described above.
After amplification, the individual template PCR products obtained were subjected to 1% agarose gel electrophoresis. And sequencing the residual PCR products, wherein the sequencing result is shown in figure 1, and the base mutation of the low-temperature tolerant penaeus japonicus is homozygous insertion of the A gene.
In summary, the molecular marker a257 of the present invention can accurately identify individuals with low temperature resistance in penaeus japonicus, and the application steps can be summarized as follows: extracting genomic DNA in a penaeus japonicus sample, and performing PCR amplification reaction by using the extracted genomic DNA as a template and using molecular-labeled amplification primers A257-F and A257-R; and (3) carrying out agarose gel electrophoresis on the PCR amplification product and sequencing, wherein if the genotype of the A257 is AA in the sequencing result, the homozygous insertion mutation is shown, namely, the 510 th base of the molecular marker A257 is A, the Penaeus japonicus sample has low temperature resistance. The molecular marker A257 can also be used for identifying low-temperature resistant parents and fries of the penaeus japonicus, and is beneficial to the breeding development of the penaeus japonicus.
The above examples are only intended to illustrate the technical solution of the present invention, but not to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, it will be apparent to those skilled in the art that various changes may be made and equivalents may be substituted for elements thereof; and such modifications or substitutions do not depart from the spirit and scope of the corresponding technical solutions.
Sequence listing
<110> research institute for aquatic products in yellow sea of China institute for aquatic science
<120> low-temperature-resistant molecular marker C6101 of penaeus japonicus and application thereof
<160> 3
<170> SIPOSequenceListing 1.0
<210> 1
<211> 1002
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 1
tgagctccga gcgcgcgatg actggagctg ggaggacgag cagagcggtg ttgcctctcc 60
cggcgccgcg cgaccactgg cgggaaagtg agtcgaaaga gcggcagatc gacggtgcag 120
cgaggccggc cccagccaga attttccttc aataatgccc ttcactctgg atctcatgct 180
tgagaactgg atttgcgccg cgtgatctat catcgttgat ggacggaatt taaaggatgc 240
atttccctgc acttgcaagg ggtattttgt tgttgttgtt agctacgtta gcaatacaga 300
tagtttacaa gttcttgaac ttcaaggagc taacaactca tacattatac attctgaaat 360
ttcaatatac attatcccct agattatgca agcatctgca caggacgtta aacttaagaa 420
ctctttcatg gacataattt atgtgaatgt gtataagcta cttatcccgg gggagaaaga 480
ggatagaagg gggatggtag caaaaaaaaa tgattattat ttctcagtag ttctaagaaa 540
tccagatttt gcaattataa gatgtttctc agtgtctcaa catcgtttaa atcgttaaaa 600
aaaaaaaaaa actttttaat acgcagtacc aaccttaaag gtaagtgtgc gttatacgtg 660
tacccaaaat gaacaaattc ctaaagtgta cgcctggcat tttattagac tttcacttat 720
catacctcca aatttattcc ataacttcgt gtattatcca atctgcctat aatcgacaat 780
ctgcccacac gtgtaaaggg atatcaaagg cttatcctgc gaccgaagcc ttgtaacaca 840
tctcgatgtt ctctggagat ggctcggaat atgtttgaca ggactgcgtc tttaaatgcg 900
ctatggctgt accatctgcc tctaattcca tacatagaat gacctggtaa caaaagcgat 960
tattctttgt accatcaaat atgcaattta caacatcata tc 1002
<210> 2
<211> 19
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 2
atgcaagcat ctgcacagg 19
<210> 3
<211> 21
<212> DNA
<213> Artificial Sequence (Artificial Sequence)
<400> 3
ccaggcgtac actttaggaa t 21
Claims (9)
1. A low-temperature-resistant molecular marker A257 of Penaeus japonicus is characterized in that the nucleotide sequence of the molecular marker A257 is shown in SEQ ID No. 1.
2. The low temperature resistant molecular marker A257 of Penaeus japonicus as claimed in claim 1, wherein the base at position 510 of the molecular marker A257 is A.
3. The low temperature resistant molecular marker A257 of Penaeus japonicus as claimed in claim 1, wherein the low temperature resistant genotype of the molecular marker A257 is AA homozygous insertion genotype.
4. The amplification primer of the molecular marker A257 of claim 1, wherein the nucleotide sequence of the amplification primer is shown as SEQ ID No.2 and SEQ ID No. 3.
5. The use of the molecular marker A257 of claim 1 or the amplification primer of claim 4 in screening low temperature resistant varieties of Penaeus japonicus.
6. The application of claim 5, wherein the screening step of the low temperature resistant variety of the Penaeus japonicus is as follows:
(1) synthesizing an amplification primer with a nucleotide sequence shown as SEQ ID No.2 and SEQ ID No. 3;
(2) extracting the genomic DNA of the penaeus japonicus to be detected;
(3) performing PCR amplification on the extracted genome DNA by using an amplification primer, and sequencing an amplification product;
(4) if the sequencing result shows that the gene is homozygous and insertional mutated, the penaeus japonicus is a low temperature resistant variety.
7. The use of claim 6, wherein the sequencing result in step (4) shows that the AA gene is homozygous insertion mutation, i.e., the 510 th base of the molecular marker A257 is A, so that the Penaeus japonicus is a low temperature resistant variety.
8. The use according to claim 6, wherein the PCR amplification conditions are: pre-denaturation at 94 deg.C for 5 min; denaturation at 94 deg.C for 30s, annealing at 55 deg.C for 30s, extension at 72 deg.C for 30s, and repeating for 32 cycles; the circulation extends for 72 ℃ for 7 min.
9. Use of the molecular marker a257 of claim 1 or the amplification primer of claim 4 in genetic diversity analysis, germplasm identification and genetic map construction of penaeus japonicus.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111060275.0A CN113621714B (en) | 2021-09-10 | 2021-09-10 | Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202111060275.0A CN113621714B (en) | 2021-09-10 | 2021-09-10 | Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113621714A true CN113621714A (en) | 2021-11-09 |
| CN113621714B CN113621714B (en) | 2023-03-24 |
Family
ID=78389753
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202111060275.0A Active CN113621714B (en) | 2021-09-10 | 2021-09-10 | Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113621714B (en) |
Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002267A (en) * | 2015-06-15 | 2015-10-28 | 浙江省海洋开发研究院 | Penaeus japonicus molecule marking method and application |
| CN105567865A (en) * | 2016-03-23 | 2016-05-11 | 厦门大学 | SNP (single-nucleotide polymorphism) marker related to Marsupenaeus japonicus heat resistance and detection method thereof |
-
2021
- 2021-09-10 CN CN202111060275.0A patent/CN113621714B/en active Active
Patent Citations (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN105002267A (en) * | 2015-06-15 | 2015-10-28 | 浙江省海洋开发研究院 | Penaeus japonicus molecule marking method and application |
| CN105567865A (en) * | 2016-03-23 | 2016-05-11 | 厦门大学 | SNP (single-nucleotide polymorphism) marker related to Marsupenaeus japonicus heat resistance and detection method thereof |
Non-Patent Citations (1)
| Title |
|---|
| ANONYMITY: "Penaeus japonicus isolate Ginoza2017 unplaced genomic scaffold, Mj_TUMSAT_v1.0 scaffold_06849, whole genome shotgun sequence", 《GENBANK数据库》 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN113621714B (en) | 2023-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN105506162B (en) | SNP (single nucleotide polymorphism) marker related to rapid growth of crassostrea gigas as well as identification method and application thereof | |
| CN110747282B (en) | Low-salt-resistant molecular marker C22 of portunus trituberculatus and application thereof | |
| CN110747281B (en) | Low-salt-resistant molecular marker C62 of portunus trituberculatus and application thereof | |
| CN111996261A (en) | Macrobrachium rosenbergii sex molecular marker primer and application thereof | |
| CN115261489A (en) | Catharanthus roseus microsatellite marker primer group and application and evaluation method thereof | |
| CN113789394B (en) | Molecular marker C13 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN113604587B (en) | Molecular marker T5198 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN113736891B (en) | Molecular marker G2997 for rapidly identifying low-temperature tolerant variety of penaeus japonicus and application thereof | |
| CN111057771B (en) | SNP molecular marker for distinguishing 'Zhongyang No. 1' from common fugu obscurus and application thereof | |
| CN110724748B (en) | Molecular marker C3 of portunus trituberculatus parahaemolyticus and application thereof | |
| CN109536624B (en) | Fluorescent molecular marker and detection method for discriminating true and false male fish of cynoglossus semilaevis | |
| CN109439771B (en) | Method for identifying family of hybrid porgy by using microsatellite marker | |
| CN113584187A (en) | Molecular marker A2629 for screening penaeus japonicus with low temperature resistance, amplification primer and application thereof | |
| CN113584188A (en) | Low-temperature-resistant molecular marker C6101 of penaeus japonicus and application | |
| CN113621714B (en) | Low-temperature-resistant molecular marker A257 of penaeus japonicus and application thereof | |
| CN113801945B (en) | Molecular marker C768 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN110724749B (en) | Molecular marker C104 of portunus trituberculatus resistant vibrio parahaemolyticus and application thereof | |
| CN114717333A (en) | Molecular marker 9W1 related to prawn reproduction traits and application thereof | |
| CN114875158A (en) | Molecular marker 27W1 for breeding high-fertility prawn population and application thereof | |
| CN116732199A (en) | Molecular marker T3368 for identifying low temperature resistance of penaeus japonicus and application thereof | |
| CN110724750B (en) | Molecular marker C242 of portunus trituberculatus parahaemolyticus and application thereof | |
| CN113981112B (en) | InDel marker C3082 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| CN113930518B (en) | Molecular marker C49 for identifying ammonia nitrogen tolerance character of portunus trituberculatus and application thereof | |
| CN113981113B (en) | InDel marker C142 for identifying ammonia nitrogen tolerance character of portunus trituberculatus, primers and application thereof | |
| CN110791572B (en) | Molecular marker C7 of portunus trituberculatus parahaemolyticus and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |