CN113604594B - SNP molecular marker related to jujube and wild jujube citric acid and application thereof - Google Patents
SNP molecular marker related to jujube and wild jujube citric acid and application thereof Download PDFInfo
- Publication number
- CN113604594B CN113604594B CN202110873728.5A CN202110873728A CN113604594B CN 113604594 B CN113604594 B CN 113604594B CN 202110873728 A CN202110873728 A CN 202110873728A CN 113604594 B CN113604594 B CN 113604594B
- Authority
- CN
- China
- Prior art keywords
- jujube
- citric acid
- wild
- molecular marker
- breeding
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6888—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms
- C12Q1/6895—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for detection or identification of organisms for plants, fungi or algae
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/13—Plant traits
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/156—Polymorphic or mutational markers
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Analytical Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Health & Medical Sciences (AREA)
- Biotechnology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Immunology (AREA)
- Mycology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Botany (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Genetics & Genomics (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a SNP molecular marker related to jujube and wild jujube citric acid and application thereof. The SNP molecular marker is positioned in the ZjACO3 gene promoter region of the jujube, and the mutation site is the mutation of-284A > G. According to the invention, through identifying the relation between the ZjACO3 promoter sequence and citric acid accumulation, SNP molecular markers related to citric acid are developed, and further through KASP typing, the direct and rapid genetic identification of seedling is realized, the genome breeding value (Genomic Estimated Breeding Value, GEBV) is estimated in early prediction, the wild resource domestication breeding and the early evaluation of related hybridization breeding can be carried out, a rapid breeding technology system is established, and the optimization and the upgrading of variety structure are promoted.
Description
Technical Field
The invention relates to the technical field of molecular genetics, in particular to a SNP molecular marker related to jujube and wild jujube citric acid and application thereof.
Background
Jujube (Ziziphus jujuba mill.) is the most important economic tree species of the family rhamnaceae, with a 7000 year history of cultivation and use. The jujube has rich nutritive value, high sugar content and low acid content, and a small amount of malic acid is mainly accumulated. The jujube is obtained by domestication and breeding of wild jujube (ziphus jujuuba Mill. Var. Spinosa Hu), the jujube has extremely sour taste and high acid content, and a large amount of citric acid and malic acid are accumulated. A series of intermediate types exist in the process of domesticating wild jujube to jujube, so that the wild jujube is a candidate germplasm library for cultivating jujube, and the wild jujube is sour and sweet in taste and is a medium-low acid type. The rapid decrease in citric acid content is an important cause of the loss of sour taste during domestication of the cultivated jujube. Citric acid is synthesized mainly through tricarboxylic acid cycle and glyoxylate cycle processes, and the synthesized citric acid can be converted into isocitric acid by aconitate hydratase (Aconitate hydratase, ACO) and further degraded. Early scholars suggested that in citrus fruits, the accumulation of citric acid was due to inhibition of aconitate hydratase (Aconitate hydratase, ACO) activity (Bogin and Wallace, orgnic acid synthesis and accumulation in sweet and sour lemon guides of the American Society for Horticultural science 1966.89:182-194). Early stage we identified 4 members of the ACO gene family based on whole genome sequencing of jun jujubes, found that ZjACO3 (zj. Jz 0133123003) was selected in jujube fruit acclimation by re-sequencing the whole genome of 31 cultivated jujubes and wild jujubes (Huang et al, the jujube genome provides insights into genome evolution and the domestication of sweetness/acidity taste in fruit tress. Plos genes.2016, 12 (12): e 1006433), and further analyzed to find SNP (Single Nucleotide polymorphisms) mutation sites in the upstream promoter region of the gene, presumably affecting the accumulation of citric acid in jujube fruits.
Early morphological and enzymatic approaches were used to classify and identify germplasm resource diversity, SSR (Simple sequence repeats) was used to identify species genetic diversity and to flag important agronomic traits with tremendous advances in biotechnology over the last 20 years. In recent 10 years, along with the progress of genome sequencing technology and the reduction of cost, SNP (Single Nucleotide polymorphisms) molecular markers are developed in a large scale, and compared with SSR molecular markers, the molecular markers are more accurate and simpler in statistics. Among them, KASP (Kompetitive Allele Specific PCR, competitive allele-specific PCR) can rapidly and precisely double-allele-type a target SNP. A large number of SNP molecular markers were developed by researchers by sequencing the entire genome of jujube and sequencing the population (Guo et al genomic analyses of diverse wild and cultivated accessions provide insights into the evolutionary history of jujube.plant Biotechnology journal 2020, 19:517-531). However, no research on molecular markers related to quality traits of jujube fruits has been conducted so far.
Disclosure of Invention
Aiming at the prior art, the invention aims to provide SNP molecular markers related to jujube and wild jujube citric acid and application thereof. According to the invention, through identifying the relation between the ZjACO3 promoter sequence and citric acid accumulation, SNP molecular markers related to citric acid are developed, and further through KASP typing, the direct and rapid genetic identification of seedling is realized, the genome breeding value (Genomic Estimated Breeding Value, GEBV) is estimated in early prediction, the wild resource domestication breeding and the early evaluation of related hybridization breeding can be carried out, a rapid breeding technology system is established, and the optimization and the upgrading of variety structure are promoted.
In order to achieve the above purpose, the invention adopts the following technical scheme:
in a first aspect of the invention, a SNP molecular marker related to jujube and wild jujube citric acid is provided, the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and the 1070 th base R in the sequence is A or G, so that polymorphism of the citric acid content occurs. The method comprises the following steps:
ATGGCGAATCGTAACCGTTCATTTTCATAGAAACTTTAACTTTGAGTTCATCCCAAACGCTACATTAAAGTACACAGTACACTACATCATAAATAATGCACCACCACTCGATTATCAACAACCACATCTAGCCGTTGCATTTTCTATGGCCCACTTTCCATTAAGATTTTGCAAAGAACACGTGGGCCAGTGAAAACCAACGCTGCTATTCTCGTGTACAGCTTAAAATATCTCTTACTATTCAATTCAAAGCGAAGGAAGAGAGAATAGTCGTATAAGTAGGATGATGCCACTTGACCACGCCTCCTGCGAAACTTCCAAGAGTTGCCGATTCATGGGCACGCGGCTCAATACTTAAAGCACTCTCTAAGATATTAGATATATATCAAAATACACCCAGCCAGGCAATCTGAAAGTGACACATACACGCCCCAAGTCTATTAACCGACTATTATCGGAATTTTCTTAATCCCATTCCACACGTCTAATAAATTGTTTTATTATATTCCACGTAGTTAGAATTTTTTTTGGGTTAATCACGTAGTTAGGATATTTGTATAATTTAAAGTGGTTGTTTCAATTCAATATAATTATTATATAATATTCTCTTTCTTTATTGAAATCAGCTTATTTGTAATAAGCCATTATTTTTAGGCATAAGAATTAAAAATTTAAATTATATTCTATTTTTTTAAAAAAATATTATTTATTATTAATGATGAGATTTATATATCAAATAATAATTTAGATAGTTATTATTAAAATTTTATTTTTAAAATTTTAAAATAAGAATAATAAAATTAAATATTTTAATTAAAATTTGTTAGATAAATTGATAATTATAGTAACTAATTGTACACAACAAAACTCTTTTTTAAGAAAAAAAAAGATTTTAAACTAATAAAAAATTCAATTTGAAGAAGAAAATGGAAAAGAAAAAAGAAAAAAGAAAAAAGAAAAAAAGACATTTATCAATAAAAAGAAGGTTAAAATGGCCAAAAAATGGGTTGAATTGATAGGGGGATAGTTTGGATTTGGAACTTGTTTTGGGTGCATTTGATCACAGACARGTGAAGCCCACGAATTGGGCAAATTTTCGCAGAGGGGATTGAGATTTTGAGAGGGGGAGAGAGAGAGAGAGAGGCTCCTCAATTGTATAAAGCTCGCAACAAAGGCAGTTTACTTCTAGAAAAGTGGCACGCAGCCCTAGGTCTTCTTTCAATTTTCAGCCTCGCCACACGCCACACGCCACACGCCACACGCCACCTACTATGTTAACTTTCTCTTTCTCTCTCTATCACTAACTCAGACCAGAACAGTCG(SEQ ID NO.1)
the SNP molecular marker is positioned in a ZjACO3 gene promoter region, and a mutation site is a mutation of-284A > G. The mutation site was determined based on the ZjACO3 gene, gene id Zj.jz 0133123003, database linking http:// dx.doi.org/10.5061/dryad.83fr7. With the start codon of the ZjACO3 gene as +1. The promoter region is characterized by a mutation from an upstream-486 bp to-481 bp homocitric acid type site CAAGTG to a low acid type site CAGGTG (MYB cis-binding element). When the base of the-484 bp locus is detected to be homozygous A/A type, the gene is judged to have low expression level and high citric acid content, and the gene is the main genotype of the wild jujube group; when the base of the-484 bp locus is detected to be a homozygous G/G type, judging that the gene expression level is high, citric acid is largely degraded, the content is low, and the genotype is the main genotype of the cultivated jujube group; when the site is detected to be A/G heterozygous, the citric acid content is medium-low, and the genotype exists in wild resource types with sweet and sour taste (stock germplasm of domestication breeding) and also exists in a few cultivation type jujube groups.
In a second aspect of the present invention, there is provided the use of the above SNP molecular marker in at least one of the following 1) to 3):
1) Detecting the citric acid content of the jujube or the wild jujube;
2) Screening jujube or wild jujube varieties with low citric acid content;
3) And breeding the jujube or wild jujube variety with high or low citric acid content.
In a third aspect of the present invention, there is provided a set of primers for amplifying the above SNP molecular markers, wherein the sequences of the primers are shown as SEQ ID NO.2 and SEQ ID NO.3, respectively. The method comprises the following steps:
forward primer: 5'-ATGGCGAATCGTAACCGTTC-3'; (SEQ ID NO. 2)
Reverse primer: 5'-CGACTGTTCTGGTCTGAGTT-3'. (SEQ ID NO. 3)
In a fourth aspect of the present invention, there is provided a kit for detecting the above SNP molecular markers, comprising the primers shown in SEQ ID NO.2 and SEQ ID NO. 3.
In a fifth aspect of the invention there is provided the use of a primer or kit as described above in at least one of the following 1) -3):
1) Detecting the citric acid content of the jujube or the wild jujube;
2) Screening jujube or wild jujube varieties with low citric acid content;
3) And breeding the jujube or wild jujube variety with high or low citric acid content.
In a sixth aspect of the present invention, there is provided a method of detecting the citric acid content of date or wild jujube, comprising the steps of:
extracting DNA of the jujube or the wild jujube to be detected and taking the DNA as a template, and carrying out PCR amplification by using primers shown in SEQ ID NO.2 and SEQ ID NO. 3; sequencing the amplified product, and judging the content of citric acid in the jujube or the wild jujube according to the sequencing result: the type of the amplification product with G at the 1070 th base has a lower citric acid content than the type of the amplification product with A at the 1070 th base.
Preferably, the conditions for PCR amplification are:
the PCR reaction system is as follows: the total volume was 50. Mu.L, which included a DNA sample (concentration: about 200 ng/. Mu.L) of 2. Mu.L, an upstream primer of 1.5. Mu.L, a downstream primer of 1.5. Mu.L, tks Gflex DNA Polymerase (1.25U/. Mu.L) (Takara) of 1. Mu.L, a 2 XGflex PCR Buffer (Mg) 2+ ，dNTP plus)(Takara)25μL、ddH 2 O19μL。
The PCR reaction procedure was: pre-denaturation at 94℃for 1min, then denaturation at 98℃for 10sec, renaturation at 58℃for 15sec, extension at 68℃for 45sec for 36 cycles, and finally incubation at 4 ℃.
In a seventh aspect of the present invention, there is provided a method for screening low citric acid content jujube or wild jujube, comprising the steps of:
genotyping detection is carried out on mutation sites-484A > G of ZjACO3 gene promoter regions of the jujubes to be detected or the wild jujubes; the A/A genotype is the high citric acid type, the G/G genotype is the low citric acid type, and the A/G genotype is the intermediate type.
Preferably, KASP genotyping technology is used for genotyping detection of mutation site-284A > G; the sequence of the KASP primer combination is shown as SEQ ID NO.4-SEQ ID NO. 6. The method comprises the following steps:
gene–F1：5′-HEX-GAAGGTCGGAGTCAACGGATTGTTTTGGGTGCATTTGATCACAGACAG-3′；(SEQ ID NO.4)
gene–F2：5′-FAM-GAAGGTGACCAAGTTCATGCTGTTTTGGGTGCATTTGATCACAGACAA-3′；(SEQ ID NO.5)
gene–R：5′-AAAATCTCAATCCCCRCTGCGAAAATTTGCCC-3′。(SEQ ID NO.6)
the primers were dissolved to 10. Mu.M with TE (pH 8.0) and then typed according to upstream primer F1: upstream typing primer F2: the downstream universal primers r=1:1:3 were mixed for use with 0.25 μl of primer mix per 3 μl of reaction system.
In detection, the PCR reaction system was as follows: 1.15. Mu.L of DNA template, 1.6. Mu.L of 2 XKASP Master mix, and 0.25. Mu.L of primer mix.
The PCR reaction conditions were: 95 ℃ 10min,95 ℃ 20sec, 61-55 ℃ 60sec 10 cycles, 95 ℃ 20sec, 55 ℃ 60sec 35 cycles, 25 ℃ 30sec.
Judging the genotype of each sample according to the fluorescent signal color: if the fluorescent signal is orange, the genotype of the-484 th site is AA, if the fluorescent signal is green, the genotype is GA, and if the fluorescent signal is blue, the genotype is GG.
The eighth aspect of the invention provides a method for breeding jujube or wild jujube varieties with low citric acid content, comprising the following steps:
genotyping detection is carried out on mutation sites-284A > G of ZjACO3 gene promoter regions of jujube or wild jujube; crossing two A/G genotypes, or G/G type and A/G date or wild jujube, and screening the filial generation of G/G genotype.
The invention has the beneficial effects that:
the invention provides an SNP molecular marker for identifying the citric acid content of jujube or wild jujube for the first time, wherein the molecular marker is from the ZjACO3 gene promoter region of jujube. The promoter region is characterized by a mutation from an upstream-486 bp to-481 bp homocitric acid type site CAAGTG to a low acid type site CAGGTG (MYB cis-binding element). The invention provides an efficient and accurate molecular technology for domestication and breeding related to jujube fruit organic acid.
Drawings
FIG. 1 is a ZjACO3 upstream promoter region sequence;
FIG. 2 is a diagram of the sequencing peaks at-484 bp and nearby of the jujube and wild jujube promoter regions;
FIG. 3 is a chart showing the citric acid content of-484 bp different genotypes;
FIG. 4 is a KASP genotyping map of a portion of the sample.
Detailed Description
It should be noted that the following detailed description is illustrative and is intended to provide further explanation of the present application. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.
As described in the background section, the citric acid content of jujube or wild jujube affects the mouthfeel and nutritional value of the fruit. If SNP molecular markers related to the citric acid content in the jujubes or the wild jubes can be found, a rapid breeding technology system can be established for wild resource domestication breeding and related early evaluation of hybridization breeding. However, no research on molecular markers related to quality traits of jujube fruits has been carried out so far.
Based on the above, the invention develops a SNP molecular marker suitable for identifying the content of the citric acid in the jujube or the wild jujube by identifying the relationship between the ZjACO3 promoter sequence and the accumulation of the citric acid. The molecular marker is derived from a ZjACO3 gene promoter region. The promoter region is characterized by a mutation from an upstream-486 bp to-481 bp homocitric acid type site CAAGTG to a low acid type site CAGGTG (MYB cis-binding element).
When the base of the-484 bp locus is detected to be homozygous A/A type, the gene is judged to have low expression level and high citric acid content, and the gene is the main genotype of the wild jujube group; when the base of the-484 bp locus is detected to be a homozygous G/G type, judging that the gene expression level is high, citric acid is largely degraded, the content is low, and the genotype is the main genotype of the cultivated jujube group; when the site is detected to be A/G heterozygous, the citric acid content is medium-low, and the genotype exists in wild resource types (stock germplasm of domestication breeding) with sour and sweet taste and also exists in cultivated jujube groups with sour and sweet taste.
The invention also provides a method for detecting the low acid or the high citric acid of the wild jujube by using the SNP molecular marker. PCR amplification and sequencing are adopted to detect that the base of the ZjACO3 gene promoter region-484 bp is A or G, wherein the A/A type is high acid type, the G/G type is low acid type and the A/G type is intermediate type.
In order to implement the invention, according to ZjACO3 promoter sequence and early re-sequencing result, conservative upstream and downstream sequencing primers are designed, and the primers are respectively as follows:
forward primer: 5'-ATGGCGAATCGTAACCGTTC-3'; (SEQ ID NO. 2)
Reverse primer: 5'-CGACTGTTCTGGTCTGAGTT-3'. (SEQ ID NO. 3)
The PCR reaction system is as follows: the total volume was 50. Mu.L, which included a DNA sample (concentration: about 200 ng/. Mu.L) of 2. Mu.L, an upstream primer of 1.5. Mu.L, a downstream primer of 1.5. Mu.L, tks Gflex DNA Polymerase (1.25U/. Mu.L) (Takara) of 1. Mu.L, a 2 XGflex PCR Buffer (Mg) 2+ ，dNTP plus)(Takara)25μL、ddH 2 O19μL。
The PCR reaction procedure was: pre-denaturation at 94℃for 1min, then denaturation at 98℃for 10sec, renaturation at 58℃for 15sec, extension at 68℃for 45sec for 36 cycles, and finally incubation at 4 ℃.
The PCR product can be cloned and sequenced, the PCR product is purified and then is led into a cloning vector, DH5a escherichia coli is genetically transformed, 6 positive bacterial plaques are respectively picked up, each bacterial plaque is respectively sequenced by shaking bacteria and extracting plasmids, and the genotype of the-484 bp position is identified; the PCR product can also be directly sequenced to identify A or G, or perhaps an A/G overlap, that is single-peaked at-484, and the genotype of the sample can be determined.
In another embodiment, KASP genotyping technology is used to detect that the upstream-484 bp base of ZjACO3 gene promoter region of the genome to be detected is G or A, KASP primer combination is designed according to the sequence of the locus and the upstream region, and the KASP primer combination comprises two upstream typing primers F1 (the 3 'end is the variant type G), F2 (the 3' end is the variant type A) and a downstream universal primer R, wherein the F1 joint is paired with a universal fluorescent joint HEX (blue), the F2 joint is paired with a universal fluorescent joint FAM (orange), and the primer sequences are respectively
gene–F1：GAAGGTCGGAGTCAACGGATTGTTTTGGGTGCATTTGATCACAGACAG
gene–F2：GAAGGTGACCAAGTTCATGCTGTTTTGGGTGCATTTGATCACAGACAA
gene–R：AAAATCTCAATCCCCRCTGCGAAAATTTGCCC
The primers were dissolved to 10. Mu.M with TE (pH 8.0) and then typed according to upstream primer F1: upstream typing primer F2: the downstream universal primer r=1:1:3 ratio (volume ratio) was mixed for use, adding 0.25 μl of primer mixture per 3 μl of reaction system.
In detection, the PCR reaction system was as follows: 1.15. Mu.L of DNA template, 1.6. Mu.L of 2 XKASP Master mix, and 0.25. Mu.L of primer mix.
The PCR reaction conditions were: 95 ℃ 10min,95 ℃ 20sec, 61-55 ℃ 60sec 10 cycles, 95 ℃ 20sec, 55 ℃ 60sec 35 cycles, 25 ℃ 30sec.
Judging the genotype of each sample according to the fluorescent signal color: if the fluorescent signal is orange, the genotype of the-484 th site is A/A, and if the fluorescent signal is green, the genotype is A/G; if the fluorescent signal is blue, the genotype is G/G.
Embodiments also include detecting the citric acid content of the mature fruit of jujube or wild jujube.
The invention further provides a novel hybridization combination, namely, two medium-low acid wild jujube are hybridized, a homozygous low acid G/G genotype is screened, and genotype resources are provided for diversified breeding.
In order to enable those skilled in the art to more clearly understand the technical solutions of the present application, the technical solutions of the present application will be described in detail below with reference to specific embodiments.
The test materials used in the examples of the present invention are all conventional in the art and are commercially available. The experimental procedure, without specifying the detailed conditions, was carried out according to the conventional experimental procedure or according to the operating instructions recommended by the suppliers.
Example 1: determination of citric acid content of jujube and wild jujube
Sample collection jujube germplasm resources are collected at an demonstration base of a Shandong province fruit tree institute, wild jujubes are respectively collected from regions such as Hebei Tai mountain, shandong Taishan mountain and Weishan, 15 mature-period (semi-red) fruits are selected for each variety, sampling positions comprise symmetrical positions, every five fruits serve as a biological repetition, the samples are cut into blocks, and then immediately frozen by liquid nitrogen, and the cut wild jujubes are stored in a-80 refrigerator for standby.
Weighing 1g of fruit fragments, placing in a precooled mortar, adding 5ml of KH with concentration of 3% 2 PO 4 The extract was ground to a homogenate on ice and transferred to a sterilized 10ml dry centrifuge tube. Extracting organic acid by ultrasonic at normal temperature for 20min. 60 at 4 DEG CCentrifuging at 00r/min for 20min, and collecting supernatant; adding 3ml KH into pulp residue 2 PO 4 The organic acid is extracted again by ultrasonic, the two extracting solutions are combined, the volume is fixed to 10ml by a volumetric flask, and the supernatant is filtered by a 0.22 mu m filter membrane and is added into a sample bottle.
The citric acid standard is treated with KH 2 PO 4 Standard solutions (0.05, 0.1, 0.25, 0.5, 1.0mg/m L) with different concentrations are prepared for the grinding extract, and are used for drawing a citric acid standard curve.
The citric acid detection conditions are as follows: an Agilnet C18 (4.6x250 mm) column; UV Detector L-2400 Detector; the detection wavelength is 210nm; detecting the temperature to 30 ℃; mobile phase is 0.01mol/L KH 2 PO 4 (pH 2.3): chromatographic grade methanol (volume ratio 4:1); the flow rate is 1mL/min; the sample volume was 10. Mu.L. Three sample injections were repeated for each sample, three biological replicates for each variety, and the citric acid content was calculated by standard curve formula.
Example 2: zjACO3 fluorescent quantitative PCR expression level analysis
RNA extraction: the total RNA of fruits is extracted by using a Takara polysaccharide polyphenol plant total RNA extraction kit, and the specific steps are shown in the specification.
Reverse transcription: the cDNA reverse transcription kit is Takara reverse transcription kit PrimeScript TM RT Master MixT。
Quantitative analysis: the fluorescent quantitative PCR analysis kit is ChamQ Universal SYBR qPCR Master Mix (Vazyme), and the experimental instrument is an IQ5 (Bio-Rad) PCR instrument. The PCR system was 1. Mu.l of cDNA, 10. Mu.l of SYBR Master Mix, 0.4. Mu.l (10. Mu.M) of each forward and reverse primer, and 20. Mu.l of the total reaction system. The reaction procedure is: UBQ was used as an internal reference gene (Zhang et al, 2015) in 3min at 95℃for 5s and 30s at 56℃for 40 cycles. Using equation 2 ∧-Delta CT The relative expression levels of the genes were calculated by the method. The result for each gene for each sample is the average of 3 biological and technical replicates, and the average with standard error was calculated using SPSS25.0 software.
Example 3: correlation analysis of ZjACO3 expression level and citric acid content
The results of the determination of the citric acid content and the ZjACO3 expression level in the jujubes and the wild jubes are shown in Table 1.
Table 1: genotype, citrate content and ZjACO3 expression levels of different jujube and wild jujube types
Note that: measuring the citric acid content of 45 diversity wild jujube samples and 22 fruits of different jujube varieties in the mature period, and analyzing the ZjACO3 gene expression; randomly selecting 34 wild jujube and 18 jujube promoter regions for sequencing; genotype designation ns is the un-sequenced sample.
The correlation of zjo 3 expression levels and citric acid content was analyzed using Spearman calculation using SPSS software and showed a significant negative correlation (-0.620, p < 0.01).
Example 4: cloning sequencing of promoters
Genomic DNA extraction: the genome extraction method of jujube and wild jujube leaves utilizes an improved CTAB method (see Zhang Chunmei SSR primer development and genetic diversity research of wild jujube, and the university of northwest agriculture and forestry science and technology, shu's treatises) to extract: 0.2g of leaf liquid nitrogen was ground and transferred to a 1.5ml sterile centrifuge tube containing 300ml of 2 XCTAB. Water bath at 65℃for 30min, 800. Mu.l CIA chloroform was added: isoamyl alcohol=24:1 (V: V)) was mixed well and centrifuged at 12000rpm for 5min. The supernatant was transferred to a new 1.5ml centrifuge tube, added with equal volume CIA and mixed well and centrifuged at 12000rpm for 5min. After centrifugation, the supernatant was placed in a new 1.5ml centrifuge tube, and added with equal volumes of ice isopropanol and thoroughly mixed, and DNA was precipitated at-30℃for 10min. Centrifuge at 12000rpm at 4℃for 5min. The supernatant was decanted, the DNA was washed with ice absolute ethanol, centrifuged again at 12000rpm at 4℃for 5min, the supernatant was discarded, and the DNA was dried in a kitchen. Add 50. Mu.l TE buffer to dissolve DNA.
And (3) PCR amplification: according to the sequencing data of the early date genome, a promoter sequence of about 1300bp at the upstream of a gene is amplified (figure 1), a PCR primer of a ZjACO3 gene upstream promoter is designed, a forward primer 5 'ATGGCGAATCGTAACGTTC and a reverse primer 5' CGACTGTTCTGGTCTGAGTT are used, the genomic DNA is used as a template for PCR amplification, a PCR kit is Takara TKs high-fidelity polymerase, and the amplification program is 94 ℃ 1min,98 ℃ 10s, 56 ℃ 15s, 68 ℃ 30s and 30 cycles. And detecting the PCR product by using 1.5% agarose gel electrophoresis, and cutting the gel to recover the target band, wherein the gel recovery method refers to a universal DNA purification recovery kit.
Sequencing of the promoter region: the target band was constructed into Cloning vector to transform DH5a E.coli by using 5minTMTA/Blunt-Zero Cloning Kit (Vazyme) in a total reaction system of 5. Mu.L including purified product of 5 XTA/Blunt-Zero Cloning Mix 1. Mu. L, PCR (concentration: about 90 ng/. Mu.L) 2. Mu. L, ddH 2 O2. Mu.L, at 25℃for 30min.
Transferring the reaction product into DH5 alpha chemically competent cells by using a heat shock conversion method, adding 500 mu L of LB to culture for 60min based on shaking table shake recovery at 37 ℃, taking 30 mu L of bacterial liquid into 3mL of LB liquid medium containing Amp, shaking and culturing for 12h at 200rpm in a shaking table at 37 ℃, scribing on an LB plate containing Amp, and sending positive clone bacterial liquid to Rui Boxing family biotechnology Co. The 6 positive clones for each variety were sequenced separately to distinguish between homozygous or heterozygous genotypes. The PCR products can also be sequenced directly, and the alignment observation-484 bp site is a single peak A, G or a cap peak containing A and G (FIG. 2).
Example 5: sequence alignment analysis
The sequence of the ZjACO3 gene sequencing promoter region of 34 diversified wild jujube resources and 18 jujube varieties is compared by using biokit software and a ClustalW Multiple alignment method, the genotype of a locus of-484 bp at the upstream of the compared promoter region is G/G, A/G, A/A type, the cultivated jujube with extremely low citric acid is G/G type, the wild jujube with extremely high citric acid is A/A type, and the wild jujube with sweet and sour taste is A/G type (table 1, figure 3).
The correlation coefficient of the genotype and the citric acid content of 52 sequencing samples (comprising jujube and wild jujube) in table 1 was 0.812, and the correlation coefficient was very significantly correlated.
Example 6: establishment of KASP detection System
Designing KASP primer combination according to ZjACO3 promoter upstream-484 bp locus sequence and upstream region, comprising two upstream parting primers F1 (HEX fluorescent linker), F2 (FAM fluorescent linker) and downstream general primer R, wherein the primer sequences are respectively
gene–F1：GAAGGTCGGAGTCAACGGATTGTTTTGGGTGCATTTGATCACAGACAG
gene–F2：GAAGGTGACCAAGTTCATGCTGTTTTGGGTGCATTTGATCACAGACAA
gene–R：AAAATCTCAATCCCCRCTGCGAAAATTTGCCC
The primers were dissolved to 10. Mu.M with TE (pH 8.0) and then typed as upstream primer 1: upstream typing primer 2: the downstream universal primer=1:1:3 ratio (volume ratio) was mixed for use, adding 0.25 μl of primer mixture per 3 μl of reaction system.
In detection, the PCR reaction system was as follows: 1.15. Mu.L of DNA template, 1.6. Mu.L of 2 XKASP Master mix, and 0.25. Mu.L of primer mix.
The PCR reaction conditions were: 95 ℃ 10min,95 ℃ 20sec, 61-55 ℃ 60sec 10 cycles, 95 ℃ 20sec, 55 ℃ 60sec 35 cycles, 25 ℃ 30sec.
The main reagent consumable is KASP 2 XPCR mix, STO Rox, PCR plate, and sealing plate; the main experimental instrument is a fluorescent quantitative PCR instrument.
Judging the genotype of each sample according to the fluorescent signal color: if the fluorescent signal is orange, the genotype at position-484 is A/A, if the fluorescent signal is green, the genotype is A/G, and if the fluorescent signal is blue, the genotype is G/G (FIG. 4).
And genotyping the partial sequencing sample by using the method, wherein the fluorescence result is consistent with the sequencing result.
The foregoing description is only of the preferred embodiments of the present application and is not intended to limit the same, but rather, various modifications and variations may be made by those skilled in the art. Any modification, equivalent replacement, improvement, etc. made within the spirit and principles of the present application should be included in the protection scope of the present application.
SEQUENCE LISTING
<110> Shandong agricultural university
<120> SNP molecular markers related to jujube and wild jujube citric acid and application thereof
<130> 2021
<160> 6
<170> PatentIn version 3.5
<210> 1
<211> 1322
<212> DNA
<213> artificial sequence
<400> 1
atggcgaatc gtaaccgttc attttcatag aaactttaac tttgagttca tcccaaacgc 60
tacattaaag tacacagtac actacatcat aaataatgca ccaccactcg attatcaaca 120
accacatcta gccgttgcat tttctatggc ccactttcca ttaagatttt gcaaagaaca 180
cgtgggccag tgaaaaccaa cgctgctatt ctcgtgtaca gcttaaaata tctcttacta 240
ttcaattcaa agcgaaggaa gagagaatag tcgtataagt aggatgatgc cacttgacca 300
cgcctcctgc gaaacttcca agagttgccg attcatgggc acgcggctca atacttaaag 360
cactctctaa gatattagat atatatcaaa atacacccag ccaggcaatc tgaaagtgac 420
acatacacgc cccaagtcta ttaaccgact attatcggaa ttttcttaat cccattccac 480
acgtctaata aattgtttta ttatattcca cgtagttaga attttttttg ggttaatcac 540
gtagttagga tatttgtata atttaaagtg gttgtttcaa ttcaatataa ttattatata 600
atattctctt tctttattga aatcagctta tttgtaataa gccattattt ttaggcataa 660
gaattaaaaa tttaaattat attctatttt tttaaaaaaa tattatttat tattaatgat 720
gagatttata tatcaaataa taatttagat agttattatt aaaattttat ttttaaaatt 780
ttaaaataag aataataaaa ttaaatattt taattaaaat ttgttagata aattgataat 840
tatagtaact aattgtacac aacaaaactc ttttttaaga aaaaaaaaga ttttaaacta 900
ataaaaaatt caatttgaag aagaaaatgg aaaagaaaaa agaaaaaaga aaaaagaaaa 960
aaagacattt atcaataaaa agaaggttaa aatggccaaa aaatgggttg aattgatagg 1020
gggatagttt ggatttggaa cttgttttgg gtgcatttga tcacagacar gtgaagccca 1080
cgaattgggc aaattttcgc agaggggatt gagattttga gagggggaga gagagagaga 1140
gaggctcctc aattgtataa agctcgcaac aaaggcagtt tacttctaga aaagtggcac 1200
gcagccctag gtcttctttc aattttcagc ctcgccacac gccacacgcc acacgccaca 1260
cgccacctac tatgttaact ttctctttct ctctctatca ctaactcaga ccagaacagt 1320
cg 1322
<210> 2
<211> 20
<212> DNA
<213> artificial sequence
<400> 2
atggcgaatc gtaaccgttc 20
<210> 3
<211> 20
<212> DNA
<213> artificial sequence
<400> 3
<210> 4
<211> 48
<212> DNA
<213> artificial sequence
<400> 4
gaaggtcgga gtcaacggat tgttttgggt gcatttgatc acagacag 48
<210> 5
<211> 48
<212> DNA
<213> artificial sequence
<400> 5
gaaggtgacc aagttcatgc tgttttgggt gcatttgatc acagacaa 48
<210> 6
<211> 32
<212> DNA
<213> artificial sequence
<400> 6
aaaatctcaa tccccrctgc gaaaatttgc cc 32
Claims (3)
1. A SNP molecular marker related to jujube and wild jujube citric acid is characterized in that the nucleotide sequence of the molecular marker is shown as SEQ ID NO.1, and the 1070 th base in the sequence is A or G, so that polymorphism of the citric acid content is caused.
2. Use of a primer for amplifying the SNP molecular marker of claim 1 for detecting wild jujube and jujube citric acid content;
the sequences of the primers are respectively shown as SEQ ID NO.2 and SEQ ID NO. 3.
3. The application according to claim 2, characterized in that it comprises the following steps:
extracting DNA of the jujube or the wild jujube to be detected and taking the DNA as a template, and carrying out PCR amplification by using primers shown in SEQ ID NO.2 and SEQ ID NO. 3; sequencing the amplified product, and judging the content of citric acid in the jujube or the wild jujube according to the sequencing comparison result.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110873728.5A CN113604594B (en) | 2021-07-30 | 2021-07-30 | SNP molecular marker related to jujube and wild jujube citric acid and application thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN202110873728.5A CN113604594B (en) | 2021-07-30 | 2021-07-30 | SNP molecular marker related to jujube and wild jujube citric acid and application thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN113604594A CN113604594A (en) | 2021-11-05 |
| CN113604594B true CN113604594B (en) | 2023-05-16 |
Family
ID=78338814
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN202110873728.5A Active CN113604594B (en) | 2021-07-30 | 2021-07-30 | SNP molecular marker related to jujube and wild jujube citric acid and application thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN113604594B (en) |
Family Cites Families (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| FR2993574B1 (en) * | 2012-07-19 | 2015-05-29 | Inst Rech Developpement Ird | MOLECULAR MARKERS AND METHODS FOR THE EARLY IDENTIFICATION OF THE SEX OF PALM DATTIER |
-
2021
- 2021-07-30 CN CN202110873728.5A patent/CN113604594B/en active Active
Also Published As
| Publication number | Publication date |
|---|---|
| CN113604594A (en) | 2021-11-05 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN110117673B (en) | Molecular marker of brassica napus dwarf trait locus and application thereof | |
| CN106755481B (en) | SSR molecular marker VI for identifying progeny plants of Gala apples and application thereof | |
| CN109957614B (en) | Method for detecting insertion/deletion polymorphism of CMTM2 gene of goat and application of method | |
| CN110512025B (en) | Molecular marker closely linked with wheat powdery mildew resistance gene PmJM23 and application thereof | |
| CN102766697B (en) | Molecular marking method for detecting imidazolone herbicide resisting gene of cabbage type rape | |
| CN109517922B (en) | InDel molecular marker closely linked with major QTL synthesized by barley P3G and C3G and application thereof | |
| CN113046467B (en) | SNP locus obviously associated with wheat stripe rust resistance and application thereof in genetic breeding | |
| CN109251996B (en) | dCAPS marker for detecting low temperature resistant gene COLD1 genotype of rice and application | |
| WO2005071076A1 (en) | Gene markers linked to fusarium head blight-resistance factor and utilization thereof | |
| CN109517921B (en) | InDel molecular marker closely linked with major QTL synthesized by barley P3G and C3G and application thereof | |
| CN113604594B (en) | SNP molecular marker related to jujube and wild jujube citric acid and application thereof | |
| CN107760798B (en) | SSR molecular marker of seedless major QTL (quantitative trait locus) of grape fruit | |
| CN112176082A (en) | SNP molecular marker of wheat grain weight related gene and application thereof | |
| CN110527741A (en) | A kind of molecular labeling, primer and application with american pumpkin mildew-resistance biological strain 2F gene close linkage | |
| CN113584204B (en) | DNA fragment related to kernel yield of camellia seeds, SNP molecular marker closely linked with DNA fragment and application of DNA fragment | |
| CN113584203B (en) | DNA fragment related to single fruit quality of camellia oleifera, SNP molecular marker closely linked with DNA fragment and application of DNA fragment | |
| CN114752702A (en) | Molecular marker BnCa-2C2 closely linked with rape calcium content trait QTL and application thereof | |
| CN110373487B (en) | InDel marker related to peppery taste character of pepper and application thereof | |
| CN108546778B (en) | SNP molecular marker for detecting powdery mildew resistance of cucumber and application thereof | |
| CN106350515B (en) | With the molecular labeling SV3 of Gene For Resistance To Rice Bacterial Blight close linkage | |
| CN109825619A (en) | With the molecular labeling R060939 of resistance gene of rice blast Pigm close linkage | |
| CN114763549B (en) | Highland barley drought-resistant related gene, and kit and method for identifying drought-resistant highland barley | |
| CN113637785B (en) | DNA fragment and SNP molecular marker related to kernel yield of camellia seeds and application thereof | |
| CN114369674B (en) | SNP marker linked with Indian pumpkin short vine gene CmDw-1, primer, kit and application thereof | |
| CN112626256B (en) | Sesame seedling stage drought tolerance molecular marker and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |